Application of carbonic anhydrase IV in prevention and treatment of coronary microangiopathy

Abstract

The invention belongs to the technical field of biological medicine and molecular biology, and particularly relates to application of carbonic anhydrase IV in prevention and treatment of coronary microangiopathy. The research proves that the carbonic anhydrase IV has the effects of maintaining the activity of human microvascular endothelial cells, promoting the development of heart microvessels and protecting the barrier function of the microvessels. It is shown that the carbonic anhydrase IV can play a role in inhibiting CMVD lesion by preventing heart microvascular density reduction and inhibiting heart microvascular permeability increase in the CMVD process, and therefore the carbonic anhydrase IV has good potential practical application value.

Description

Technical Field

[0001] This invention belongs to the fields of biomedicine and molecular biology, specifically relating to the application of carbonic anhydrase IV in the prevention and treatment of coronary microvascular disease (CMVD). Background Technology

[0002] The information disclosed in the background section of this invention is intended only to enhance the understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] CMVD is a clinical syndrome characterized by exertional angina or objective evidence of myocardial ischemia, resulting from structural and / or functional abnormalities of the precoronary arterioles and arterioles under the influence of multiple pathogenic factors. It is characterized by high incidence, low diagnosis rate, and high recurrence rate. Therefore, the screening and diagnosis of CMVD urgently needs attention. For decades, researchers and clinicians have generally considered stenosis or occlusion of the subepicardial large vessels as the "culprit" of ischemic heart disease, and the most direct treatment is vasodilation or recanalization of the blocked vessels. However, for some patients, even if the blocked coronary arteries are successfully opened, symptoms such as chest tightness and chest pain may still occur without vasospasm or thrombosis. Angiography often reveals slow blood flow in the coronary arteries, or even coronary "no-reflow" phenomena. In recent years, more and more scholars have found that severe CMVD is the main cause of this phenomenon.

[0004] CMVD primarily affects the complex and delicate network of small blood vessels within the myocardium, which play a crucial role in regulating blood flow and ensuring myocardial oxygen supply. In recent years, CMVD has gained increasing attention as a significant pathogenic factor for various cardiovascular diseases, particularly its role in ischemic heart disease and heart failure. Studies show that CMVD is present in over 50% of chest pain patients with no coronary artery obstruction on angiography, predominantly women and those with multiple cardiovascular risk factors. Furthermore, CMVD is a major cause of non-obstructive myocardial infarction and poor prognosis, accounting for 5%-15% of acute ST-segment elevation and non-ST-segment elevation myocardial infarction cases. However, due to a lack of understanding of the mechanisms underlying CMVD, effective treatments for this disease are currently lacking.

[0005] Numerous factors contribute to coronary microvascular disease (CMVD), among which alterations in the structure and function of coronary microvessels form the pathological basis for CMVD. Under normal physiological conditions, vascular endothelial cells are distributed in a monolayer of cells in the innermost layer of blood vessels. They are highly active and maintain vascular tone and structure by regulating vasodilation, vasoconstriction, and growth. In addition, vascular endothelial cells act as a barrier, preventing the adhesion of coagulation components and the invasion of microorganisms and immune cells, thereby avoiding thrombus formation and protecting blood vessels. Microvascular endothelial cells play a crucial role in microvascular homeostasis, which is particularly important for myocardial capillaries.

[0006] In recent years, significant progress has been made in the field of vascular biology with the application of high-resolution technologies such as single-cell RNA sequencing (scRNA-seq). These studies have revealed the tissue specificity of endothelial cells and the heterogeneity of gene expression within the same tissue. In previous studies, the inventors successfully screened proteins specifically expressed by cardiac microvascular endothelial cells by performing scRNA-seq on endothelial cells of Bama miniature pig hearts. Among them, carbonic anhydrase IV (CA4) protein was significantly reduced in myocardial tissue of patients with heart failure and mice after myocardial infarction caused by acute coronary artery occlusion, suggesting that CA4 may be involved in the ischemic heart disease process. CA4 is an isoenzyme of the carbonic anhydrase family, with 260 amino acids, and is anchored to the plasma membrane via phosphatidylinositol glycerol bonds. Previous studies have confirmed that CA4 can catalyze reversible carbon dioxide hydration and plays an important role in maintaining pH balance. Existing research has shown that CA4 interacts with key ion transport proteins (such as chloride / bicarbonate exchangers and Na+ / bicarbonate cotransporters [NBC1]), promoting bicarbonate transport and regulating pH homeostasis. Besides heart tissue, CA4 has also been found expressed in tissues such as the brain, lungs, eyes, and kidneys. Previous studies have shown that CA4 can interact with Na+. + Bicarbonate cotransporters form functional complexes that maintain pH balance in the retinal or retinal pigment epithelial environment. CA4 also plays an important role in maintaining renal pH balance, and mutations in its gene can lead to renal tubular acidosis. CA4 is also involved in tumorigenesis, but its role varies in different types of tumors. However, the inventors' research has found that the role of CA4 in myocardial microvessels and its mechanism of involvement in CMVD remain unknown. Summary of the Invention

[0007] To address the shortcomings of existing technologies, the present invention aims to provide the application of carbonic anhydrase IV in the prevention and treatment of CMVD. Specifically, the present invention has demonstrated through research the role of CA4 in maintaining the activity of human cardiac microvascular endothelial cells (CMVECs), promoting cardiac microvascular development, and protecting microvascular barrier function. This indicates that CA4 can inhibit CMVD by preventing the reduction of cardiac microvascular density and inhibiting the increase of cardiac microvascular permeability during cardiac lesions.

[0008] Based on the above research results, this invention is thus completed.

[0009] The technical solution of the present invention is as follows:

[0010] In a first aspect, the invention provides the use of substances for detecting the carbonic anhydrase IV gene and its expression products in the preparation of products for screening, diagnosing, detecting, monitoring, or predicting the progression of CMVD.

