rbo nt recombinant proteins and precursors thereof, and methods of making and using the same
By optimizing the structure and improving the purification process of botulinum neurotoxin protein, the safety and purity issues of traditional preparation methods have been resolved, enabling the large-scale production of high-purity, high-activity recombinant botulinum toxin protein.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- CHENGDU RUIYI BIOTECHNOLOGY CO LTD
- Filing Date
- 2026-04-21
- Publication Date
- 2026-07-31
AI Technical Summary
Traditional methods for preparing botulinum toxin have problems such as high safety risks, low yield, unstable purity and many impurities, making it difficult to meet market demand. Moreover, existing purification technologies for recombinant botulinum toxin cannot effectively separate active and inactive forms of botulinum toxin.
By deleting the C-terminus of the light chain and/or the N-terminus of the heavy chain of botulinum neurotoxin protein and adding enzyme cleavage sites at specific positions, a recombinant rBoNT protein precursor was constructed. Optimized purification processes, including membrane ultrafiltration, hydrophobic chromatography, and ion exchange chromatography, combined with specific protease digestion, yielded a high-purity, high-activity recombinant rBoNT protein.
It improves the purity and expression level of botulinum toxin, reduces biosafety risks, simplifies the production process, is suitable for large-scale production, and maintains high biological activity.
Smart Images

Figure CN122080238B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to rBoNT recombinant protein, its precursor, its preparation method, and its applications. Background Technology
[0002] Botulinum toxin (BTX) is a potent neurotoxin produced by Clostridium botulinum. Its mechanism of action involves inhibiting the release of acetylcholine from nerve endings, blocking signal transmission at the neuromuscular junction, thereby producing a muscle-relaxing effect. Since its discovery in the mid-20th century, botulinum toxin has demonstrated immense value in the medical and cosmetic fields.
[0003] In the field of medical treatment, the application of botulinum toxin is constantly expanding. Initially used to treat muscle spasm-related disorders such as blepharospasm, hemifacial spasm, acute paralytic strabismus, and certain types of strabismus, precise injections effectively relieve excessive muscle contraction and improve patient symptoms. With further research, botulinum toxin has also played an important role in the treatment of dystonia-related conditions, helping patients alleviate pain and improve their quality of life. Furthermore, it is used to treat hyperhidrosis, inhibiting sweat gland secretion and providing patients with a dry and comfortable experience. In the treatment of chronic migraines, botulinum toxin has also shown significant efficacy, providing a new treatment option for patients suffering from migraines. In the cosmetic field, botulinum toxin is highly favored, becoming an important means of improving facial appearance. It can effectively reduce dynamic wrinkles, such as frown lines, forehead wrinkles, crow's feet, nasal wrinkles, and perioral wrinkles. Its principle is to block the transmission of signals between nerves and muscles, relaxing the muscles that cause wrinkles, thereby achieving a smoothing effect on the skin and restoring a youthful appearance. Botox is also used in body sculpting procedures such as facial slimming and calf reduction. By blocking the nutrient supply to specific muscles, it causes the muscles to gradually atrophy, thereby achieving the goal of shaping an ideal body shape.
[0004] Currently, botulinum toxin on the market is mainly obtained through traditional methods of extraction and purification from Clostridium botulinum fermentation broth. However, this traditional preparation method has many limitations. Clostridium botulinum is a pathogenic microorganism, requiring strict safety precautions during cultivation to prevent toxin leakage and serious safety accidents. Leakage could lead to poisoning or even death. Traditional preparation methods have low yields, making it difficult to meet the growing market demand. Because the growth conditions for Clostridium botulinum are demanding, the fermentation process is difficult to control precisely, resulting in unstable toxin production and increased production costs. Botulinum toxin products obtained through traditional methods often contain impurities, which may cause adverse reactions such as allergies, affecting the product's safety and efficacy. For example, some patients may experience local redness, swelling, itching, and other allergic symptoms after injecting traditionally prepared botulinum toxin; in severe cases, it can even lead to life-threatening situations such as difficulty breathing.
[0005] To overcome the shortcomings of traditional preparation methods, the construction and preparation of recombinant botulinum toxin has become a research hotspot. Through genetic engineering, the botulinum toxin gene can be precisely manipulated to achieve recombinant expression. This method not only increases the yield and purity of botulinum toxin but also reduces production costs and biosafety risks. By optimizing gene sequences and expression conditions, recombinant botulinum toxin can achieve higher yields in a shorter time, with higher purity and reduced impurities, thereby improving product quality and safety. The construction and preparation of recombinant botulinum toxin also opens up possibilities for developing novel botulinum toxin products; for example, botulinum toxins with different properties can be obtained through genetic modification to meet the needs of different patients.
[0006] The inventors, through research on recombinant botulinum toxin sequences without any tags or enzyme site modifications, discovered that culture media from recombinant botulinum bacteria (E. coli, yeast, or other eukaryotic cells) without any tags or enzyme site modifications could produce active botulinum toxin after purification and trypsin digestion (trypsin, lysine endopeptidase). However, industrialization studies revealed that the yield of active botulinum toxin from recombinant botulinum bacteria without any tags or enzyme site modifications was low.
[0007] The reasons are as follows: First, in Clostridium botulinum, the natural botulinum toxin precursor polypeptide is hydrolyzed by precursor toxin hydrolases (trypsin-like enzymes or thiol proteases) to form two polypeptide chains linked together by disulfide bonds. These two double-chain polypeptides are the active form of botulinum toxin. Escherichia coli contains proteases similar to precursor toxin hydrolases. After purification, the culture medium of recombinant botulinum toxin without any tags or enzyme cleavage site modifications, through disulfide bond detection, amino acid sequence analysis, HPLC, and other related studies, revealed that before trypsin cleavage, it was no longer a single, unprocessed recombinant botulinum toxin precursor polypeptide, but rather a mixture of partially processed, inactive recombinant botulinum toxin and fully processed, active botulinum toxin. Because these substances have similar physical and chemical properties, current purification and separation techniques cannot accurately separate these impurities completely. Secondly, although trypsin cleavage (trypsin, lysine endopeptidase) is widely used in protein hydrolysis and peptide preparation, its core disadvantage lies in the uncontrollable cleavage products due to limitations in its enzymatic characteristics, action conditions, and applicability. This can easily damage the cleavage sites of other endogenous proteases in the target protein structure, introducing redundant sequences and thus affecting protein activity. For example, trypsin cleaves the carboxyl-terminal peptide bonds of lysine (Lys) and arginine (Arg) residues. Lys / Arg is randomly distributed in the recombinant botulinum neurotoxin protein sequence. After enzymatic cleavage of recombinant botulinum toxin precursor polypeptides without any tags or cleavage site modifications, studies using disulfide bond detection, amino acid sequence detection, and HPLC revealed that many fragmented non-target product impurities were generated in the product due to the cleavage of non-target sites.
[0008] In industrial applications, in order to meet GMP requirements for product uniformity and safety, it is necessary to focus on solving the above problems. Summary of the Invention
[0009] To overcome the shortcomings of existing technologies, this invention provides rBoNT recombinant protein, its precursor, its preparation method, and its applications. By deleting the C-terminus of the light chain and / or the N-terminus of the heavy chain of botulinum neurotoxin protein, the truncated recombinant protein obtained exhibits higher neurotoxicity, better solubility, and higher expression levels compared to the full-length recombinant protein, showing promising prospects for clinical translation.
[0010] rBoNT recombinant protein precursor, which includes a first polypeptide fragment, a second polypeptide fragment and a third polypeptide fragment;
[0011] The first polypeptide fragment includes a tag protein and a first restriction enzyme site structural region;
[0012] The second polypeptide fragment includes a light chain protein and a second enzyme cleavage site structural region, wherein the light chain protein is selected from the full length of the botulinum toxin light chain or a truncated version thereof with 1 to 15 amino acids missing from its C-terminus;
[0013] The third polypeptide fragment is a heavy chain protein; the heavy chain protein is selected from the full length of the botulinum toxin heavy chain or a truncated form with 1 to 3 amino acids missing from its N-terminus;
[0014] The heavy chain protein and the light chain protein are not both full-length.
[0015] In this invention, the light chain protein and heavy chain protein are derived from BoNT / A, i.e., Clostridium botulinum type A, i.e., the rBoNT recombinant protein precursor is designed for BoNT-A and is the precursor protein of rBoNT-A.
[0016] This invention obtains a truncated precursor protein of botulinum neurotoxin protein by deleting 1-15 amino acids from the C-terminus of the light chain and / or 1-3 amino acids from the N-terminus of the heavy chain, and adding enzyme cleavage sites at specific positions. This precursor protein is then digested with proteases to obtain the rBoNT recombinant protein. Because the precursor protein provided by this invention is not easily cleaved by proteases similar to precursor toxin hydrolases in *E. coli*, it significantly reduces the presence of partially processed inactive recombinant botulinum toxin and fully processed active botulinum toxin in the recombinant botulinum toxin precursor polypeptide, greatly improving the purity of the rBoNT recombinant protein. Compared to full-length recombinant proteins and other truncated recombinant proteins (such as those with a 4-5 amino acid truncation at the N-terminus of the heavy chain), the rBoNT recombinant protein of this invention exhibits higher neurotoxicity, better solubility, and higher expression levels, showing promising clinical translation prospects. The recombinant protein obtained by deleting 15 amino acids from the C-terminus of the light chain and 3 amino acids from the N-terminus of the heavy chain shows the best efficacy.
