A primer set of a kasp molecular marker related to low temperature tolerance of soybean germination stage and application thereof

Abstract

The application relates to a primer set of a KASP molecular marker related to a low-temperature tolerance trait of a soybean germination stage and application thereof, and belongs to the field of soybean molecular breeding. A primer set of a KASP molecular marker closely linked to a low-temperature tolerance trait of a soybean germination stage on chromosome 10 and application thereof are disclosed. The marker is S10_41301729, which is obtained by resequencing 308 soybean materials and combining genotype correlation analysis of the low-temperature tolerance phenotype of the germination stage. The molecular marker primer set can be used for quickly and accurately screening and identifying a low-temperature tolerance soybean strain of the germination stage, thereby effectively improving the breeding efficiency of a low-temperature tolerance soybean variety, and providing technical support for the stability of soybean production in areas easily affected by low temperature.

Description

Technical Field

[0001] This invention relates to the field of molecular genetics breeding, and in particular to a primer set of KASP molecular markers closely linked to the low-temperature tolerance trait during soybean germination and its application. Background Technology

[0002] Northeast my country is a major soybean producing region and one of the areas most significantly affected by global climate change. Low-temperature stress, as a major abiotic stress factor, severely impacts soybean growth, development, and yield. Especially during the sowing period, periods of low temperature often severely inhibit soybean seed germination, limiting not only soybean yield but also the distribution and promotion of soybean varieties. Therefore, screening soybean varieties tolerant to low temperatures during germination and identifying low-temperature-tolerant genes are of great significance for enhancing the cold damage resistance of soybeans in Northeast China and ensuring stable soybean yields in the region.

[0003] Competitive allele-specific PCR (KASP) technology, with its advantages of low cost and high precision, has become one of the preferred techniques for genotyping in molecular breeding. However, there is currently a lack of KASP molecular markers specifically targeting the low-temperature tolerance trait in soybean germination, which are fully validated and tightly linked to the phenotype. Therefore, developing efficient, stable, and applicable KASP molecular markers for identifying low-temperature tolerance traits in soybean germination is of paramount technical value and promising industrial application prospects for achieving rapid and accurate marker-assisted selection of this trait and accelerating the breeding process of new low-temperature tolerant soybean varieties. Summary of the Invention

[0004] This invention provides a primer set and its application for KASP molecular markers, based on resequencing data and germination-stage low-temperature tolerance phenotype data of 308 soybean accessions, which can be used to detect or assist in the detection of low-temperature tolerance traits during soybean germination. The molecular marker primer set is used to detect the 101st bp of SEQ ID NO.1. This invention shows significant genotyping effects on samples, and can sensitively, efficiently, and cost-effectively predict the low-temperature tolerance of soybeans during germination. It is beneficial for rapidly scanning germplasm resources, assisting in molecular breeding of low-temperature tolerant soybeans, and further shortening the breeding process.

[0005] The technical solutions of the present invention include, but are not limited to, the following: This invention provides a primer set for a KASP molecular marker associated with low-temperature tolerance during soybean germination, wherein the KASP molecular marker is S10_41301729; the nucleotide sequence of S10_41301729 is shown in SEQ ID NO.1, and there is a T / C base mutation at position 101 bp.

[0006] The present invention also provides a primer set for detecting the KASP molecular marker, comprising a forward primer F1 with a nucleotide sequence as shown in SEQ ID NO.2, a forward primer F2 with a nucleotide sequence as shown in SEQ ID NO.3, and a reverse primer R with a nucleotide sequence as shown in SEQ ID NO.4.

[0007] The present invention also provides a detection kit for the KASP molecular marker, comprising the primer set described above.

[0008] The present invention also provides an application of the primer set or the detection kit described herein, for any of the following applications: (1) Application in identifying the low-temperature tolerance of soybeans during germination; (2) Application in screening soybean varieties or lines that are resistant to low temperatures during the germination period.

[0009] This invention also provides a method for identifying the low-temperature tolerance of soybeans during germination, comprising the following steps: Using the genomic DNA of the soybean sample to be tested as a template, the template is subjected to a KASP reaction using the primer set or the detection kit described above, and the amplification results are used to determine the low temperature tolerance of soybeans during germination.

[0010] Furthermore, if the amplification results show that the genotype of S10_41301729 is TT, then the soybean sample to be tested is determined to be a low-temperature resistant material during germination; if the genotype is CC, then the soybean sample to be tested is determined to be a sensitive material.