[0011] The CMVD includes both CMVD without and with myocardial infarction.

[0012] The carbonic anhydrase IV gene and its expression product are derived from microvascular endothelial cells in the myocardial tissue of the subjects.

[0013] A second aspect of the invention provides the use of at least one of the following a1)-a5): (The original text contains several inconsistencies and unclear sentences, making a direct translation impossible.)

[0014] a1) Prepare products that damage cardiac function and reduce blood supply to the heart's blood vessels;

[0015] a2) Prepare products that increase the area of ​​myocardial infarction;

[0016] a3) Prepare products that disrupt the barrier function of microvessels and promote the infiltration of inflammatory cells into myocardial tissue;

[0017] a4) Prepare products that affect the morphology of cardiac microvascular endothelial cells, reduce the activity of cardiac microvascular endothelial cells, and increase the permeability of cardiac microvascular endothelial cells;

[0018] a5) Construct CMVD-related disease cell or animal models of CMVD-related diseases.

[0019] Among them, in a4), the morphology of cardiac microvascular endothelial cells is specifically affected by the elongated cell shape and the presence of obvious gaps between cells;

[0020] Furthermore, in a4), the product also has the effect of reducing the expression of VE-Cadherin and ESAM, intracellular junction proteins in cardiac microvascular endothelial cells.

[0021] A third aspect of the invention provides the use of substances that promote the carbonic anhydrase IV gene and its expression products and / or increase its activity in at least one of the following b1)-b2):

[0022] b1) Prepare products that maintain the activity of myocardial microvascular endothelial cells, promote the development of cardiac microvessels, and protect the function of the microvascular barrier;

[0023] b2) Prepare products that prevent the reduction of cardiac microvascular density and inhibit the increase of cardiac microvascular permeability during CMVD, thereby inhibiting CMVD lesions;

[0024] In b1), the product also has the function of maintaining the full morphology and tight arrangement of myocardial microvascular endothelial cells;

[0025] In b2), the product also has the effect of increasing the expression of VE-Cadherin and ESAM in myocardial microvascular endothelial cells.

[0026] Furthermore, the CMVD lesions can specifically be CMVD without or with myocardial infarction.

[0027] A fourth aspect of the present invention provides a method for treating CMVD lesions, the method comprising: administering to a subject a substance that promotes the expression of the carbonic anhydrase IV gene and its expression products and / or increases its activity.

[0028] Furthermore, the CMVD lesions can specifically be CMVD without or with myocardial infarction.

[0029] The beneficial technical effects of one or more of the above technical solutions are as follows:

[0030] The above-mentioned technical solution is the first to demonstrate the role of CA4 in maintaining CMVEC activity, promoting cardiac microvascular development, and protecting microvascular barrier function. This suggests that CA4 can inhibit CMVD lesions by preventing the reduction of cardiac microvascular density and inhibiting the increase of cardiac microvascular permeability during CMVD. Therefore, targeting CA4 shows promise as a potential target for the prevention and treatment of CMVD lesions, possessing significant potential practical application value. Attached Figure Description

[0031] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0032] Figure 1This invention presents single-cell RNA sequencing (scRNA-seq) results to demonstrate the genetic heterogeneity of cardiac vascular endothelial cells in Bama miniature pigs and the specific expression of CA4 in cardiac microvascular endothelial cells. A, Schematic diagram of the locations of cardiac blood vessels of different diameters from which endothelial cells were extracted; B, scRNA-seq heatmap showing the heterogeneity of gene expression in cardiac vascular endothelial cells; C, t-SNE plot showing different subtypes of cardiac vascular endothelial cells; D, t-SNE plot showing the expression of CA4 in different subtypes of cells.

[0033] Figure 2 This embodiment of the invention demonstrates the expression of CA4 in mouse and human myocardial tissue through immunofluorescence staining. The top image shows a section of mouse myocardial tissue, with a scale bar of 100 micrometers; the bottom image shows a section of human myocardial tissue, with a scale bar of 50 micrometers. Red indicates vascular endothelial cells, green indicates CA4 protein, and blue indicates the cell nucleus.

[0034] Figure 3 This diagram illustrates the expression of CA4 in the heart tissues of normal individuals and patients with heart failure, as described in this invention. A, HE staining results show the morphology and arrangement of cells in the heart tissues of normal individuals and patients with heart failure; B, immunofluorescence staining results show the expression and distribution of CA4 in the heart tissue. CT, heart tissue of normal individuals; HF, heart tissue of patients with heart failure. The scale bar in the upper image is 200 μm, and the scale bar in the lower image is 50 μm.

[0035] Figure 4 This invention illustrates the changes in CA4 expression in mouse myocardial tissue after myocardial infarction. A1, TTC and HE staining results of C57 mouse myocardial tissue; A-ii, statistical results of myocardial infarction area; B, immunofluorescence staining showing the expression and distribution of CA4 in myocardial tissue; C, Real-time RT-PCR and Western blotting results detecting CA4 at mRNA and protein levels in different groups of mouse myocardial tissue. Sham, sham-operated group; MI, myocardial infarction group. *, p<0.05, n=6.

[0036] Figure 5 This invention illustrates the effect of endothelial cell-specific CA4 deficiency on cardiac function and cardiac surface blood flow signals in mice. A1), echocardiographic results; A-ii), statistical results of left ventricular ejection fraction; Bi), detection results of cardiac surface blood flow signals using a laser speckle imaging system; B-ii), statistical results of left ventricular surface blood flow signals. Sham, sham-operated group; MI, acute myocardial infarction group. *, p<0.05, **, p<0.01, n=6. Figure 6This invention illustrates the effect of endothelial cell-specific CA4 deficiency on the area of ​​myocardial infarction in mice. A, TTC staining results of cardiac tissue after myocardial infarction; white represents the infarcted area, and red represents the non-infarcted area. B, Statistical results of myocardial infarction area. *, p<0.05; **, p<0.01, n=6.