[0017] The rBoNT recombinant protein precursor provided by the present invention is composed of a first polypeptide fragment, a second polypeptide fragment, and a third polypeptide fragment connected sequentially from the N-terminus to the C-terminus.
[0018] Furthermore, the light chain protein includes a light chain functional region, a light chain variable structure region, and a second enzyme cleavage site structural region.
[0019] In this invention, the sources of the light chain protein and the heavy chain protein include, but are not limited to, botulinum toxin type A.
[0020] In some specific embodiments, the light chain functional region has the amino acid sequence shown in SEQ ID NO: 4.
[0021] In some specific embodiments, the amino acid sequence of the light chain variable structure region is selected from: the amino acid sequence shown in SEQ ID NO: 5, an amino acid sequence obtained by deleting several bases in the sequence shown in SEQ ID NO: 5, or none.
[0022] In some specific embodiments, the second enzyme cleavage site structural region has the amino acid sequence shown in SEQ ID NO: 12.
[0023] Furthermore, the heavy chain protein includes a heavy chain variable structure region and a heavy chain functional region.
[0024] In some specific embodiments, the amino acid sequence of the heavy chain variable structure region is selected from ALN, AL, A, or none.
[0025] In some specific embodiments, the heavy chain functional region has the amino acid sequence shown in SEQ ID NO: 6;
[0026] Furthermore, in the rBoNT recombinant protein precursor of the present invention, the first polypeptide fragment has the amino acid sequence shown in SEQ ID NO: 10.
[0027] The present invention also provides a nucleic acid encoding the rBoNT recombinant protein precursor as described above.
[0028] Furthermore, the nucleic acid includes a nucleic acid encoding at least one of the following: the first polypeptide fragment, a light chain functional region, a light chain variable structure region, a second enzyme cleavage site structural region, a heavy chain variable structure region, and a heavy chain functional region.
[0029] The nucleic acid described in this invention can be DNA or RNA, preferably DNA. In this invention, the nucleic acid can be codon-optimized for specific host types to improve expression efficiency in host cells. In a specific embodiment of this invention, codon optimization was performed for *E. coli*. Specifically, the nucleic acid encoding the first polypeptide fragment, the light chain functional region, the second restriction site structural region, and the heavy chain functional region sequentially has the nucleic acid sequences shown in SEQ ID NO: 9, 1, 11, and 3; the nucleotide sequence encoding the light chain variable structure region is as shown in SEQ ID NO: 2, or a nucleotide sequence obtained by deleting, substituting, or adding one or more bases to the sequence shown in SEQ ID NO: 2; or a sequence having more than 80% identity with the nucleic acid sequence shown in any of the preceding claims. The nucleic acid sequence encoding the heavy chain variable structure region is gccctgaac; or a nucleotide sequence obtained by deleting, substituting, or adding one or more bases to the nucleic acid sequence shown in the preceding claims; or a sequence having more than 80% identity with the nucleic acid sequence shown in any of the preceding claims.
[0030] The rBoNT recombinant protein precursor provided by this invention introduces a His purification tag and an enzyme cleavage site. The histidine protein tag typically does not significantly interfere with the protein's spatial structure or biological activity; in some cases, the His tag may even help improve the solubility and stability of the target protein, preventing its degradation or inclusion body formation. Further, the enzyme cleavage site is selected from the cleavage sites of at least one enzyme selected from enterokinase, TEV protease, and SUMO protease. In a specific embodiment of this invention, both the first and second enzyme cleavage sites are enterokinase cleavage sites.
[0031] The present invention also provides biomaterials, including any one of the following:
[0032] (1) Expression box, including nucleic acids as described above.
[0033] (2) A recombinant vector, including the expression frame described in (1);
[0034] (3) A recombinant host whose genome integrates nucleic acids as described above or expression cassettes as described in (1), or contains recombinant vectors as described in (2).
[0035] The recombinant vector described in this invention refers to a vector capable of carrying the nucleic acid described in this invention and replicating and expressing it in a host cell. In some specific embodiments, the recombinant vector is an expression vector, more specifically a prokaryotic expression vector, such as the pET series vectors, pGEX series vectors, or pMAL series vectors. In some specific embodiments, the recombinant vector is the pET-28a(+) vector.
[0036] The recombinant host described in this invention refers to a host cell containing the nucleic acid, expression cassette, or recombinant vector described in this invention. The host cell can be a prokaryotic cell or a eukaryotic cell, preferably a prokaryotic cell; the prokaryotic cell includes, but is not limited to, *Escherichia coli*. In some specific embodiments, the recombinant host is *Escherichia coli* BL21(DE3) or a derivative strain thereof.
[0037] Furthermore, the present invention also provides a recombinant rBoNT protein, characterized in that it is obtained by enzymatic digestion of the rBoNT recombinant protein precursor described in the present invention. Preferably, the enzyme includes at least one of enterokinase, TEV protease, and SUMO protease. In a specific embodiment of the present invention, the enzyme is enterokinase.
[0038] The present invention also provides a method for preparing the recombinant botulinum neurotoxin protein (i.e., rBoNT recombinant protein), comprising: transferring a recombinant vector containing the nucleic acid described in the present invention into a host, inducing expression, purifying, and obtaining the rBoNT recombinant protein precursor;
[0039] The rBoNT recombinant protein precursor was activated by enzyme digestion to obtain the rBoNT recombinant protein.
[0040] In this invention, a recombinant vector containing the nucleic acid described herein is transferred into a host cell to obtain a recombinant host. After induction of expression, bacterial cells are lysed, and the lysate is then purified to obtain the rBoNT recombinant protein precursor. The conditions for inducing expression include: inoculating the recombinant host cell into a fermentation broth and culturing it until OD2000. 600 At a temperature of 25-35°C, IPTG is added for induction. The induced bacterial suspension is then homogenized under high pressure to obtain a cell lysate for subsequent purification. The preferred induction temperature is 16°C, and the preferred induction time is 16 hours.
[0041] In this invention, the bacterial cell lysate is first filtered and sterilized using a filter membrane before purification. The filter membrane is preferably a 0.45 μm membrane.
[0042] In this invention, the purification process includes a first purification, a second purification, and a third purification in sequence; the first purification is affinity chromatography or membrane ultrafiltration; the second purification is hydrophobic chromatography; and the third purification is ion exchange chromatography.
[0043] This invention also optimizes the purification process of recombinant proteins. Studies have shown that purification following the His affinity-hydrophobic-ionic sequence effectively removes impurities such as host proteins and nucleic acids while maintaining the activity of the target protein. Replacing the first step of His affinity chromatography with membrane ultrafiltration, i.e., the purification process proceeds in the order of membrane encapsulation-hydrophobic-ionic, can also effectively remove impurities such as host proteins and nucleic acids while maintaining the activity of the target protein. Furthermore, this method is simpler to operate and easier to scale up for production.
[0044] Specifically, the affinity chromatography includes: after equilibration of the affinity chromatography column, loading the primary purified sample, washing the column with equilibration buffer until the baseline absorbance is stable, eluting with elution buffer, and collecting and combining the eluent containing the target recombinant protein. In some specific embodiments, the affinity chromatography column is Ni Sepharos Excel. In some specific embodiments, the equilibration buffer is 20 mM PB + 1.5 M NaCl + 5 mM imidazole (pH = 7.0~8.0), and the elution buffer is 20 mM PB + 1.5 M NaCl + 500 mM imidazole (pH = 7.0~8.0).
[0045] Specifically, the membrane-encapsulated ultrafiltration includes: filtering a primary purified sample through a filter equipped with a tangential flow membrane, collecting the filtrate, and obtaining an ultrafiltered sample containing the target protein. More specifically, the membrane-encapsulated tangential flow membrane is preferably a cellulose membrane or a polyethersulfone membrane. The molecular weight cutoff of the membrane-encapsulated tangential flow membrane is preferably 30~100kDa, more preferably 50kDa. In some specific embodiments, the replacement solution used in the membrane-encapsulated ultrafiltration is 20mM PB + 1.5M NaCl, pH 6.5~7.5.
[0046] Specifically, the hydrophobic chromatography includes: after equilibration of the hydrophobic chromatography column, loading the harvested sample containing the target protein obtained by affinity chromatography or membrane ultrafiltration; washing the chromatography column with equilibration buffer until the baseline absorbance is stable; eluting with elution buffer; and collecting and combining the eluents containing the target recombinant protein. More specifically, the hydrophobic chromatography packing material is Capto phenyl (HS) or Capto Butyl Impres; the equilibration buffer is 20 mM PB + 1.5 M NaCl, pH 6.5–7.5; and the elution buffer is 20 mM PB, pH 6.5–7.5.
