Use of ginsenoside rh1 in treating inflammatory skin diseases

Abstract

The application provides an application of ginsenoside Rh1 in treatment of inflammatory skin diseases, relates to the technical field of biological medicine, and verifies for the first time that ginsenoside Rh1 can inhibit AQP3 expression by activating the oxidative phosphorylation pathway and regulating cell homeostasis, can inhibit AQP3 gene transcription and / or expression, can be used as a new type of AQP3 inhibitor, and can down-regulate the expression level of AQP3 protein in a rose acne animal model. The application provides a brand-new strategy and candidate drug for targeted treatment of rose acne and other AQP3 related inflammatory skin diseases.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and in particular to the application of ginsenoside Rh1 in the treatment of inflammatory skin diseases. Background Technology

[0002] Rosacea, also known as rhinophyma, is a chronic, recurrent inflammatory skin disease. It primarily affects the central facial areas (such as the cheeks, nose, forehead, and chin), manifesting as persistent erythema, telangiectasia, papules, and pustules. Aquaporin 3 (AQP3) is upregulated in lesions caused by rosacea-type inflammatory skin diseases, and its function is closely related to inflammation amplification and barrier disruption. It is a key molecular node connecting triggering factors such as LL-37 to clinical phenotypes (erythema, inflammation). Therefore, AQP3 is a potential therapeutic target, but drug development for it is currently limited.

[0003] In view of this, the present invention is hereby proposed. Summary of the Invention

[0004] One of the objectives of this invention is to provide the application of ginsenoside Rh1 in the preparation of AQP3 inhibitors, so as to at least solve one of the technical problems existing in the prior art.

[0005] The second objective of this invention is to provide the application of ginsenoside Rh1 in the preparation of drugs for treating inflammatory skin diseases.

[0006] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted: In a first aspect, the present invention provides the application of ginsenoside Rh1 in the preparation of AQP3 inhibitors.

[0007] Furthermore, the AQP3 inhibitor has the function of inhibiting AQP3 gene transcription and / or expression.

[0008] Furthermore, the AQP3 inhibitor has the function of downregulating the expression level of AQP3 protein.

[0009] Furthermore, the AQP3 inhibitor has the function of activating the oxidative phosphorylation pathway.

[0010] Secondly, this invention provides the application of ginsenoside Rh1 in the preparation of drugs for treating inflammatory skin diseases.

[0011] Furthermore, the inflammatory skin diseases include those caused by damage to the skin barrier.

[0012] Furthermore, the skin barrier impairment includes skin barrier impairment caused by AQP3 overexpression.

[0013] Furthermore, the inflammatory skin condition includes at least one of rosacea, atopic dermatitis, or psoriasis.

[0014] Furthermore, the drug possesses any one of the functions A1 to A4: A1. Downregulates AQP3 protein expression levels; A2. Reduces dermal inflammatory cell infiltration; A3. Reduce the number of MPO-positive cells; A4. Inhibits the expression of pro-inflammatory cytokines.

[0015] Furthermore, the pro-inflammatory cytokines include at least one of IL-1β, IL-6, or TNF-α; The dosage form of the drug includes at least one of the following: tablets, capsules, drops, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal preparations, lozenges, suppositories, or lyophilized powder injections.

[0016] This invention provides the application of ginsenoside Rh1 in the preparation of AQP3 inhibitors. It is the first time that ginsenoside Rh1 has been verified to inhibit AQP3 expression by activating the oxidative phosphorylation pathway and regulating cellular homeostasis, thereby inhibiting AQP3 gene transcription and / or expression. As a novel AQP3 inhibitor, it can downregulate AQP3 protein expression levels in an animal model of rosacea. This provides a novel strategy and drug candidate for targeted therapy of rosacea and other AQP3-related inflammatory skin diseases. Attached Figure Description