[0037] Figure 7 This invention illustrates the effect of endothelial cell-specific CA4 deficiency on microvascular density in mouse hearts. A, Immunofluorescence staining showing CA4 expression and microvascular density in myocardial tissue of mice with different genotypes; B, Statistical results of vascular density in myocardial tissue. Red indicates vascular endothelial cells, green indicates CA4 protein, and blue indicates cell nuclei. *, p<0.05, n=6.

[0038] Figure 8 This invention illustrates the effect of endothelial cell-specific CA4 deficiency on microvascular leakage and inflammatory factor infiltration in mouse cardiac tissue. A1) Evans blue injection experiment showing microvascular leakage in cardiac tissue; red represents Evans blue, green represents microvessels; A-ii) Statistical analysis of Evans blue-positive area; B1) Immunohistochemistry showing CD68+ inflammatory cells in myocardial tissue; B-ii) Statistical results of inflammatory cells infiltrating myocardial tissue. *, p<0.05; **, p<0.01, n=6.

[0039] Figure 9 This invention illustrates the effects of CA4 intervention on the morphology, activity, and cell permeability of human cardiac microvascular endothelial cells. A1-ii) Effect of CA4 gene overexpression on intracellular CA4 protein expression levels; A2-ii) Effect of CA4 gene interference on intracellular CA4 protein expression levels; B) Effect of intracellular CA4 expression intervention on cell culture supernatant pH; C) Effect on cardiac microvascular endothelial cell morphology; D) Effect on cell activity; E) Effect on monolayer cell permeability; F) Effect on the expression of cell junction proteins VE-Cadherin (Fi) and ESAM (F-ii). *, p < 0.05; **, p < 0.01, n = 6. Detailed Implementation

[0040] It should be noted that the following detailed description is illustrative and intended to provide further explanation of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0041] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof.

[0042] The present invention will now be further illustrated with specific examples. These examples are for illustrative purposes only and do not limit the scope of the invention. Unless otherwise specified, experimental conditions not explicitly stated in the examples are generally performed under conventional conditions or as recommended by the reagent company. Unless otherwise specified, all reagents and consumables used in the following examples are commercially available.

[0043] In a typical embodiment of the present invention, the use of a substance for detecting the carbonic anhydrase IV gene and its expression product in the preparation of products for screening, diagnosing, detecting, monitoring or predicting the progression of CMVD is provided.

[0044] The CMVD includes both CMVD without and with myocardial infarction.

[0045] The carbonic anhydrase IV gene expression product clearly includes carbonic anhydrase IV.

[0046] The product contains substances that detect the transcription of carbonic anhydrase IV based on high-throughput sequencing and / or quantitative PCR and / or probe hybridization; or substances that detect the expression of carbonic anhydrase IV in a sample based on immunoassay.

[0047] In another specific embodiment of the present invention, the use of substances that inhibit the carbonic anhydrase IV gene and its expression product and / or reduce its activity is provided in at least one of the following a1)-a5):

[0048] a1) Prepare products that damage cardiac function and reduce blood supply to the heart's blood vessels;

[0049] a2) Prepare products that increase the area of ​​myocardial infarction;

[0050] a3) Prepare products that disrupt the barrier function of microvessels and promote the infiltration of inflammatory cells into myocardial tissue;

[0051] a4) Prepare products that affect the morphology of cardiac microvascular endothelial cells, reduce the activity of cardiac microvascular endothelial cells, and increase the permeability of cardiac microvascular endothelial cells;

[0052] a5) Construct CMVD-related disease cell or animal models of CMVD-related diseases.

[0053] Among them, in a4), the morphology of cardiac microvascular endothelial cells is specifically affected by the elongated cell shape and the presence of obvious gaps between cells;

[0054] Furthermore, in a4), the product also has the effect of reducing the expression of VE-Cadherin and ESAM, intracellular junction proteins in cardiac microvascular endothelial cells.

[0055] The above products can be pharmaceuticals or experimental reagents for non-pharmaceutical purposes, and these experimental reagents can be used for basic research.

[0056] The substances that inhibit the carbonic anhydrase IV gene and its expression products and / or reduce its activity include, but are not limited to, RNA interference molecules or antisense oligonucleotides, small molecule inhibitors, shRNA, siRNA, substances that carry out lentiviral infection or gene knockout, and specific antibodies against carbonic anhydrase IV itself or its upstream and downstream molecules, including anti-carbonic anhydrase IV antibodies.

[0057] In another specific embodiment of the present invention, the use of substances that promote the carbonic anhydrase IV gene and its expression products and / or increase its activity is provided in at least one of the following b1)-b2):

[0058] b1) Prepare products that maintain the activity of myocardial microvascular endothelial cells, promote the development of cardiac microvessels, and protect the function of the microvascular barrier;

[0059] b2) Prepare products that prevent the reduction of cardiac microvascular density and inhibit the increase of cardiac microvascular permeability during CMVD, thereby protecting against CMVD lesions;

[0060] In b1), the product also has the function of maintaining the full morphology and tight arrangement of myocardial microvascular endothelial cells;

[0061] In b2), the product also has the effect of increasing the expression of VE-Cadherin and ESAM in myocardial microvascular endothelial cells.

[0062] Furthermore, the CMVD lesions can specifically be CMVD without or with myocardial infarction.

[0063] The substances that promote the carbonic anhydrase IV gene and its expression products and / or enhance its activity include, but are not limited to, promoters that upregulate carbonic anhydrase IV expression, plasmids containing the carbonic anhydrase IV gene, or lentiviruses; they also include compound promoters.