[0047] Specifically, the ion exchange chromatography includes: after equilibration of the anion exchange chromatography column, loading the harvested sample containing the target protein obtained from hydrophobic chromatography, washing the chromatography column with equilibration buffer until the baseline absorbance is stable, eluting with elution buffer, and collecting and combining the eluent containing the target recombinant protein. More specifically, the ion exchange chromatography packing material is Capto Q impres; the equilibration buffer is 50 mM Tris-HCl, pH 7.5~8.5, and the elution buffer is 50 mM Tris-HCl + 1 M NaCl, pH 7.5~8.5.
[0048] Furthermore, the enzymatic activation includes: mixing the purified rBoNT recombinant protein precursor with a specific protease, incubating at a suitable temperature, so that the precursor protein is precisely cleaved at a preset cleavage site, releasing the active rBoNT recombinant protein. In this invention, the specific protease is enterokinase.
[0049] The present invention also provides the use of the rBoNT recombinant protein or the rBoNT recombinant protein precursor in the preparation of a drug.
[0050] The medication includes therapeutic drugs or cosmetic products. Specifically, the medication treats at least one of the following conditions: muscle spasms, dystonia, strabismus, blepharospasm, spasmodic torticollis, cerebral palsy, multiple sclerosis, Parkinson's disease, cerebrovascular disease, spinal cord injury, chronic pain, or migraine. The cosmetic product is used to reduce wrinkles, slim the face, body, or legs.
[0051] A pharmaceutical or medical aesthetic product is characterized by comprising the rBoNT recombinant protein of the present invention as described above, and pharmaceutically acceptable excipients or medical aesthetic product-acceptable excipients.
[0052] The rBoNT recombinant protein or rBoNT recombinant protein precursor described in this invention can also be combined with pharmaceutically or medical aesthetic product-acceptable carriers or excipients to form drugs or medical aesthetic products. Further, the pharmaceutically acceptable carriers include buffers, stabilizers, preservatives, isotonic modifiers, ionic compounds, surfactants, lyophilization protectants, etc., or combinations thereof; the dosage forms of the drug compositions include injections, lyophilized powder injections, etc.
[0053] This invention unexpectedly discovered that using 30-100kD membrane-encapsulated ultrafiltration technology to replace affinity chromatography in a three-step purification process for target protein purification can achieve similar purity and yield levels. This alternative strategy simplifies downstream processes, reducing production costs and the risk of contamination associated with the use of affinity packing materials. In nature, the light and heavy chains of clostridium neurotoxins are linked by disulfide bonds, and there exists a loop region (also known as a linker sequence) whose length varies with serotype. When the toxin is released from clostridium, this loop is cleaved by endogenous proteases. Taking BoNT / A as an example, its loop sequence undergoes two enzymatic cleavages during the cleavage process, yielding a decapeptide, ultimately linking the light and heavy chains only by disulfide bonds. However, due to the randomness of protease cleavage (which can occur at both the loop region and the heavy chain end), a large number of non-target intermediates are generated, significantly increasing purification difficulty and reducing the final yield. This cyclic region (e.g., the 15 amino acids at the C-terminus of the light chain and the 3 amino acids at the N-terminus of the heavy chain) is located at the domain junction or surface loop region and does not participate in core functions such as catalysis, binding, or translocation; its deletion does not affect the activity of the final toxin. According to research by Michael R. Baldwin et al., the deletion of 30 amino acids at the C-terminus of LC / A can improve the stability of recombinant LC / A, but in vitro cleavage of the SNAP25 protein revealed that excessive deletion of the C-terminal sequence reduces the protein's catalytic activity. This invention found that the toxicity of recombinant full-length type A botulinum toxin with the deletion of 30 amino acids at the C-terminus of the light chain is significantly reduced. This invention constructs a batch of soluble recombinant E. coli strains that can be specifically activated by enzyme cleavage by deleting variable structural regions (1-15 amino acids at the C-terminus of the light chain and / or 1-3 amino acids at the N-terminus of the heavy chain) while retaining the disulfide bonds between the light and heavy chains, using different deletion combinations. Among the various combinations, the recombinant protein rBoNT-M64, with 15 amino acids at the C-terminus of the light chain and 3 amino acids at the N-terminus of the heavy chain, is the optimal combination. Its virulence is significantly superior to the full-length sequence, and its expression level is significantly increased. Other deletion combinations are significantly less effective; for example, recombinant proteins with 10 amino acids missing at the C-terminus of LC and 1 amino acid missing at the N-terminus of HC only maintain protein yield and botulinum toxin virulence comparable to the full-length sequence. The recombinant Clostridium botulinum neurotoxin protein precursor constructed in this invention is not easily cleaved by proteases similar to precursor toxin hydrolases in E. coli, significantly reducing the presence of partially processed inactive recombinant botulinum toxin and fully processed active botulinum toxin mixed in the recombinant botulinum toxin precursor polypeptide. Simultaneously, a new purification technique was developed for the recombinant Clostridium botulinum neurotoxin protein expressed by recombinant E. coli strains with introduced tags and restriction enzyme sites, removing endogenously introduced tags and restriction enzyme sites as well as exogenously introduced specific proteases. This ensures the acquisition of high-purity, high-efficiency, and active recombinant Clostridium botulinum neurotoxin protein.
[0054] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0055] The present invention provides a method for optimizing the amino acid sequence of botulinum neurotoxin, successfully enabling soluble expression of botulinum neurotoxin protein in *E. coli*. Simultaneously, a novel purification process improves the purity of the botulinum neurotoxin protein, yielding a highly bioactive double-stranded botulinum neurotoxin. The histidine tag not only allows for affinity chromatography purification but also improves the soluble expression level of recombinant botulinum toxin protein. Research has shown that the purification method for recombinant botulinum toxin protein can replace affinity chromatography with 30-100 kD membrane ultrafiltration, optimizing the botulinum neurotoxin process steps, significantly reducing biosafety risks, and facilitating the scale-up of botulinum neurotoxin industrial production, providing a solid foundation for the large-scale production of botulinum neurotoxin. Attached Figure Description
[0056] Figure 1 This is the spectral information of the recombinant plasmid pET28a-(rBoNT-M00) of this invention;
[0057] Figure 2 This is the spectral information of the recombinant plasmid pET28a-(rBoNT-M16) of this invention;
[0058] Figure 3 This is the spectral information of the recombinant plasmid pET28a-(rBoNT-M19) of this invention;
[0059] Figure 4 This is the spectral information of the recombinant plasmid pET28a-(rBoNT-M64) of this invention;
[0060] Figure 5 This is an SDS-Page diagram of recombinant botulinum neurotoxin strains pET28a-BoNT / A(1), pET28a-BoNT / A(2), and pET28-(rBoNT-M19) expressing recombinant proteins. M is the marker, S1 is the supernatant after centrifugation of pET28a-BoNT / A(1), P1 is the precipitate after centrifugation of pET28a-BoNT / A(1); S2 is the supernatant after centrifugation of pET28a-BoNT / A(2), and P2 is the supernatant after centrifugation of pET28a-BoNT / A(2). A(2) is the precipitate after lysis and centrifugation of bacterial culture; S3 is the supernatant after lysis and centrifugation of pET28a-(rBoNT-M19) bacterial culture; P3 is the precipitate after lysis and centrifugation of pET28a-(rBoNT-M19) bacterial culture. Note: pET28a-BoNT / A(1) is abbreviated as M00, which is a recombinant expression strain of codon optimization method 1; pET28a-BoNT / A(2) is a recombinant expression strain of codon optimization method 2; pET28-(rBoNT-M19) is abbreviated as M19, which is a recombinant expression strain modified from M00.
[0061] Figure 6This is an SDS-Page diagram of the recombinant botulinum neurotoxin strain pET28a-(rBoNT-M00) induced expression and purification of the recombinant toxin protein after enzyme digestion. M is the marker, S is the supernatant after bacterial lysis and centrifugation, E1 is the 30-100kD membrane encapsulation ultrafiltration buffer, E2 is the hydrophobic chromatography eluent, E3 is the ion exchange chromatography eluent, N is the non-reduced page after enzyme digestion, and D is the reduced page after enzyme digestion.
[0062] Figure 7 This is an SDS-Page diagram of the recombinant botulinum neurotoxin strain pET28a-(rBoNT-M16-1) induced expression and purification of the recombinant toxin protein after enzyme digestion. M is the marker, S is the supernatant after bacterial lysis and centrifugation, E1 is the affinity chromatography eluent, E2 is the hydrophobic chromatography eluent, E3 is the ion exchange chromatography eluent, N is the non-reduced page after enzyme digestion, and D is the reduced page after enzyme digestion.
[0063] Figure 8 This is an SDS-Page diagram of the recombinant botulinum neurotoxin strain pET28a-(rBoNT-M19-1) induced expression and purification of the recombinant toxin protein after enzyme digestion. M is the marker, S is the supernatant after bacterial lysis and centrifugation, E1 is the affinity chromatography eluent, E2 is the hydrophobic chromatography eluent, E3 is the ion exchange chromatography eluent, N is the non-reduced page after enzyme digestion, and D is the reduced page after enzyme digestion.