[0017] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0018] Figure 1 Flowchart of the endogenous AQP3-2A-luciferase reporter gene cell line provided in Example 1 of the present invention; Figure 2 The results of the detection of relative activity of endogenous AQP3-2A-luciferase for drug screening provided in Example 2 of the present invention are shown on the left, which is the result of high-throughput drug screening using reporter gene cell lines, and the right is the verification result of the downregulation of relative luciferase activity by ginsenoside Rh1. Figure 3The results of the efficacy verification of the rosacea animal model provided in Example 3 of this invention are shown in the following figures: a) is a schematic diagram of the efficacy verification process of the animal model; b) is an observation diagram of the modeling site at different time points after drug administration in each group of mice; c) is a statistical chart of erythema scores in each group of mice; d) is a statistical chart of erythema area in each group of mice; e) is... II-1b and Tnf The graph shows the relative expression levels of mRNA; f is the expression level statistics of IL-1β and TNF-α; g is the immunohistochemical quantitative analysis of AQP3 protein; h is the number of dermal infiltrating cells; i is the MPO immunofluorescence staining image; j is the MPO... + Cell count statistics chart; Figure 4 The transcriptome sequencing analysis results of Rh1-treated keratinocytes provided in Example 4 of this invention are shown below. In the figure, a is a PCA plot to verify the reliability of the experimental grouping; b is a volcano plot of differentially expressed genes, showing the number and significance of upregulated / downregulated genes; c is a bar chart of differentially expressed gene enrichment; and d is the result of Rh1 treatment of hacat cells downregulating AQP3 expression. Figure 5 This is a graph showing the enrichment analysis results of the KEGG oxidative phosphorylation pathway in Rh1-treated keratinocytes provided in Example 4 of the present invention. Figure 6 The results of the verification of the mechanism by which ginsenoside Rh1 regulates AQP3 expression provided in Example 4 of the present invention are shown. In this example, a is the qRT-PCR analysis result of AQP3 mRNA, and b is the measurement result of the relative ATP level in the cell. Detailed Implementation

[0019] Unless otherwise defined herein, the scientific and technical terms used in conjunction with this invention shall have the meanings commonly understood by one of ordinary skill in the art. The meaning and scope of terms shall be clear; however, in any case of potential ambiguity, the definitions provided herein shall prevail over any dictionary or foreign definitions. In this application, unless otherwise stated, the use of "or" means "and / or". Furthermore, the use of the term "comprising" and other forms is non-limiting.

[0020] Generally, the nomenclature and techniques used in cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization, together with those described herein, are those well-known and commonly used in the art. Unless otherwise stated, the methods and techniques of the present invention are generally carried out according to conventional methods well-known in the art and described in various general and more specific references, which are cited and discussed throughout this specification. Enzymatic reactions and purification techniques are carried out according to the manufacturer's instructions, as commonly practiced in the art, or as described herein. The nomenclature, laboratory procedures, and techniques used in analytical chemistry, synthetic organic chemistry, and medical and medicinal chemistry, together with those described herein, are those well-known and commonly used in the art.

[0021] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0022] This invention provides, in one aspect, the application of ginsenoside Rh1 in the preparation of AQP3 inhibitors.

[0023] The inventors have for the first time demonstrated that ginsenoside Rh1 inhibits AQP3 expression by activating the oxidative phosphorylation pathway and regulating cellular homeostasis, thereby suppressing AQP3 gene transcription and / or expression. It can serve as a novel AQP3 inhibitor, downregulating AQP3 protein expression levels in an animal model of rosacea. This provides a novel strategy and drug candidate for targeted therapy of rosacea and other AQP3-related inflammatory skin diseases.

[0024] According to another aspect of the present invention, the use of ginsenoside Rh1 in the preparation of a medicament for treating inflammatory skin diseases is also provided.

[0025] In some specific embodiments, the inflammatory skin disease includes inflammatory skin diseases caused by impaired skin barrier function. In some specific embodiments, the impaired skin barrier function includes skin barrier impairment caused by AQP3 overexpression.

[0026] In some specific embodiments, the inflammatory skin disease includes at least one of rosacea, atopic dermatitis, or psoriasis.

[0027] In some specific embodiments, the drug has the functions of downregulating AQP3 protein expression levels, reducing dermal inflammatory cell infiltration, reducing the number of MPO positive cells, or inhibiting the expression of pro-inflammatory cytokines.

[0028] In some specific embodiments, the pro-inflammatory cytokines include at least one of IL-1β, IL-6, or TNF-α.

[0029] In some specific embodiments, the dosage form of the drug includes at least one of tablets, capsules, drops, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal preparations, lozenges, suppositories, or lyophilized powder injections.

[0030] Specific drugs can be ordinary preparations, sustained-release preparations, controlled-release preparations, and various microparticle delivery systems.

[0031] The present invention will be further illustrated by the following examples. Unless otherwise specified, the materials in the examples are prepared according to existing methods or purchased directly from the market.