[0064] According to the present invention, when the product is a drug, the drug further includes at least one inactive pharmaceutical ingredient.

[0065] The inactive components of the drug can be pharmaceutically commonly used carriers, excipients, and diluents. Furthermore, according to conventional methods, it can be formulated into oral, topical, suppository, and sterile injectable solutions such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and sprays.

[0066] The non-pharmaceutical active ingredients that may be included, such as carriers, excipients, and diluents, are well known in the art, and those skilled in the art can determine that they meet clinical standards.

[0067] In another specific embodiment of the present invention, the drug can be administered to humans and non-human mammals, such as mice, rats, guinea pigs, rabbits, dogs, monkeys, orangutans, etc.

[0068] In another specific embodiment of the present invention, a method for treating CMVD lesions is provided, the method comprising: administering to a subject a substance that promotes the expression of the carbonic anhydrase IV gene and its expression product and / or increases its activity.

[0069] Furthermore, the CMVD lesions can specifically be CMVD without or with myocardial infarction.

[0070] The following examples further illustrate the present invention, but do not constitute a limitation thereof. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention. The following examples illustrate test methods with specific conditions, which are generally performed under conventional conditions.

[0071] Example

[0072] Materials and methods:

[0073] 1. Feeding and Produce Acquisition of Bama Piglets

[0074] Three-month-old Bama miniature pigs (half male and half female, weighing 9-11 kg) were purchased from Tianjin Bainong Experimental Animal Breeding Technology Co., Ltd. The animals should have free access to water and be fed twice daily. The ambient temperature should be controlled at 20-22℃, and the humidity maintained at 40%-60%. The cages should be rinsed with clean water daily to keep them clean.

[0075] Following euthanasia under deep anesthesia (3% sodium pentobarbital, 30 mg / kg, intraperitoneal injection), the heart was rapidly removed and immediately flushed with ice-cold phosphate-buffered saline (PBS, pH 7.4) to remove excess blood. Based on vessel diameter, the intracardiac arteries were divided into five segments: the aorta, the main left coronary artery, the proximal and distal segments of the left anterior descending artery (LAD), and the distal myocardium.

[0076] 2. Single-cell RNA sequencing (scRNA-seq)

[0077] The previously collected heart tissue samples were cut into 1mm pieces. 3 The cells were divided into small pieces and digested in a digestive solution. The digested cell suspension was then filtered through 100μm and 40μm cell filters, and the filtered cell suspension was sorted by magnetic beads (Medini GmbH, Germany) to obtain endothelial cells.

[0078] Single-cell sequencing was performed using the 10x Genomics Chromium system. This system captures single-cell RNA by encapsulating individual cells with barcoded gel beads (GEMs-in-Emulsion) within droplets. After cell lysis, the released RNA molecules bind to the barcode and are reverse transcribed to generate cDNA. Subsequently, the cDNA undergoes PCR amplification and library preparation steps to construct a library suitable for high-throughput sequencing. The library was sequenced using the NovaSeq 6000 platform to generate high-quality single-cell transcriptome data. The sequencing data was processed using Cell Ranger software (10xGenomics, USA), including sequencing read alignment, gene expression quantification, and differential gene expression analysis among different cell subpopulations, thus providing transcriptome information at the single-cell level for research.

[0079] 3. Cell Culture

[0080] Human cardiac microvascular endothelial cells (CMVECs) were purchased from Zhongqiao Xinzhou Biotechnology Co., Ltd. (ZQ0882, Shanghai). Cells were grown at a concentration of 1×10⁶ cells / year. 5 Cells were seeded at a density of 1 / ml in fibronectin-coated culture flasks (plates) in endothelial cell culture medium (1001, Sciencell) containing 5% FBS, 1% cell growth supplement, and 1x penicillin / streptomycin solution. After 48 hours of cell culture, images were acquired and morphological analysis was performed using an inverted phase-contrast microscope (Ti2, Nikon) equipped with a 20x objective lens.

[0081] 4. Viral transfection

[0082] 1×10 5Cells / well were passaged into 6-well tissue culture plates and cultured for 24 hours. The required viral volumes for the following lentiviral vectors were calculated using a multiplicity of infection (MOI) of 20: control lentiviral vector (LV-NC), lentiviral vector containing the human CA4 gene (gene ID: 762) sequence (LV-CA4), lentiviral vector expressing short hairpin (sh) RNA targeting the control sequence TTCTCCGAACGTGTCACGT (LV-shNC), lentiviral vector expressing shRNA targeting the CAIV gene sequence GGACCCTGAAGACGAAATTGC (LV-shCA4-1), and lentiviral vector targeting the CAIV gene sequence GCTGTACTACGACAAGGAACA (LV-shCA4-2). The media were then added to fresh medium containing 5 μg / ml polybrene. The medium was replaced with normal medium 48 hours after transfection. Starting at 72 hours, 5 μg / ml puromycin was added to the medium and changed daily to screen for stably transfected cells. After one week, cell growth was maintained in medium containing 1 μg / ml puromycin. The target sequences and primer information for shRNA are detailed in Table 1-2.

[0083] 5. Mouse feeding

[0084] SPF-grade male C57BL / 6J wild-type mice were purchased from Beijing Vital River Laboratory Animal Co., Ltd. Tie2-cre transgenic mice and mice with flanking flotation sites on the CA4 gene (CA4f / f) were obtained from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd., both with the C57BL / 6J genetic background. All mice were housed under standardized conditions (12-hour light / dark cycle, temperature 22-24℃, humidity 35%-60%) with free access to food and water. Twelve-week-old male mice were used for experiments.

[0085] 6. Construction of endothelial-specific CA4 gene knockout mice

[0086] We first crossed male Tie2-cre mice with female CA4f / f mice to produce Tie2-Cre;CA4f / + mice. To obtain CA4 conditional knockout (Tie2-cre;CA4f / f or CA4ECKO mice), we crossed male Tie2-Cre;CA4f / + mice with female CA4f / f mice. When the newborn mice were 5-7 days old, they were marked and their DNA was obtained for genotyping.