[0011] The beneficial effects of the present invention include, but are not limited to: This invention develops a KASP molecular marker primer set associated with low-temperature tolerance during soybean germination based on 308 resequencing data and phenotypes. This set can detect or assist in the detection of low-temperature tolerance during soybean germplasm germination at low cost, high efficiency, and high accuracy. It is beneficial for assisting in the molecular breeding of low-temperature tolerant soybeans and further shortening the breeding process. Attached Figure Description

[0012] Figure 1 Genome-wide association analysis results of relative germination rate under 6°C low-temperature stress during germination in 308 natural soybean accessions. A: Manhattan plot, where the red dashed line represents the significance threshold -log 10 ( P ) = 5.57; B: QQ image; Figure 2 Analysis of the differences in low-temperature resistance during the germination period of different haplotypes of Glyma.10G179700; Figure 3 Sequence alignment of the S10_41301729 variant site for different materials; Figure 4The results of SNP genotyping of different soybean germplasms using KASP molecular markers. Detailed Implementation

[0013] The present invention will be further described below through specific embodiments. The purpose of this description is to illustrate the technical solutions of the present invention in detail, rather than to limit the scope of application of the present invention. The embodiments are intended to provide a reference for those skilled in the art to understand and implement the present invention, and improvements can be made without departing from the spirit and scope of the present invention. They should not be construed as limiting the present invention in any way. Unless otherwise specified, the experimental materials used in the following embodiments were all purchased from conventional biochemical reagent stores.

[0014] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0015] Example 1: Acquisition of SNP loci related to low-temperature tolerance during soybean germination. This invention performs a genome-wide association study (GWAS) on phenotypic data of germination at 6°C on 308 soybean resequencing materials. The soybeans included 120 local varieties and 188 improved varieties. The phenotypic data was relative germination rate (RGR). Manhattan plots and QQ plots of the corresponding indicators were plotted using the GLM model in the GAPIT package in R. Figure 1 A, Figure 1 As shown in B, SNP sites exceeding the threshold were found on chromosome 10, as shown in Table 1. Gene screening was performed using the 100 kb region upstream and downstream of this region as candidate intervals. Functional annotation of genes within this region preliminarily identified Glyma.10G179700 as a candidate gene for low-temperature resistance during soybean germination. Only one mutation site, S10_41301729 (T / C), was detected in this gene, resulting in different haplotypes. Haplotype analysis showed significant differences in the relative germination rate among different haplotypes of this gene, such as... Figure 2 As shown.

[0016] Table 1. Loci significantly associated with RGR in natural soybean populations detected using the GLM model.

[0017] The S10_41301729 site is located at the 101st base of the nucleotide sequence shown in SEQ ID NO.1; the relative germination rate of soybeans with the TT genotype at this site is significantly higher than that of soybeans with the CC genotype.

[0018] SEQ ID NO.1: TTCAGCATTACGCACGCGTTGTCTTAGAGTGCACGGTGAAGGGAGATGGGAAGTTGATTCTCTCAGGTCAGAGGTTAAGTCAAATTCCACCACTTACAAA T ATGTCCCGGAAAATTTGGGCACCAAGTTTGTTTGGATGAAGAAAAATAATAGTACCCAGGATCCACAGGCTAGAAGCATGATACAATTTATGTCATT The above data on low-temperature tolerance phenotypes during soybean germination were obtained using the following methods: Ninety mature and plump seeds were randomly selected from thoroughly mixed clean seeds, with 30 seeds per group and three replicates. The seeds were placed on filter paper in petri dishes, and a shallow layer of sterile distilled water was added to maintain moisture. The dishes were incubated at 25°C in the dark for 12 hours to promote imbibition. The treatment groups were then added with an appropriate amount of sterile deionized water at 6°C and transferred to a 6°C constant temperature incubator in the dark. The control group was cultured in a 25°C tissue culture room in the dark. Germination counts were monitored daily. The experiment ended after 8 days, and the relative germination rate was calculated. The specific calculation method is as follows:

[0019] In the formula: X The number of germinations under stress treatment; CK The number of germinations is for the control treatment.

[0020] Example 2: Primer design for KASP molecular markers To verify the accuracy of the SNP variant site S10_41301729, the PCR products amplified from samples P06-19, Harbin Zhongli Black, Huangjinyuan, and Xiaoli Mochi beans were sequenced. The results are as follows: Figure 3 As shown, S10_41301729 exhibits a T / C variation. Based on the SNP mutation sites described in Example 1, a KASP molecular marker primer set was designed using the website (https: / / tools.goodbtk.com / SNPPrimer). The set consisted of three primers: two specific forward primers, F1 and F2, and one universal reverse primer, R. F1 contained the FAM fluorescent adapter sequence, and F2 contained the HEX fluorescent adapter sequence, both underlined. The designed primers were synthesized by Sangon Biotech (Shanghai), and the specific sequences are shown in Table 2.