[0032] Example 1: Construction of an endogenous AQP3-2A-luciferase reporter gene cell line An endogenous AQP3-2A-luciferase reporter gene cell line was constructed using CRISPR / Cas9 technology to establish a direct and precise high-throughput drug screening platform. The construction process is as follows: Figure 1 As shown, the specific steps are as follows: A P2A-luciferase (LUC) fragment was inserted upstream of the stop codon at the AQP3 gene locus to construct the AQP3–P2A–LUC cell line, enabling co-transcription of AQP3 and the luciferase reporter gene, followed by post-translational expression via P2A autoclast peptide. First, sgRNA was designed targeting the region adjacent to the AQP3 stop codon, and an sgRNA expression plasmid and a Donor donor plasmid containing left and right homologous arms and carrying the P2A-LUC fragment were constructed. HEK293T cells were cultured in 6-well plates to approximately 40–50% confluence, and then co-transfected with PEI (total plasmid amount 3 μg; PEI:DNA mass ratio 4:1). Forty-eight hours after transfection, puromycin was used for selection to enrich a positive cell population (puromycin concentration 10 μg / mL; selection time 24 h). Subsequently, limiting dilution was used for plating, amplification, and screening of single-cell clones for genotyping. Finally, the correct positive clones Clone#1, Clone#2, and Clone#3 were obtained.

[0033] sgRNA sequence: CGATCCACCCTTTCAGGCTA (SEQ ID NO.1).

[0034] Primers for genomic PCR identification: P1: CCTCGACTGTAGCAGGGTTT (SEQ ID NO.2); P2: CTCCAGCGGTTCCATCTTCC (SEQ ID NO.3); P3: GCTTGCGGAACCCTTCCAAT (SEQ ID NO.4); P4: TGTATGACCCCCAGGGTAAC (SEQ ID NO. 5).

[0035] Example 2 Drug Screening 1. Cell line culture: The cell line constructed in Example 1 was cultured in DMEM medium containing 10% fetal bovine serum (FBS) at 37°C and 5% CO2.

[0036] 2. Drug Screening: AQP3–P2A–LUC-293T cells were seeded in 96-well white opaque luminescent plates, 5,000 cells per well, and cultured for 24 h until adherence before drug administration. Compounds were obtained from the TargetMol compound library. All compounds were screened using a single-point concentration of 20 μM for 24 h; the solvent control was an equal volume of DMSO. Each plate included a DMSO negative control well and three replicate wells. After treatment, the luminescence activity (RLU) was measured according to the general luciferase reporter assay (FRTA) procedure, and the relative luciferase activity was calculated by normalizing to the DMSO group for compound screening.

[0037] The results are as follows Figure 2 As shown, ginsenoside Rh1 is a novel and potent transcriptional inhibitor of AQP3.

[0038] Example 3: Pharmacological Efficacy Verification 1. Establishment of a mouse model of rosacea Hair on the back was shaved 24 hours before modeling, and the skin was kept clean and dry. LL-37 (Sangon Biotech (Shanghai) Co., Ltd.) was dissolved in sterile PBS to prepare a 320 μM working solution. LL-37 was injected intradermally into the designated area on the back, with an injection volume of 40 μL each time, once every 12 hours for 2 consecutive days, for a total of 4 injections. The blank control group received an equal volume of PBS intradermally at the same time schedule. The Rh1 treatment group received Rh1 topical treatment (5 mg / mL) 12 hours after LL-37 modeling, once every 1 hour after LL-37 injection, for a total of 3 treatments. 2. Grouping and drug administration In the LL37 modeling group, LL-37 was injected intradermally into a designated area on the back, with an injection volume of 40 μL each time, once every 12 hours for 2 consecutive days, for a total of 4 injections. The blank control group received an equal volume of PBS intradermally at the same time schedule. In the Rh1 treatment group, Rh1 (5 mg / mL) was applied topically 12 hours after LL-37 modeling, once every 1 hour after LL-37 injection, for a total of 3 administrations.

[0039] 3. Testing Skin texture, erythema, and overall appearance changes were recorded every 24 hours after drug administration, and erythema scores were calculated. Erythema scores were calculated using a 0–5 scale (0 = no erythema, 1 = very mild, 2 = mild, 3 = moderate, 4 = severe, 5 = very severe / with scaling), and were completed by 3 independent assessors under blinded conditions.