[0087] 7. Establishment of a myocardial infarction model

[0088] Twelve-week-old male mice were fasted for 12 hours before surgery. Anesthesia was administered with 5% isoflurane, with maintenance anesthesia maintained at 2% isoflurane. The mice were fixed in a supine position, and the surgical area on the left chest was shaved and disinfected. A longitudinal incision of approximately 1.5 cm was made about 1-2 mm from the left sternal border, and a vertical everted mattress suture was left at the incision site. The chest wall muscles were bluntly dissected layer by layer, and the thoracic cavity was quickly accessed through the 3rd or 4th intercostal space. Hemostatic forceps were used to open the intercostal spaces, and the heart was gently squeezed out of the opening by the left hand in conjunction with the heartbeat. The left atrial appendage was ligated 1-2 mm below the left atrial appendage and 0.5 mm beside the pulmonary conus, using an 8-0 suture needle to pass through the anterior descending coronary artery. The ligation was done with appropriate tightness, controlling the needle depth (so that the needle is barely visible) and the suture width (approximately 2 mm). After ligation, the heart was gently returned to the thoracic cavity, and the thoracic cavity was squeezed to expel air while simultaneously tightening the suture at the ligation incision site to complete the surgery. During the operation, the concentration of anesthetic was gradually adjusted to zero. After removing the mask, the mouse was placed on a constant temperature pad for about 3-5 minutes to wait for it to wake up.

[0089] 8. Echocardiography

[0090] Cardiac function was measured using a Doppler ultrasound detector according to a previously reported method. The procedure was as follows: Mice were anesthetized with 3% isoflurane to maintain a heart rate of approximately 300 beats / min. The mice were placed in a supine position on a thermostatic heating plate. Electrocardiograms were performed using limb leads connected to the animals' limbs, and the mice's body temperature was monitored and maintained at approximately 37°C. A high-resolution VisualSonics Vevo2100 system (VisualSonics, Canada) was used to record a long-axis view of the left ventricle and two-dimensional guided M-mode ultrasound images. Four consecutive heart rate measurements were taken after anesthesia, and the average of these measurements was analyzed. The left ventricular systolic diameter (LVIDs) and diastolic diameter (LVIDd) were measured to determine the ejection fraction (LVEF), LVEF(%) = [(LVIDd-LVIDs) / LVIDd] × 100%.

[0091] 9. Laser speckle blood flow detection

[0092] Mice anesthetized with sodium pentobarbital (40 mg / kg) were fixed supine on a temperature-controlled plate and endotracheally intubated via a PE-60 tube. Mechanical ventilation was maintained at a respiratory rate of 200 breaths per minute (RWD, R415). The tidal volume per breath was 0.3 mL, and the positive end-expiratory pressure was 3 cmH2O. The left third and fourth ribs and intercostal muscles were dissected to expose the heart. Warm (37°C) saline was dripped onto the exposed heart to keep it moist. A laser Doppler imager (PeriCam PSI System, Perimed, Sweden) was focused on the mouse heart to obtain a clear color image. Monitoring was performed continuously for 1 minute, and a region of interest (ROI) was established below the left ventricular ligation area; the ROI value represents the blood flow in the selected area. Throughout the monitoring process, the mice were kept anesthetized to maintain stable respiration and heart rate.

[0093] 10. Vascular permeability testing

[0094] Mice were administered 18 mg / kg of 1% Evans blue (Sigma, St Louis, MO, USA) (w / v) PBS (pH 7.4) via tail vein injection. Two hours later, mice were deeply anesthetized by intraperitoneal injection of 50 mg / kg sodium pentobarbital. The thoracic cavity was opened, and 100 μl of 1 mg / ml Dylight 488-modified tomato lectin (DL-1174-1, Vector Labs) was injected directly into the left ventricle of the mice over approximately 30 seconds, after which the heart continued to beat for about 1 minute. Subsequently, the left ventricle was perfused sequentially with 3 ml of pre-chilled PBS and 10 ml of pre-chilled 4% paraformaldehyde (PFA), followed by OCT embedding. After washing away the OCT from 6 μm frozen sections, the sections were mounted with an anti-fluorescence quencher containing DAPI and imaged using an Olympus VS200 slide scanner.

[0095] 11. TTC staining

[0096] Mice were deeply anesthetized by intraperitoneal injection of pentobarbital, and their blood vessels were perfused with pre-cooled saline to remove residual blood. The heart was harvested and quickly placed on a tissue sectioning mold. The tissue was frozen until slightly hardened, then removed and sectioned to a thickness of 1 mm, starting from the ligation site and moving towards the apex. The sections were incubated in 2% red tetrazolium solution at 37°C in the dark for 5 minutes, with gentle shaking to ensure thorough staining. After staining, the sections were gently pressed with a cryoplast for 2 seconds to prevent curling, and then fixed in 4% neutral formaldehyde solution for 6 hours before photography. Image-Pro Plus 6.0 software was used to analyze the pathological sections, measuring the area percentage of the infarcted region (white area) in each section. The average value of each mouse's sections was recorded as the area percentage of the infarcted region in that mouse's heart.

[0097] 12. HE staining

[0098] Mice deeply anesthetized with pentobarbital were perfused sequentially with physiological saline and then with 4% paraformaldehyde solution. Heart tissue was then harvested and fixed in 4% paraformaldehyde solution for 24 hours. The fixed tissue was then subjected to a series of alcohol dehydration processes, followed by xylene clearing and paraffin embedding to prepare 5μm tissue sections. After dewaxing and washing, the sections were stained in hematoxylin aqueous solution for 5 minutes. After washing, they were differentiated in 1% hydrochloric acid ethanol for 3 seconds, blued with tap water for 5 minutes, and stained with eosin for 3 minutes. The washed tissue sections were then dehydrated with anhydrous ethanol, cleared with xylene, mounted with neutral resin, and the extent of myocardial tissue damage was observed under a light microscope.