[0064] Figure 9 This is an SDS-Page diagram of the recombinant botulinum neurotoxin strain pET28a-(rBoNT-M64-1) induced expression and purification of the recombinant toxin protein after enzyme digestion. M is the marker, S is the supernatant after bacterial lysis and centrifugation, E1 is the affinity chromatography eluent, E2 is the hydrophobic chromatography eluent, E3 is the ion exchange chromatography eluent, N is the non-reduced page after enzyme digestion, and D is the reduced page after enzyme digestion.
[0065] Figure 10 This is an SDS-Page diagram of the recombinant botulinum neurotoxin strain pET28a-(rBoNT-M16-2) induced expression and purification of the recombinant toxin protein after enzyme digestion. M is the marker, S is the supernatant after bacterial lysis and centrifugation, E1 is the 30-100kD membrane encapsulation ultrafiltration buffer, E2 is the hydrophobic chromatography eluent, E3 is the ion exchange chromatography eluent, N is the non-reduced page after enzyme digestion, and D is the reduced page after enzyme digestion.
[0066] Figure 11This is an SDS-Page diagram of the recombinant botulinum neurotoxin strain pET28a-(rBoNT-M19-2) induced expression and purification of the recombinant toxin protein after enzyme digestion. M is the marker, S is the supernatant after bacterial lysis and centrifugation, E1 is the 30-100kD membrane encapsulation ultrafiltration buffer, E2 is the hydrophobic chromatography eluent, E3 is the ion exchange chromatography eluent, N is the non-reduced page after enzyme digestion, and D is the reduced page after enzyme digestion.
[0067] Figure 12 This is an SDS-Page diagram of the recombinant botulinum neurotoxin strain pET28a-(rBoNT-M64-2) induced expression and purification of the recombinant toxin protein after enzyme digestion. M is the marker, S is the supernatant after bacterial lysis and centrifugation, E1 is the 30-100kD membrane encapsulation ultrafiltration buffer, E2 is the hydrophobic chromatography eluent, E3 is the ion exchange chromatography eluent, N is the non-reduced page after enzyme digestion, and D is the reduced page after enzyme digestion.
[0068] Figure 13 This is an HPLC chromatogram of the recombinant botulinum neurotoxin strain pET28a-(rBoNT-M00) of the present invention after trypsin digestion;
[0069] Figure 14 This is an HPLC chromatogram of the recombinant botulinum neurotoxin strain pET28a-(rBoNT-M16-1) of the present invention after purification by method 1 and after enterokinase digestion;
[0070] Figure 15 This is an HPLC chromatogram of the recombinant botulinum neurotoxin strain pET28a-(rBoNT-M19-1) of the present invention after purification by method 1 and after enterokinase digestion;
[0071] Figure 16 This is an HPLC chromatogram of the recombinant botulinum neurotoxin strain pET28a-(rBoNT-M64-1) of the present invention after purification by method 1 and after enterokinase digestion;
[0072] Figure 17 This is an HPLC chromatogram of the recombinant botulinum neurotoxin strain pET28a-(rBoNT-M16-2) of the present invention after purification by method 2 and after enterokinase digestion;
[0073] Figure 18 This is an HPLC chromatogram of the recombinant botulinum neurotoxin strain pET28a-(rBoNT-M19-2) of the present invention after purification by method 2 and after enterokinase digestion;
[0074] Figure 19 This is an HPLC chromatogram of the recombinant botulinum neurotoxin strain pET28a-(rBoNT-M64-2) of the present invention after purification by method 2 and after enterokinase digestion;
[0075] Figure 20 This is a graph showing the significant difference in the production of botulinum toxin protein expressed and purified by the recombinant expression strain pET28a-(rBoNT-MX). M00 is the code for pET28a-BoNT / A(1), M16 is the code for pET28a-(rBoNT-M16), M19 is the code for pET28a-(rBoNT-M19), M64 is the code for pET28a-(rBoNT-M64), ns is P>0.05, **** is P<0.0001. Detailed Implementation
[0076] This invention provides recombinant botulinum neurotoxin protein, its precursor, its preparation method, and its applications. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments; those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.
[0077] In this document, the terms "including", "comprising", and "having" describe both closed-loop technical solutions consisting of the listed features and open-loop technical solutions that include the listed features.
[0078] In this document, the term “and / or” as used includes any and all combinations of one or more of the related listed items.
[0079] In this document, numerical ranges are referred to as continuous unless otherwise specified, and include the minimum and maximum values of the range, as well as every value between the minimum and maximum values. Furthermore, when a range refers to an integer, it includes every integer between the minimum and maximum values of the range. Additionally, when multiple ranges are provided to describe a feature or characteristic, the ranges may be combined. In other words, unless otherwise specified, all ranges disclosed herein should be understood to include any and all subranges to which they are incorporated.
[0080] In this article, when referring to units for data ranges, if the unit is only followed by the right endpoint, it means that the units for the left and right endpoints are the same. For example, 200~400rpm means that the units for the left endpoint "200" and the right endpoint "400" are both rpm.
[0081] This invention provides a recombinant botulinum neurotoxin protein precursor that is soluble in expression and not easily cleaved by protoxin-like hydrolytic enzymes in Escherichia coli, the sequence of which includes:
[0082] (1) A first polypeptide fragment, wherein the first polypeptide fragment comprises: a tag protein-first restriction site structural region. The nucleotide sequence of the first polypeptide fragment is shown in SEQ ID NO:9, and the amino acid sequence is shown in SEQ ID NO:10.
[0083] (2) A second polypeptide fragment, wherein the second polypeptide fragment comprises:
[0084] (a) Functional amino acid domain of the recombinant botulinum toxin light chain. It contains the catalytic domain of the toxin, exhibiting zinc-dependent protease activity. Upon entering the cytoplasm, the LC (lower lysine ligand) is activated to exert protease activity, specifically cleaving the SNARE complex protein (soluble N-ethylmaleimide-sensitive factor attachment protein receptor), a key protein regulating the fusion of synaptic vesicles with the presynaptic membrane, thus retaining acetylcholine vesicles on the presynaptic membrane. Botulinum toxin induces flaccid paralysis by inhibiting the release of neurotransmitters from synaptic vesicles and blocking neurotransmitter transmission. The optimized nucleotide sequence of the botulinum toxin light chain functional domain is shown in SEQ ID NO:1, and the amino acid sequence is shown in SEQ ID NO:4.
[0085] (b) The variable structure region of the recombinant botulinum toxin light chain, wherein all or part of the amino acids in this region may be deleted. By altering the amino acid sequence of this region, the expression level of recombinant botulinum toxin protein can be increased without affecting the toxicity of recombinant botulinum toxin. The optimized nucleotide sequence of the variable structure region of the botulinum toxin light chain is shown in SEQ ID NO:2, and the amino acid sequence is shown in SEQ ID NO:5.
[0086] (c) Second restriction enzyme site structural region. The nucleotide sequence of the second restriction enzyme site structural region is shown in SEQ ID NO:11, and the amino acid sequence is shown in SEQ ID NO:12.
[0087] (3) A third polypeptide fragment, wherein the third polypeptide fragment comprises:
[0088] (a) The variable structure region of the recombinant botulinum toxin heavy chain, in which all or part of the amino acids can be deleted. By altering the amino acid sequence of this region, the expression level of recombinant botulinum toxin protein can be increased without affecting the toxicity of recombinant botulinum toxin. The optimized nucleotide sequence of the variable structure region of the botulinum toxin heavy chain is gccctgaac, and the amino acid sequence is ALN.
[0089] (b) The functional amino acid structural region of the recombinant botulinum toxin heavy chain. It contains the C-terminal targeting component (H... C (structural domain) and N-terminal translocation group (H N (structural domain). Where H NThis is a translocation domain responsible for transporting the botulinum toxin light chain into the neuronal cell. H C The receptor-binding domain (LC) is responsible for binding to specific receptors on the presynaptic membrane of motor nerve endings at the neuromuscular junction. After botulinum toxin enters the cell via endocytosis, the disulfide bonds break, and the free LC enters the cytoplasm of the nerve ending to exert its toxic function. The optimized nucleotide sequence of the botulinum toxin heavy chain functional region is shown in SEQ ID NO:3, and the amino acid sequence is shown in SEQ ID NO:6.
[0090] The recombinant botulinum neurotoxin protein is achieved using the following technical solution:
[0091] The nucleotide sequence of the neurotoxin gene region of *Clostridium botulinum* strain Hall (accession number AF488749) was optimized using commonly used *E. coli* codons, while balancing the proportions and distributions of A, T, C, and G nucleotides. The nucleic acid sequence of the coding gene for the *Clostridium botulinum* strain Hall neurotoxin after codon optimization method 1 is shown in SEQ ID NO:7, and the amino acid sequence is shown in SEQ ID NO:8. The *Clostridium botulinum* strain Hall neurotoxin after codon optimization method 1 underwent the following steps: the introduction of a first polypeptide fragment; the introduction of a second restriction enzyme site structural region at the C-terminus of the light chain (i.e., between the light and heavy chains); partial or complete deletion of the variable structure region of the light chain of the second polypeptide fragment recombinant botulinum toxin; and partial or complete deletion of the variable structure region of the heavy chain of the third polypeptide fragment recombinant botulinum toxin. A recombinant plasmid of recombinant botulinum toxin neurotoxin was constructed through gene synthesis.