[0021] Table 2 Specific primers for KASP

[0022] Example 3: Method for detecting different soybean SNP locus genotypes and identifying soybean low-temperature tolerance during germination using KASP molecular markers. One hundred soybean varieties were randomly selected, and genomic DNA was extracted from the soybean samples using the CTAB method. The samples were then tested using the primer set described in Example 2. The KASP reaction system was prepared according to the FLU-ARMS for KASP 2× PCRMix V5F kit (BGH1001RV5F) (Guangzhou Good Biotechnology Co., Ltd.). The KASP amplification system consisted of: 1 μL of 100 ng / μL DNA template, 5 μL of FLU-ARMS 2×PCR Mix, 0.1 μL of upstream genotyping primer F1 (10 μM), 0.1 μL of upstream genotyping primer F2 (10 μM), 0.3 μL of downstream universal primer R (10 μM), and 3.5 μL of ddH2O. The KASP reaction conditions were: 95℃ for 5 min; 95℃ for 5 sec, 58℃ for 20 sec, for a total of 38-45 cycles; 30℃ for 30 sec.

[0023] After the reaction was completed, the fluorescence data of the reaction products were read using a CFX96 Optics Module real-time quantitative PCR instrument. The low-temperature tolerance of soybean seeds during germination was determined based on genotype, and the results are as follows: Figure 4 As shown, the designed molecular marker primers can clearly separate two different genotypes after PCR.

[0024] Specifically, KASP molecular markers were designed for the SNP site S10_41301729, which is significantly associated with the relative germination rate of soybeans during the low-temperature tolerance period. Figure 4 The genotyping results for this locus are shown, where blue squares represent soybean germplasm with the CC genotype and orange dots represent soybean germplasm with the TT genotype. The relative germination rate of soybean germplasm with the TT genotype is significantly higher than that of soybean germplasm with the CC genotype. Figure 4 The selection efficiency for low-temperature resistant resources during the germination period was 98%, while the selection efficiency for sensitive resources was 47%.

[0025] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of a KASP molecular marker primer set related to low-temperature tolerance during soybean germination: characterized in that, For use in any of the following applications: (1) Application in identifying the low-temperature tolerance of soybeans during germination; (2) Application in screening soybean varieties or lines that are resistant to low temperatures during germination; The low-temperature tolerance trait during the germination period refers to the relative germination rate during the low-temperature tolerance period. The KASP molecular marker is S10_41301729, and its nucleotide sequence is shown in SEQ ID NO.1, with a T / C base mutation at position 101 bp; If the genotype of the KASP molecular marker is TT, the soybean sample to be tested is determined to be a low-temperature resistant material during germination; if the genotype of the KASP molecular marker is CC, the soybean sample to be tested is determined to be a low-temperature sensitive material during germination. The primer set for detecting the KASP molecular marker includes forward primer F1 with the nucleotide sequence shown in SEQ ID NO.2, forward primer F2 with the nucleotide sequence shown in SEQ ID NO.3, and reverse primer R with the nucleotide sequence shown in SEQ ID NO.

4.

2. Application of a detection kit for KASP molecular markers related to low-temperature tolerance during soybean germination: characterized in that, For use in any of the following applications: (1) Application in identifying the low-temperature tolerance of soybeans during germination; (2) Application in screening soybean varieties or lines that are resistant to low temperatures during germination; The low-temperature tolerance trait during the germination period refers to the relative germination rate during the low-temperature tolerance period. The KASP molecular marker is S10_41301729, and its nucleotide sequence is shown in SEQ ID NO.1, with a T / C base mutation at position 101 bp; If the genotype of the KASP molecular marker is TT, the soybean sample to be tested is determined to be a low-temperature resistant material during germination; if the genotype of the KASP molecular marker is CC, the soybean sample to be tested is determined to be a low-temperature sensitive material during germination. The primer set for detecting the KASP molecular marker includes forward primer F1 with the nucleotide sequence shown in SEQ ID NO.2, forward primer F2 with the nucleotide sequence shown in SEQ ID NO.3, and reverse primer R with the nucleotide sequence shown in SEQ ID NO.4; The detection kit comprises the primer set as described in claim 1.

3. A method for detecting or assisting in the detection of low-temperature tolerance during soybean germination, characterized in that, Includes the following steps: Using the genomic DNA of the soybean sample to be tested as a template, the template is amplified by KASP reaction using the primer set described in claim 1 or the detection kit described in claim 2, and the amplification results are used to determine the low temperature resistance of soybeans during germination. The KASP molecular marker is located at the 101st base of the sequence shown in SEQ ID NO.1, and there is a T / C base mutation at the 101st base. If the genotype of the KASP molecular marker is TT, the soybean sample to be tested is determined to be a low-temperature resistant material during germination; if the genotype of the KASP molecular marker is CC, the soybean sample to be tested is determined to be a low-temperature sensitive material during germination.

Images