[0099] 13. Immunostaining of tissue sections

[0100] Paraffin sections of human myocardial tissue, after dewaxing and antigen retrieval, were blocked with 5% normal goat serum at room temperature for 1 hour, and then incubated overnight at 4°C with anti-human CD31 (1:500, Ab9498, Abcam, UK) and CA4 (1:500, ARG58375, Arigo, Taiwan) antibodies, respectively. After washing with PBS, Alexa antibodies were added. 647 goat anti-mouse secondary antibody (1:1000, ab150115, Abcam) and Alexa 488 goat anti-rabbit secondary antibody (1:1000, ab150077, Abcam) was incubated at room temperature for 1 hour. After the reaction was completed, the slides were washed with PBS and mounted with an anti-fluorescence quencher containing DAPI. The slides were then observed and photographed under a fluorescence microscope.

[0101] Mouse myocardial tissue, after dewaxing and antigen retrieval, was blocked with 5% normal goat serum at room temperature for 1 hour, then incubated overnight at 4°C with anti-CA4 antibody (1:200, ARG58375, Arigo). After washing with PBS, Alexa was added simultaneously. 488 goat anti-rabbit secondary antibody (1:1000, ab150077, Abcam) and 594-labeled tomato lectin (1:100, DL-1177-1; Vector Laboratories, USA) was incubated at room temperature for 1 hour. After the reaction was completed, the mixture was washed with PBS and blocked with a DAPI-containing anti-fluorescence quencher. The mixture was then observed and photographed under a fluorescence microscope.

[0102] Mouse myocardial tissue sections used for immunohistochemical staining were antigen-retrieved and blocked with hydrogen peroxide, then incubated overnight at 4°C with anti-mouse CD68 antibody (1:500, ab125212, Abcam). After washing with PBS, HRP-labeled goat anti-rabbit secondary antibody (1:2000, ab205718, Abcam) was added and incubated at room temperature for 1 hour. After the reaction, the sections were washed with PBS, developed with DAB, counterstained with hematoxylin, washed with water, dehydrated and cleared, mounted with neutral resin, and observed and photographed under a microscope. Three fields of view were randomly selected from the peri-infarct area of ​​each mouse in the myocardial infarction group and the corresponding location in the sham-operated group to obtain the proportion of CD68-positive cells.

[0103] 14. Real-time RT-PCR analysis

[0104] Total RNA was isolated from mouse left ventricular tissue. RNA quantity and quality were assessed spectrophotometrically, and reverse transcription was performed using the TaKaRa reverse transcription kit (RR037A, TaKaRa, Japan). Following the kit (RR420A, TaKaRa) instructions, the gene expression levels of CA4 and actin were detected using SYBR Green I chimeric fluorescence assay. Real-time PCR amplification and product detection were performed using an ABI QuantStudio3 detection system (Thermo Fisher Scientific, USA). The cDNA quantity of the CA4 gene was normalized to the cDNA quantity of Actin in each sample. 2 -ΔΔCt (Threshold cycling) determines the relative expression of the gene. Each assay includes two copies of the standard curve sample, one template-free control, and three copies of the cDNA sample for the test sample.

[0105] 15. Western blotting detection

[0106] Mouse ventricular tissue or human CMVEC was lysed and total protein was extracted using RIPA lysis buffer (P0013B, Beyotime, China). The concentration of dissolved protein was determined by the dicaprinate assay (BCA). Proteins were separated by SDS-PAGE and imprinted onto polyvinylidene fluoride (PVDF) membranes. The membranes were blocked in 5% skim milk and then incubated overnight at 4°C with anti-mouse CA4 antibody (1:1000, 13931-1-AP, Proteintech, USA), anti-human CA4 (1:1000, NBP1-69373, Novus, USA), VE-Cadherin (1:1000, ab33168, Abcam), ESAM antibody (1:1000, AF2688, R&D, USA), and anti-human and mouse Tubulin antibody (1:1000, #2146, Cell Signaling Technology, USA). After washing away unbound primary antibody from the membrane, the membrane was incubated with horseradish peroxidase at room temperature for 2 hours. Protein bands were then developed using enhanced chemiluminescence (ECL) substrate, and images were acquired using an AI 600 chemiluminescence image analyzer (Amersham Imager 600, GE, USA). The density of the immunoblot data was determined using ImageJ software (Wayne Rasband, NIH).

[0107] 16. pH value measurement

[0108] CMVEC after CA4 expression intervention was 1×10 5 Cells were seeded into 6-well tissue culture plates and cultured for 48 hours. Cell supernatant was collected, and pH was measured using a pH meter (METTLER TOLEDO, Switzerland) equipped with an INLAB MICRO PRO-ISM microelectrode.

[0109] 17. Cell viability assay

[0110] CMVEC after CA4 expression intervention was 1×10 4 Cells were seeded into 96-well tissue culture plates with clear bottoms coated with fibronectin. An equal volume of culture medium was added to each blank well. After 48 hours of incubation, the medium was replaced with fresh medium, and WST-8 solution was added according to the manufacturer's instructions (ab228554, Abcam), followed by incubation for 1 hour. The absorbance at 460 nm was measured using a multi-mode microplate reader.

[0111] 18. Monolayer cell permeability detection

[0112] 1×10 4CMVECs, after CA4 expression intervention, were seeded into the upper chambers of 6-well Transwell plates coated with fibronectin and cultured at 37°C for 48 hours. The culture medium in the upper chambers was removed, and 300 μl of Evans blue solution (0.5 mg / ml) diluted in phenol red-free ECM medium (1101-PRF, ScienCell) was added. The plates were incubated at 37°C for 5 min. The liquid from the lower chambers was transferred to 96-well plates, and the absorbance at 620 nm was measured using a multi-plate reader.