[0092] This invention provides a purification technique for soluble expression of botulinum neurotoxin protein by a recombinant Escherichia coli strain. The purification process includes the following steps:
[0093] (a) The synthesized recombinant expression vector was heat-shocked and transformed into Escherichia coli competent cells BL21(DE3).
[0094] (b) Recombinant botulinum neurotoxin strain fermented and induced to express in Kana liquid medium.
[0095] (c) The induced product was centrifuged and resuspended, and the supernatant was collected by homogenization and centrifugation. The crude pure recombinant botulinum neurotoxin protein was obtained by affinity chromatography or ultrafiltration with a 30-100kD membrane.
[0096] (d) Crude recombinant botulinum neurotoxin protein was obtained using hydrophobic chromatography and anion exchange. After anion exchange chromatography, it was digested with enterokinase (EK) to obtain high-purity active recombinant botulinum neurotoxin protein.
[0097] According to an embodiment of the present invention, the recombinant botulinum toxin light chain functional region nucleic acid fragment has the nucleotide sequence shown in SEQ ID NO:1:
[0098] atgccttttg tgaacaagca gttcaactac aaggaccctg tgaatggtgt tgacatcgcctatatcaaga ttccgaatgc aggtcagatg cagcctgtga aagcattcaa gatccacaac aagatctgggtgattccgga acgtgacacc tttaccaacc cggaggaggg tgatttaaac cctccgcctg aagccaaacaggttccggtt agctactacg atagcaccta cctgagcacc gacaatgaaa aggacaacta cctgaaaggtgtgaccaaac tgttcgagcg catctatagc acagacctgg gtcgcatgct gctgaccagt atcgtgcgtggtattccttt ttggggtggt agcaccatag acaccgagct gaaggttatc gataccaact gcatcaacgtgattcagccg gacggtagct atagaagcga ggaactgaac ctggtgatta ttggtcctag cgccgatattattcagttcg agtgcaagag ctttggtcat gaggttctga acctgacccg taacggttac ggtagcacccagtatattcg ctttagccct gatttcacct tcggtttcga ggaaagcctg gaggtggaca ccaatcctttactgggtgcc ggtaaattcg ccacagatcc ggccgtgaca ttagcccacg aactgattca cgcaggtcatcgtctgtacg gtattgcaat taaccctaac cgcgtgttta aagttaatac caacgcctac tacgagatgagcggtctgga ggttagcttt gaagagctgc gtaccttcgg tggtcatgac gcaaaattca tcgatagcctgcaggagaac gagttccgtc tgtactacta caacaagttc aaggacatcg caagcaccct gaacaaggccaaaagcatcg ttggtacaacagccagcctg cagtatatga aaaacgtgtt caaggaaaag tacctgctgagcgaagacac cagcggtaag tttagcgttg acaagctgaa gtttgacaag ctgtacaaga tgctgaccgagatttatacc gaggacaact tcgttaagtt tttcaaggtg ctgaatcgta aaacctacct gaacttcgataaggcagtct tcaaaatcaa catcgtgccg aaagttaact acaccatcta tgacggcttt aacctgcgtaacaccaatct ggccgcaaat ttcaatggtc agaacaccga gatcaacaac atgaacttca ccaagctgaagaacttcacc ggtctgttcg agttttataa gctgctgtgt gtgcgcggt.
[0099] According to an embodiment of the present invention, the nucleic acid fragment of the variable structure region of the recombinant botulinum toxin light chain has the nucleotide sequence shown in SEQ ID NO:2:
[0100] atcatcacca gcaagaccaa aagcctggac aagggttata ataaa.
[0101] According to an embodiment of the present invention, the nucleotide sequence of the recombinant botulinum toxin heavy chain variable structure region nucleic acid fragment is: gccctgaac.
[0102] According to an embodiment of the present invention, the recombinant botulinum toxin heavy chain functional region nucleic acid fragment has the nucleotide sequence shown in SEQ ID NO:3, as follows:
[0103] gatctgtgca tcaggttaa taactgggac ctgtttta gccgagcga agatacttcaccacgacc tgaataagg tgaggaatt accagcgata ccacattga ggcagccgag gagacattagcctgacct gatccagcag tattatga ccacatcacaacc tcagcattgaaaacctgagc agcgatatta ttggtcagct ggagctgatg cctaacattg aacgctttcc caacggtaagaatacgagc tggatagta caccatgttt cactactgc gtgcccagga gttcgagcac ggtaaaagcctagtagggattgcccct gaccacct ccctagccgc gtgtacacct tctttagcagcgactacgtt aagaaagtga acaaagccac cgaggcagca atgttctgg gttggttga gcagctgtttacgacttta ccgacgagac aagcgaagtt agcaccaccg ataaatcgc cgacgcctcccct aacatcggta atatgctgta caaggacgac tcgtgggtg ccctgatttttagcggtgca gtcatcctgc tggagtttat tccggaatc gccatccctg tgctgggtac atttgcctgggagctata ttgcaaataa ggtgctgacc agattagcatcagc t cgtaacgaaagtgggacga agtgtacaa tacattgtga ccaactggct ggccaaggtt aacaccaga tcgatctccgtaagaag atgaggaag cactggagaa tcaggcagag gccaccaagg caatcatcaa ctaccagtacaatcagtaca ccgaggaggagaagaacaat atcaacttca acatcgacga tctgagcagc aagctgaacgagagcattaa caaagccatg atcacatca acagttcct gaaccagtgt agcgtgagct atctgaacagcatgatt ccgtatggtg tgaagcgtct ggaggacagttcc tgaggacagttcc cctgctgaagtacatttacg ataatcgtgg tacactgatc ggtcaggttg atcgcctga agacaagtg ataacaccctgagcaccga catccctttt cagctgagca atacgttga taaccagcgc cctgctgagca ccttcaccgaatagcactcatcag aacacag cgctatgaaa gcaaccatct gatcgatctgagccgttag caagcagat taacatcggt agcaagtga acttcgaccc cattgacaaa aaccagatccagctgttca cctggaagc agcagatcg aagtgattct gaaaaccgcc atcgtgtaca tt acgacaccactacctt tactcccaag tactttaata gcatcagcct gaacaacgaatacaccatca tcaactgcat ggagaataat agcggttgga aagtgagcct gattacggt gaattattttggaccctgca ggatacccag gaatcaacga aacgtgtgt gtttaagtat tcagatcga tcagctaccattag cattaccaat aaccgtctga acacagca gatctacatcaatgtcgcc tgattgacca gaagccgatc agcaacctg gtaatattca tgccagcaac aacatcatgttcaactgga cggttgccgt gatacccacgttacatctg gatcaagtac ttcaacctgt tcgataaggaactgaacgag aaggagatta aggacctgta cgacaatcag agcaatagcg gtatcctgaa agatttctggggtgactatc tgcagtatga caagccttac tacatgctga atctgtatga ccctaacaag tatgtggacgttaacaatgt gggtattcgc ggttatatgt acctgaaggg tcctcgcggt agcgttatga ccaccaacatctatctgaat agcagcctgt atcgcggtac aaaattcatc atcaagaagt atgccagcgg taacaaagataacatcgtgc gtaataatga ccgcgtgtac attaacgtgg tggtgaagaa caaagaatat cgtctggccaccaatgctag tcaagccggt gtggagaaga ttctgagcgc cctggagatt cctgacgtgg gtaacctgagccaggttgtt gttatgaaga gcaagaatga ccagggtatc accaacaagt gcaaaatgaa cctgcaggacaataacggta atgacatcgg ctttattggt ttccaccagt tcaacaacat tgcaaaactg gtggccagcaactggtataa ccgtcagatc gaacgcagca gtcgcacctt aggttgcagc tgggaattta ttcctgttgacgacggttgg ggtgaacgcc ctttatga.