[0040] Twelve hours after the last injection, mice were euthanized under inhalation anesthesia, and skin tissue from the injection site on the back was harvested. To meet different testing requirements, skin samples from the same animal were divided into the following portions and processed separately: ① Histology / IHC / IF: Tissue was fixed in 4% paraformaldehyde for 24 hours, routinely dehydrated, embedded, and sectioned (4 μm) for H&E, IHC, and tissue immunofluorescence (IF). ② ELISA: A portion of the tissue was immediately flash-frozen in liquid nitrogen and transferred to… Store at 80°C for subsequent homogenization ELISA detection. ③ Tissue qRT-PCR: Take another portion of tissue, place it in RNAlater solution, and then transfer. 80°C, used for subsequent RNA extraction and qRT-PCR analysis.

[0041] The results are as follows Figure 3 As shown, topical application of Rh1 significantly alleviated clinical erythema in rosacea-like dermatitis, reduced dermal inflammatory cell infiltration, and inhibited the expression of key pro-inflammatory cytokines (such as IL-1β, IL-6, and TNF-α). Importantly, the therapeutic effect of Rh1 occurred concurrently with its effective reversal of LL37-induced AQP3 protein overexpression at the lesion site.

[0042] Example 4: Molecular mechanism of Rh1 downregulating AQP3 Transcriptome sequencing analysis of Rh1-treated keratinocytes was performed to elucidate the molecular mechanism by which Rh1 downregulates AQP3. The specific steps were as follows: HaCaT cells were cultured for 24 hours with and without 20 µM ginsenoside Rh1, respectively. Total RNA was extracted and sequenced on an Illumina NovaSeq 6000 platform. Reads were aligned to the GRCh38 reference genome using the nf-core RNAseq pipeline (v3.0). Gene set enrichment analysis (GSEA) was performed using the marker gene set in MSigDB (v7.5). An adjusted false discovery rate (FDR) <0.25 was considered statistically significant.

[0043] The results are as follows Figure 4 and Figure 5 As shown, Rh1 most significantly activated the oxidative phosphorylation pathway and simultaneously inhibited gene programs related to epithelial morphogenesis and cell migration, while downregulating AQP3 expression levels.

[0044] Pharmacological validation experiment: The causal relationship between oxidative phosphorylation activation and AQP3 inhibition was verified. HaCaT cells were treated with ginsenoside Rh1 (20 μM) and oligomycin A (1.5 μM) for 24 hours. The results are as follows: Figure 6 As shown, treatment with an oxidative phosphorylation-specific inhibitor (oligomycin A) significantly weakened the downregulation of AQP3 by Rh1. The addition of an oxidative phosphorylation pathway-specific inhibitor confirmed that Rh1 regulates AQP3 expression by activating the oxidative phosphorylation pathway. The results indicate that the inhibitor blocked the downregulation of AQP3 by Rh1, demonstrating that Rh1 exerts its regulatory role in cellular homeostasis by activating the oxidative phosphorylation pathway and inhibiting AQP3 gene transcription and / or expression.

[0045] This invention provides a novel AQP3-targeted drug screening tool and for the first time discovers that ginsenoside Rh1 can serve as a lead compound that inhibits AQP3 expression by activating oxidative phosphorylation and regulating cellular homeostasis, providing a new strategy and candidate drug for targeted treatment of rosacea and other AQP3-related inflammatory skin diseases.

[0046] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of ginsenoside Rh1 as the sole active ingredient in the preparation of drugs for treating inflammatory skin diseases, characterized in that, The inflammatory skin disease is rosacea; the ginsenoside Rh1 inhibits AQP3 expression.

2. The application according to claim 1, characterized in that, The drug inhibits AQP3 gene transcription.

3. The application according to claim 1, characterized in that, The drug downregulates the expression level of AQP3 protein.

4. The application according to claim 1, characterized in that, The drug activates the oxidative phosphorylation pathway.

5. The application according to claim 1, characterized in that, The drug possesses any one of the functions A1 to A3: A1. Reduces dermal inflammatory cell infiltration; A2. Reduce the number of MPO-positive cells; A3. Inhibits the expression of pro-inflammatory cytokines.

6. The application according to claim 5, characterized in that, The pro-inflammatory cytokines include at least one of IL-1β, IL-6, or TNF-α; The dosage form of the drug includes at least one of tablets, capsules, aerosols, pills, powders, solutions, suspensions, emulsions, granules, transdermal preparations, or suppositories.

Images