[0113] Table 1. Relevant Primer Information

[0114]

[0115] Table 2. Target sequences and primer information for shRNA

[0116]

[0117]

[0118] Experimental results:

[0119] 1. Heterogeneity of gene expression in cardiac vascular endothelial cells and specific expression of CA4 in microvascular endothelial cells

[0120] Blood vessels of different diameters in miniature pigs ( Figure 1 A) Endothelial cells were subjected to single-cell RNA sequencing. Results showed heterogeneity in gene expression within endothelial cells of different vessel diameters. Figure 1 BC). CA4 is specifically expressed in cardiac microvascular endothelial cells (BC). Figure 1 D).

[0121] 2. CA4 is specifically expressed in myocardial microvascular endothelial cells.

[0122] Immunofluorescence staining results showed that in mice ( Figure 2 (above) and human myocardial tissue ( Figure 2 In the image below, CA4 is expressed only in microvascular endothelial cells, but not in large vessel endothelial cells. This suggests that CA4 is a microvascular endothelial cell-specific protein in myocardial tissue.

[0123] 3. CA4 levels are significantly reduced in the cardiac tissue of patients with heart failure.

[0124] HE staining revealed that in normal human myocardial tissue, cardiomyocytes have clear boundaries, intact structure, and are arranged in a neat and orderly manner. However, in the myocardial tissue of heart failure patients, cardiomyocyte boundaries are blurred, the arrangement is disordered, and some areas show obvious fibrotic structures. Figure 3A). Immunofluorescence staining results showed that CA4 was highly expressed in the myocardial tissue of normal individuals, while its expression was significantly reduced in the myocardial tissue of patients with heart failure. Figure 3 B).

[0125] 4. CA4 levels are significantly reduced in myocardial infarction tissue.

[0126] TTC staining results showed that the myocardial tissue of the sham-operated group mice was deep red, indicating that the myocardium in this group was normal tissue; while in the myocardial infarction group mice, some areas of the myocardial tissue were white, indicating necrosis of the myocardial tissue in these areas, with the adjacent tissue appearing red, but lighter in color than the normal control group. HE staining results showed that in the sham-operated group mice, the myocardial striations were clearly visible, the myocardial cells were intact and neatly arranged, and there was no inflammatory cell infiltration. In the myocardial infarction group, the myocardial striations in the lesion area were blurred or partially disappeared, the number of myocardial cells was significantly reduced, and the arrangement was disordered, with obvious inflammatory cell infiltration. Figure 4 (AI)TTC staining showed that in a mouse model of myocardial infarction established by ligation of the left anterior descending coronary artery, the infarct area was approximately 30%. Figure 4 Immunofluorescence staining results of myocardial tissue from mice in group A-ii) showed that, compared with the sham-operated group, the expression level of CA4 in the myocardial tissue of mice in the myocardial infarction group was significantly reduced. Figure 4 B). Real-time RT-PCR and Western blotting further confirmed that the mRNA and protein levels of CA4 in the myocardial tissue of mice in the myocardial infarction group were significantly lower than those in the sham-operated group. Figure 4 C).

[0127] 5. Effects of CA4 deficiency on cardiac function and cardiac surface blood flow signals

[0128] Echocardiographic results showed that, regardless of whether it was the sham surgery group or the myocardial infarction group, CA4 EC- / - The LVEF and left ventricular surface blood flow signal in mice were compared with CA4. + / + Mice and CA4 EC+ / - The levels were significantly reduced in all mice. In the sham-operated group, CA4 levels were significantly reduced. + / + Mice and CA4 EC+ / - There were no significant differences in LVEF and left ventricular surface blood flow signals in mice; however, in the myocardial infarction group, although the two groups did not reach statistical significance, compared to CA4... + / + Mouse, CA4 EC+ / - In mice, both LVEF and left ventricular surface blood flow signal showed a significant decreasing trend. These results suggest that reduced CA4 levels can impair cardiac function and reduce blood supply to the heart vessels, with these effects being more pronounced during myocardial infarction.

[0129] 6. CA4 deficiency increased the area of ​​myocardial infarction in mice.

[0130] TTC staining results of cardiac tissue from mice with myocardial infarction showed that: compared to CA4 + / + Mice and CA4 EC+ / - Mouse, CA4 EC- / - The infarct area in mice was significantly higher than that in CA4. + / + and CA4 EC+ / - Mice. Despite CA4 + / + and CA4 EC+ / - There was no significant difference in the area of ​​myocardial infarction in mice, but it was similar to that of CA4. + / + Compared to mice, CA4 EC+ / - The infarct area in mice also showed an increasing trend. This result is consistent with the previous findings on cardiac function and blood flow signals on the cardiac surface.

[0131] 7. CA4 deficiency reduces microvascular density in myocardial tissue.

[0132] Immunofluorescence staining results of mouse myocardial tissue showed that: with CA4 + / + Compared to mice, CA4 EC- / - The microvessel density in the myocardial tissue of mice was significantly reduced. Meanwhile, CA4... EC+ / - The microvessel density in the mouse myocardium was between that of the two genotypes mentioned above. This suggests that CA4 may play an important role in the development of myocardial microvessels, and that CA4 deficiency can affect the normal development of microvessels in myocardial tissue.

[0133] 8. CA4 deficiency increases microvascular leakage in the heart and the infiltration of inflammatory factors into cardiac tissue.