[0104] According to an embodiment of the present invention, the amino acid fragment of the recombinant botulinum toxin light chain functional region has the amino acid sequence shown in SEQ ID NO:4, and the specific sequence is as follows:
[0105] Met Pro Phe Val Asn Lys Gln Phe Asn Tyr Lys Asp Pro Val Asn Gly ValAsp Ile Ala Tyr Ile Lys Ile Pro Asn Ala Gly Gln Met Gln Pro Val Lys Ala PheLys Ile His Asn Lys Ile Trp Val Ile Pro Glu Arg Asp Thr Phe Thr Asn Pro GluGlu Gly Asp Leu Asn Pro Pro Pro Glu Ala Lys Gln Val Pro Val Ser Tyr Tyr AspSer Thr Tyr Leu Ser Thr Asp Asn Glu Lys Asp Asn Tyr Leu Lys Gly Val Thr LysLeu Phe Glu Arg Ile Tyr Ser Thr Asp Leu Gly Arg Met Leu Leu Thr Ser Ile ValArg Gly Ile Pro Phe Trp Gly Gly Ser Thr Ile Asp Thr Glu Leu Lys Val Ile AspThr Asn Cys Ile Asn Val Ile Gln Pro Asp Gly Ser Tyr Arg Ser Glu Glu Leu AsnLeu Val Ile Ile Gly Pro Ser Ala Asp Ile Ile Gln Phe Glu Cys Lys Ser Phe GlyHis Glu Val Leu Asn Leu Thr Arg Asn Gly Tyr Gly Ser Thr Gln Tyr Ile Arg PheSer Pro Asp Phe Thr Phe Gly Phe Glu Glu Ser Leu Glu Val Asp Thr Asn Pro LeuLeu Gly Ala Gly Lys Phe Ala Thr Asp Pro Ala Val Thr Leu Ala His Glu Leu IleHis Ala Gly His Arg Leu Tyr Gly Ile Ala Ile Asn Pro Asn Arg Val Phe Lys ValAsn Thr Asn Ala Tyr Tyr Glu MetSer Gly Leu Glu Val Ser Phe Glu Glu Leu ArgThr Phe Gly Gly His Asp Ala Lys Phe Ile Asp Ser Leu Gln Glu Asn Glu Phe ArgLeu Tyr Tyr Tyr Asn Lys Phe Lys Asp Ile Ala Ser Thr Leu Asn Lys Ala Lys SerIle Val Gly Thr Thr Ala Ser Leu Gln Tyr Met Lys Asn Val Phe Lys Glu Lys TyrLeu Leu Ser Glu Asp Thr Ser Gly Lys Phe Ser Val Asp Lys Leu Lys Phe Asp LysLeu Tyr Lys Met Leu Thr Glu Ile Tyr Thr Glu Asp Asn Phe Val Lys Phe Phe LysVal Leu Asn Arg Lys Thr Tyr Leu Asn Phe Asp Lys Ala Val Phe Lys Ile Asn IleVal Pro Lys Val Asn Tyr Thr Ile Tyr Asp Gly Phe Asn Leu Arg Asn Thr Asn LeuAla Ala Asn Phe Asn Gly Gln Asn Thr Glu Ile Asn Asn Met Asn Phe Thr Lys LeuLys Asn Phe Thr Gly Leu Phe Glu Phe Tyr Lys Leu Leu Cys Val Arg Gly.
[0106] According to an embodiment of the present invention, the recombinant botulinum toxin light chain variable structure region nucleic acid fragment amino acid fragment has the amino acid sequence shown in SEQ ID NO:5, and the specific sequence is as follows:
[0107] Ile Ile Thr Ser Lys Thr Lys Ser Leu Asp Lys Gly Tyr Asn Lys.
[0108] According to an embodiment of the present invention, the amino acid sequence of the recombinant botulinum toxin heavy chain variable structure region nucleic acid fragment is Ala Leu Asn (i.e., ALN).
[0109] According to an embodiment of the present invention, the recombinant botulinum toxin heavy chain functional region nucleic acid fragment amino acid fragment has the amino acid sequence shown in SEQ ID NO:6, the specific sequence of which is as follows:
[0110] Asp Leu Cys Ile Lys Val Asn Asn Trp Asp Leu Phe Phe Ser Pro Ser GluAsp Asn Phe Thr Asn Asp Leu Asn Lys Gly Glu Glu Ile Thr Ser Asp Thr Asn IleGlu Ala Ala Glu Glu Asn Ile Ser Leu Asp Leu Ile Gln Gln Tyr Tyr Leu Thr PheAsn Phe Asp Asn Glu Pro Glu Asn Ile Ser Ile Glu Asn Leu Ser Ser Asp Ile IleGly Gln Leu Glu Leu Met Pro Asn Ile Glu Arg Phe Pro Asn Gly Lys Lys Tyr GluLeu Asp Lys Tyr Thr Met Phe His Tyr Leu Arg Ala Gln Glu Phe Glu His Gly LysSer Arg Ile Ala Leu Thr Asn Ser Val Asn Glu Ala Leu Leu Asn Pro Ser Arg ValTyr Thr Phe Phe Ser Ser Asp Tyr Val Lys Lys Val Asn Lys Ala Thr Glu Ala AlaMet Phe Leu Gly Trp Val Glu Gln Leu Val Tyr Asp Phe Thr Asp Glu Thr Ser GluVal Ser Thr Thr Asp Lys Ile Ala Asp Ile Thr Ile Ile Ile Pro Tyr Ile Gly ProAla Leu Asn Ile Gly Asn Met Leu Tyr Lys Asp Asp Phe Gly Ala Leu Ile PheSer Gly Ala Val Ile Leu Leu Glu Phe Ile Pro Glu Ile Ala With Pro Val Leu GlyThr Phe Ala Leu Val Ser Tyr With Ala Asn Lys Val Leu Thr Val Gln Thr With AspAsn Ala Leu Ser Lys Arg Asn GluLys Trp Asp Glu Val Tyr Lys Tyr Ile Val ThrAsn Trp Leu Ala Lys Val Asn Thr Gln Ile Asp Leu Ile Arg Lys Met Lys GluAla Leu Glu Asn Gln Ala Glu Ala Thr Lys Ala Ile Asn Tyr Gln Tyr Asn Glen GlnT Phe Asn Ile Asp Asp Leu Ser Ser LysLeu Asn Glu Ser Ile Asn Lys Ala Met Ile Asn Ile Asn Lys Phe Leu Asn Gln CysSer Val Ser Tyr Leu Met Asn Ser Met Ile Pro Tyr Gly Val Leu Lys Arg Leu Glu AspPhe Asp Alas Ser Typ Leu Lyu Asle Lys Gly ThrLeu Ile Gly Gln Val Asp Arg Leu Lys Asp Lys Val Asn Thr Leu Ser Thr AspIle Pro Phe Gln Leu Ser Lys Tyr Val Asp Asn Gln Arg Leu Leu Ser Thr Phe ThrGlu Tyr Ile Lys Asn Ile Ser Ile Asn Asn Thr G Asp Leu Ser Arg Tyr Ala Ser Lys Ile Asn Ile Gly Ser Lys Val AsnPhe Asp Pro Ile Asp Lys Asn Gln Ile Gln Leu Phe Asn Leu Glu Ser Ser Lys IleGlu Val Ile Leu Lys Asn Ala Ile Val Tyr Asn Ser Met Tyr Glu Asn Pro Sn Lys Phe T Thr Being Is BeingLeu Asn Asn Glu TyrThr Ile Ile Asn Cys Met Glu Asn Asn Ser Gly Trp Lys Val Ser Leu Asn Tyr GlyGlu Ile Ile Trp Thr Leu Gln Asp Thr Gln Glu Ile Lys Gln Arg Val Val Phe LysTyr Ser Gln Met Ile Asn Ile Ser Asp Tyr Ile Asn Arg Trp Ile Phe Val Thr IleThr Asn Asn Arg Leu Asn Asn Ser Lys Ile Tyr Ile Asn Gly Arg Leu Ile Asp GlnLys Pro Ile Ser Asn Leu Gly Asn Ile His Ala Ser Asn Asn Ile Met Phe Lys LeuAsp Gly Cys Arg Asp Thr His Arg Tyr Ile Trp Ile Lys Tyr Phe Asn Leu Phe AspLys Glu Leu Asn Glu Lys Glu Ile Lys Asp Leu Tyr Asp Asn Gln Ser Asn Ser GlyIle Leu Lys Asp Phe Trp Gly Asp Tyr Leu Gln Tyr Asp Lys Pro Tyr Tyr Met LeuAsn Leu Tyr Asp Pro Asn Lys Tyr Val Asp Val Asn Asn Val Gly Ile Arg Gly TyrMet Tyr Leu Lys Gly Pro Arg Gly Ser Val Met Thr Thr Asn Ile Tyr Leu Asn SerSer Leu Tyr Arg Gly Thr Lys Phe Ile Ile Lys Lys Tyr Ala Ser Gly Asn Lys AspAsn Ile Val Arg Asn Asn Asp Arg Val Tyr Ile Asn Val Val Val Lys Asn Lys GluTyr Arg Leu Ala Thr Asn Ala Ser Gln Ala Gly Val Glu Lys Ile Leu Ser Ala LeuGluIle Pro Asp Val Gly Asn Leu Ser Gln Val Val Val Met Lys Ser Lys Asn AspGln Gly Ile Thr Asn Lys Cys Lys Met Asn Leu Gln Asp Asn Asn Gly Asn Asp IleGly Phe Ile Gly Phe His Gln Phe Asn Asn Ile Ala Lys Leu Val Ala Ser Asn TrpTyr Asn Arg Gln Ile Glu Arg Ser Ser Arg Thr Leu Gly Cys Ser Trp Glu Phe IlePro Val Asp Asp Gly Trp Gly Glu Arg Pro Leu *.
[0111] According to an embodiment of the present invention, the recombinant botulinum neurotoxin codon optimization method 1 nucleic acid fragment has the nucleotide sequence shown in SEQ ID NO:7, and the specific sequence is as follows:
[0112] atgccttttg tgaacaagca gttcaactac aaggaccctg tgaatggtgt tgacatcgcctatatcaaga ttccgaatgc aggtcagatg cagcctgtga aagcattcaa gatccacaac aagatctgggtgattccgga acgtgacacc tttaccaacc cggaggaggg tgatttaaac cctccgcctg aagccaaacaggttccggtt agctactacg atagcaccta cctgagcacc gacaatgaaa aggacaacta cctgaaaggtgtgaccaaac tgttcgagcg catctatagc acagacctgg gtcgcatgct gctgaccagt atcgtgcgtggtattccttt ttggggtggt agcaccatag acaccgagct gaaggttatc gataccaact gcatcaacgtgattcagccg gacggtagct atagaagcga ggaactgaac ctggtgatta ttggtcctag cgccgatattattcagttcg agtgcaagag ctttggtcat gaggttctga acctgacccg taacggttac ggtagcacccagtatattcg ctttagccct gatttcacct tcggtttcga ggaaagcctg gaggtggaca ccaatcctttactgggtgcc ggtaaattcg ccacagatcc ggccgtgaca ttagcccacg aactgattca cgcaggtcatcgtctgtacg gtattgcaat taaccctaac cgcgtgttta aagttaatac caacgcctac tacgagatgagcggtctgga ggttagcttt gaagagctgc gtaccttcgg tggtcatgac gcaaaattca tcgatagcctgcaggagaac gagttccgtc tgtactacta caacaagttc aaggacatcg caagcaccct gaacaaggccaaaagcatcg ttggtacaacagccagcctg cagattatga aaaacgtgtt caaggaaaag tacctgctgagcgaagacac cagcggtaag tttagcgttg acaagctgaa gtttgacaag ctgtacaaga tgctgaccgagatttatacc gaggacaact tcgttaagtt tttcaaggtg ctgaatcgta aaacctacct gaacttcgataaggcagtct tcaaaatcaa catcgtgccg aaagttaact acaccatcta tgacggctt aacctgcgtaacaccaatct ggccgcaaat ttcaatggtc agaacaccga gatcaacaac atgaacttca ccaagctgaagaacttcacc ggtctgttcg agttttataa gctgctgtgt gtgcgcggta tcatcaccag caagaccaaaagcctggaca agggtttaa taaagccctg aacgatctgt gcatcaaggt taataactgg gacctgtttttagcccgag cgaagataac ttcaccaacac acctgaataa aggtgagaaa attaccagcg ataccaacattgaggcagcc gaggaagaa ttagcctgga cctgatccag footattatc tgaccttcaa cttcgacaatgagccggaaa acatcagcat tgaaaacctg agcagcgata ttatggtca gctggagctg atgcctaacattgaacgctt tcccaacggt aagaaatacg agctggataa gtacacatg tttcactatc tgcgtgcccaggagttcgag cacggtaaaa gccgtattgc cctgaccaat agcgttaacg aggccctgtt aaaccctagccgcgtgtaca ccttctttag cagcgactac gttaagaaag tgaacaaagc caccgaggca gcaatgtttctgggttgggt tgagcagctg gtttacgactttaccgacga gacaagcgaa gttagcacca ccgataaaatcgccgacatc accatcatta ttccgtatat cggtccggcc ctgaacatcg gtaatatgct gtacaaggacgacttcgtgg gtgccctgat ttttagcggt gcagtcatcc tgctggagtt tattccggaa atcgccatccctgtgctggg tacatttgcc ctggtgagct atattgcaaa taaggtgctg accgttcaga ccatcgataatgcactgagc aagcgtaacg aaaagtggga cgaagtgtac aaatacattg tgaccaactg gctggccaaggttaacaccc agatcgatct gatccgtaag aagatgaagg aagcactgga gaatcaggca gaggccaccaaggcaatcat caactaccag tacaatcagt acaccgagga ggagaagaac aatatcaact tcaacatcgacgatctgagc agcaagctga acgagagcat taacaaagcc atgatcaaca tcaacaagtt cctgaaccagtgtagcgtga gctatctgat gaacagcatg attccgtatg gtgtgaagcg tctggaggat ttcgacgcaagcctgaagga tgccctgctg aagtacattt acgataatcg tggtacactg atcggtcagg ttgatcgcctgaaagacaaa gtgaataaca ccctgagcac cgacatccct tttcagctga gcaaatacgt tgataaccagcgcctgctga gcaccttcac cgaatacatc aagaacatca tcaacaccag catcctgaat ctgcgctatgaaagcaacca tctgatcgat ctgagccgtt atgcaagcaa gattaacatc ggtagcaaag tgaacttcgaccccattgac aaaaaccaga tccagctgtt caacctggaaagcagcaaga tcgaagtgat tctgaaaaacgccatcgtgt acaacagcat gtacgaaaac tttagcacca gcttttggat tcgtatcccc aagtactttaatagcatcag cctgaacaac gaatacacca tcatcaactg catggagaat aatagcggtt ggaaagtgagcctgaattac ggtgaaatta tttggaccct gcaggatacc caggaaatca aacagcgtgt ggtgtttaagtatagccaga tgatcaacat tagcgactac atcaaccgtt ggatcttcgt gaccattacc aataccgtctgaacaacag caagatctac atcaatggtc gcctgattga ccagaagccg atcagcaacc tgggtaatattcatgccagc aacaacatca tgttcaaact ggacggttgc cgtgataccc atcgttacat ctggatcaagtacttcaacc tgttcgataa ggaactgaac gagaaggaga ttaaggacct gtacgacaat cagagcaatagcggtatcct gaaagattc tggggtgact atctgcagta tgacaagcct tactacatgc tgaatctgtatgaccctaac aagtatgtgg acgttaacaa tgtgggtatt cgcggtata tgtacctgaa gggtcctcgcggtagcgtta tgaccaccaa catctatctg aatagcagcc tgtatcgcgg tacaaaattc atcatcaagaagtatgccag cggtaacaaa gataacatcg tgcgtaataa tgaccgcgtg tacattaacg tggtggtgaagaacaaagaa tatcgtctgg ccaccaatgc tagtcaagcc ggtgtggaga agattctgag cgccctggagattcctgacg tgggtaacct gagccaggtt gttgttatga agagcaagatgaccagggt atcaccaacaagtgcaaaat gaacctgcag gacaataacg gtaatgacat cggctttatt ggtttccacc agttcaacaacattgcaaaa ctggtggcca gcaactggta taaccgtcag atcgaacgca gcagtcgcac cttaggttgcagctgggaat ttattcctgt tgacgacggt tggggtgaac gccctttatg a.
[0113] According to an embodiment of the present invention, the recombinant botulinum neurotoxin codon-optimized amino acid fragment has the amino acid sequence shown in SEQ ID NO:8, and the specific sequence is as follows:
[0114] Met Pro Phe Val Asn Lys Gln Phe Asn Tyr Lys Asp Pro Val Asn Gly ValAsp Ile Ala Tyr Ile Lys Ile Pro Asn Ala Gly Gln Met Gln Pro Val Lys Ala PheLys Ile His Asn Lys Ile Trp Val Ile Pro Glu Arg Asp Thr Phe Thr Asn Pro GluGlu Gly Asp Leu Asn Pro Pro Pro Glu Ala Lys Gln Val Pro Val Ser Tyr Tyr AspSer Thr Tyr Leu Ser Thr Asp Asn Glu Lys Asp Asn Tyr Leu Lys Gly Val Thr LysLeu Phe Glu Arg Ile Tyr Ser Thr Asp Leu Gly Arg Met Leu Leu Thr Ser Ile ValArg Gly Ile Pro Phe Trp Gly Gly Ser Thr Ile Asp Thr Glu Leu Lys Val Ile AspThr Asn Cys Ile Asn Val Ile Gln Pro Asp Gly Ser Tyr Arg Ser Glu Glu Leu AsnLeu Val Ile Ile Gly Pro Ser Ala Asp Ile Ile Gln Phe Glu Cys Lys Ser Phe GlyHis Glu Val Leu Asn Leu Thr Arg Asn Gly Tyr Gly Ser Thr Gln Tyr Ile Arg PheSer Pro Asp Phe Thr Phe Gly Phe Glu Glu Ser Leu Glu Val Asp Thr Asn Pro LeuLeu Gly Ala Gly Lys Phe Ala Thr Asp Pro Ala Val Thr Leu Ala His Glu Leu IleHis Ala Gly His Arg Leu Tyr Gly Ile Ala Ile Asn Pro Asn Arg Val Phe Lys ValAsn Thr Asn Ala Tyr Tyr Glu MetSer Gly Leu Glu Val Ser Phe Glu Glu Leu ArgThr Phe Gly Gly His Asp Ala Lys Phe Ile Asp Ser Leu Gln Glu Asn Glu Phe ArgLeu Tyr Tyr Tyr Asn Lys Phe Lys Asp Ile Ala Ser Thr Leu Asn Lys Ala Lys SerIle Val Gly Thr Thr Ala Ser Leu Gln Tyr Met Lys Asn Val Phe Lys Glu Lys TyrLeu