[0134] The Evans blue leakage test results showed that in the sham-operated group, CA4 + / + Mice and CA4 EC+ / - Evans blue and CD68-positive macrophages that had leaked into the tissue were almost undetectable in the mouse myocardium. Despite CA4 EC- / - Evans blue levels in mouse tissues were significantly increased compared to the previous two mouse types, but the levels remained low. In mice with myocardial infarction, both Evans blue and CD68-positive macrophages were significantly increased in myocardial tissue. Compared to CA4... + / + Mice and CA4 EC+ / - Mouse, CA4 EC- / - Evans blue and CD68-positive macrophages were significantly increased in mouse myocardial tissue. (The text abruptly shifts to a seemingly unrelated topic about CA4.) + / + Compared to mice, CA4 EC+ / -In mice, microvascular leakage and macrophage infiltration in the myocardium also showed an increasing trend. These results suggest that CA4 plays a positive role in maintaining myocardial microvascular homeostasis, and CA4 deficiency can disrupt the microvascular barrier and promote the infiltration of inflammatory cells into myocardial tissue.

[0135] 9. CA4 expression intervention affects the morphology, activity, and cell permeability of cardiac microvascular endothelial cells.

[0136] Using lentiviruses as vectors, effective intervention can be achieved in the expression of intracellular CA4 in cultured human cardiac microvascular endothelial cells. Figure 9 A). CA4 overexpression can effectively reduce the pH value in cell culture supernatant, while interfering with intracellular CA4 expression has the opposite effect. Figure 9 B). Compared with the control group, the cells in the CA4 overexpression group were plump and tightly packed. In contrast, the cells after CA4 interference were elongated and had obvious gaps between them. Figure 9 C). Cell viability assay results showed that although CA4 overexpression did not significantly affect cell viability, interfering with intracellular CA4 expression significantly reduced cell viability. Figure 9 D), suggesting that CA4 plays an indispensable role in maintaining cell viability. Monolayer cell permeability experiments showed that CA4 overexpression significantly reduced cell permeability, while interfering with intracellular CA4 expression significantly increased cell permeability. Figure 9 E). Western blotting results showed that CA4 overexpression significantly increased the expression of VE-Cadherin and ESAM in cells, while interfering with intracellular CA4 expression significantly reduced the expression levels of both factors. Figure 9 F).

[0137] In summary, this study confirms the role of CA4 in maintaining CMVEC activity, promoting cardiac microvascular development, and protecting microvascular barrier function. It suggests that CA4 can protect against CMVD by preventing the reduction of cardiac microvascular density and inhibiting the increase of cardiac microvascular permeability during CMVD.

[0138] The above embodiments are only for illustrating the technical concept and features of the present invention, and are intended to enable those skilled in the art to understand the content of the present invention and implement it accordingly. They should not be construed as limiting the scope of protection of the present invention. All equivalent changes or modifications made in accordance with the spirit and essence of the present invention should be covered within the scope of protection of the present invention.

Claims

1. Application of substances that detect the carbonic anhydrase IV gene and its expression products in the preparation of products for screening, diagnosis, detection, monitoring or prediction of CMVD progression.

2. The application as described in claim 1, characterized in that, The CMVDs include both non-infarction-related and infarction-related CMVDs.

3. The application as described in claim 1, characterized in that, The carbonic anhydrase IV gene expression product includes carbonic anhydrase IV. The carbonic anhydrase IV gene and its expression product are derived from microvascular endothelial cells in the myocardial tissue of the subjects.

4. The use of at least one of the following a1)-a5): (This section is incomplete and requires further context to be fully translated.) a1) Prepare products that damage cardiac function and reduce blood supply to the heart's blood vessels; a2) Prepare products that increase the area of ​​myocardial infarction; a3) Prepare products that disrupt the barrier function of microvessels and promote the infiltration of inflammatory cells into myocardial tissue; a4) Prepare products that affect the morphology of cardiac microvascular endothelial cells, reduce the activity of cardiac microvascular endothelial cells, and increase the permeability of cardiac microvascular endothelial cells; a5) Construct CMVD-related disease cell or animal models of CMVD-related diseases.

5. The application as described in claim 4, characterized in that, In a4), the morphology of cardiac microvascular endothelial cells is specifically affected by elongated cell shape and obvious gaps between cells.

6. The application as described in claim 4, characterized in that, In a4), the product also has the effect of reducing the expression of VE-Cadherin and ESAM, intracellular junction proteins in cardiac microvascular endothelial cells.

7. The application as described in claim 6, characterized in that, The substances that inhibit the carbonic anhydrase IV gene and its expression products and / or reduce its activity include RNA interference molecules or antisense oligonucleotides targeting carbonic anhydrase IV, small molecule inhibitors, shRNA, siRNA, substances that induce lentiviral infection or gene knockout, and specific antibodies against carbonic anhydrase IV itself or its upstream and downstream molecules, including anti-carbonic anhydrase IV antibodies.

8. The use of carbonic anhydrase IV gene and its expression product and / or substances that enhance its activity in at least one of the following b1)-b2): b1) Prepare products that maintain the activity of myocardial microvascular endothelial cells, promote the development of cardiac microvessels, and protect the function of the microvascular barrier; b2) Prepare products that prevent the reduction of cardiac microvascular density and inhibit the increase of cardiac microvascular permeability during CMVD, thereby inhibiting CMVD lesions.

9. The application as described in claim 8, characterized in that, In b1), the product also has the function of maintaining the full morphology and tight arrangement of myocardial microvascular endothelial cells; In b2), the product also has the effect of increasing the expression of VE-Cadherin and ESAM in myocardial microvascular endothelial cells; Furthermore, the CMVD lesions can specifically be CMVD without or with myocardial infarction.

10. The application as described in claim 8, characterized in that, The substances that promote the carbonic anhydrase IV gene and its expression products and / or increase its activity include promoters that upregulate carbonic anhydrase IV expression, plasmids or lentiviruses containing the carbonic anhydrase IV gene, and compound promoters.

Images