Leu Ser Glu Asp Thr Ser Gly Lys Phe Ser Val Asp Lys Leu Lys Phe Asp LysLeu Tyr Lys Met Leu Thr Glu Ile Tyr Thr Glu Asp Asn Phe Val Lys Phe Phe LysVal Leu Asn Arg Lys Thr Tyr Leu Asn Phe Asp Lys Ala Val Phe Lys Ile Asn IleVal Pro Lys Val Asn Tyr Thr Ile Tyr Asp Gly Phe Asn Leu Arg Asn Thr Asn LeuAla Ala Asn Phe Asn Gly Gln Asn Thr Glu Ile Asn Asn Met Asn Phe Thr Lys LeuLys Asn Phe Thr Gly Leu Phe Glu Phe Tyr Lys Leu Leu Cys Val Arg Gly Ile IleThr Ser Lys Thr Lys Ser Leu Asp Lys Gly Tyr Asn Lys Ala Leu Asn Asp Leu CysIle Lys Val Asn Asn Trp Asp Leu Phe Phe Ser Pro Ser Glu Asp Asn Phe Thr AsnAsp Leu Asn Lys Gly Glu Glu Ile Thr Ser Asp Thr Asn Ile Glu Ala Ala Glu GluAsn Ile Ser Leu Asp Leu Ile Gln Gln Tyr Tyr Leu Thr PheAsn Phe Asp Asn GluPro Glu Asn Ile Ser Ile Glu Asn Leu Ser Ser Asp Ile Ile Gly Gln Leu Glu LeuMet Pro Asn Ile Glu Arg Phe Pro Asn Gly Lys Lys Tyr Glu Leu Asp Lys Tyr ThrMet Phe His Tyr Leu Arg Ala Gln Glu Phe Glu His Gly Lys Ser Arg Ile Ala LeuThr Asn Ser Val Asn Glu Ala Leu Leu Asn Pro Ser Arg Val Tyr Thr Phe Phe SerSer Asp Tyr Val Lys Lys Val Asn Lys Ala Thr Glu Ala Ala Met Phe Leu Gly TrpVal Glu Gln Leu Val Tyr Asp Phe Thr Asp Glu Thr Ser Glu Val Ser Thr Thr AspLys Ile Ala Asp Ile Thr Ile Ile Ile Pro Tyr Ile Gly Pro Ala Leu Asn Ile GlyAsn Met Leu Tyr Lys Asp Asp Phe Val Gly Ala Leu Ile Phe Ser Gly Ala Val IleLeu Leu Glu Phe Ile Pro Glu Ile Ala Ile Pro Val Leu Gly Thr Phe Ala Leu ValSer Tyr Ile Ala Asn Lys Val Leu Thr Val Gln Thr Ile Asp Asn Ala Leu Ser LysArg Asn Glu Lys Trp Asp Glu Val Tyr Lys Tyr Ile Val Thr Asn Trp Leu Ala LysVal Asn Thr Gln Ile Asp Leu Ile Arg Lys Lys Met Lys Glu Ala Leu Glu Asn GlnAla Glu Ala Thr Lys Ala Ile Ile Asn Tyr Gln Tyr Asn Gln Tyr Thr Glu Glu GluLysAsn Asn Ile Asn Phe Asn Ile Asp Asp Leu Ser Lys Leu Asn Glu Ser IleAsn Lys Ala Met Ile Asn Ile Asn Lys Phe Leu Asn Gln Cys Ser Val Ser Tyr LeuMet Asn Ser Met Ile Pro Tyr Gly Val I Lys Arg Leu Asp Lys Ser Alas Le Le Phe Tyr Asp Asn Arg Gly Thr Leu Ile Gly Gln ValAsp Arg Leu Lys Asp Lys Val Asn Thr Leu Ser Thr Asp Ile Pro Phe Gln LeuSer Lys Tyr Val Asp Asn Gln Arg Leu Leu Ser Thr Phe Thr Glu Tyr Ile Gly As Lys Arg AsnIle Ser Asn His Leu Ile Asp LeuSer Arg Tyr Ala Ser Lys Ile Asn Ile Gly Ser Lys Val Asn Phe Asp Pro Ile AspLys Asn Gln Ile Gln Leu Phe Asn Leu Glu Ser Ser Lys Ile Glu Val Ile Leu LysAsn Ala Ile Val Tyr P Tyr Ser T Glu Asn Met ArgIle Pro Lys Tyr Phe Asn Ser Ile Ser Leu Asn Asn Glu Tyr Thr Ile Ile Asn CysMet Glu Asn Asn Ser Gly Trp Lys Val Leu Asn Tyr Gly Glu Ile Ile Trp ThrLeu Gln Asp Thr Gln Glu Ile Lys Serle Serle Gln Me Tyl Arg Val Asp Tyr With AsnArg Trp Ile Phe Val Thr Ile Thr Asn Asn Arg LeuAsn Asn Ser Lys Ile Tyr Ile Asn Gly Arg Leu Ile Asp Gln Lys Pro Ile Ser AsnLeu Gly Asn Ile His Ala Ser Asn Ile Met Phe Lys Leu Asp Gly Cys Ile Tyrp Arg Tyr T AspThr Asn Leu Phe Asp Lys Glu Leu Asn GluLys Glu Ile Lys Asp Leu Tyr Asp Asp PheTrp Gly Asp Tyr Leu Gln Tyr Asp Lys Pro Tyr Lys Met Leu Asn Leu Tyr Asp Tyr Vally Arg Glly Asn Met Tyr Leu Lys GlyPro Arg Gly Ser Val Met Thr Thr Asn Ile Tyr Leu Asn Ser Ser Leu Tyr Arg GlyThr Lys Phe Ile Lys Lys Tyr Ala Ser Gly Asn Lys Asn Ile Val Arg Le Lys Val Glus Asp Arg Val Tyr Ile Asn Ar ThA Val Lys Val Glus Gln Ala Gly Val Glu Lys Ile Leu Ser Ala Leu Glu Ile Pro Asp ValGly Asn Leu Ser Gln Val Val Met Lys Ser Lys Asn Asp Gln Gly Ile Thr AsnLys Cys Lys Met Asn Leu Gln Asp Asn Asn Gly Asn Asp Ile Gly As Gly As Gly Phe Ala Ile Leu Val Ala Ser AsnTrp Tyr Asn Arg Gln IleGlu Arg Ser Ser Arg Thr Leu Gly Cys Ser Trp Glu Phe Ile Pro Val Asp Asp GlyTrp Gly Glu Arg Pro Leu *.
[0115] According to an embodiment of the present invention, the recombinant botulinum toxin first polypeptide fragment has the nucleotide sequence shown in SEQ ID NO:9.
[0116] atgcaccatc accatcacca tgatgacga cgataag.
[0117] According to an embodiment of the present invention, the recombinant botulinum toxin first polypeptide fragment has the amino acid sequence shown in SEQ ID NO:10:
[0118] Met His His His His His Asp Asp Asp Asp Lys.
[0119] According to an embodiment of the present invention, the recombinant botulinum toxin second enzyme cleavage site structural region has the nucleotide sequence shown in SEQ ID NO:11:
[0120] gatgacgacgataag.
[0121] According to an embodiment of the present invention, the recombinant botulinum toxin second enzyme cleavage site structural region has the amino acid sequence shown in SEQ ID NO:12:
[0122] Asp Asp Asp Asp Lys.
[0123] According to an embodiment of the present invention, the recombinant botulinum neurotoxin codon-optimized method 2 nucleic acid fragment has the nucleotide sequence shown in SEQ ID NO:13, and the specific sequence is as follows:
[0124] atgcccttcg taaaaa atttaactat aaagacccgg tcaacggtgt tgacattgcgtatatcaaaa tcccgaatgc gggccaaatg cagccggtta aagcgtttaa aattcataat aagatctgggttattcctga acgtgatacg tttacgaatc cggaagaggg tgatttgaac ccgccaccgg aagcgaaacaagttccggtt agctattacg acagcaccta tctgtccacc gataacgaaa aggacaacta cttgaagggtgtgacgaagc tgttcgaacg tatctacagc acagacctgg gccgtatgtt actgaccagc attgtgcgtggcattccgtt ttggggcggt agcactattg acaccgagtt gaaggtgatt gacaccaact gcattaacgtgatccaacca gatggcagct atcgtaggga agagctgaac ctggtgatta tcggcccaag cgcagacatcattcaatttg agtgcaagtc gtttggtcac gaagtgctga atctgacccg taatggttac ggttctacccagtatattcg ttttagtccg gattttacct tcggcttcga ggagagccta gaagttgata cgaacccgctgctgggtgcc ggtaaattcg ccaccgacc ggcggttacc ttagcgcatg aactgattca cgcgggtcatcgtctttacg ggattgcaat taacccgaac agagtgttta aagtgaacac caatgcctat tacgagatgagcggtctaga ggtctcgttc gagaattac gtactttgg tggccacgat gccaaattca tcgatagcttgcaagagaat gaatttcgtc tctactacta caataagttc aaggatattg cgagcaccct gaacaaagccaaaagcatcg taggtacgaccgcatcgttg caatacatga aaaatgtgtt caaagagaaa tacctgttgtcggaagacac ctctggcaag ttctccgtag ataaactgaa gttcgataaa ctgtacaaaa tgctcacggaatacact gaggacaatt tcgtaaagtt cttaaggtg ctgaatcgtatca aacctatca gaatttcgataaggcggttt tcaaaatcaa catcgtaccg aaagtcaact ataccattta cgatggtttt aatctgcgtaacaccaactt ggcggcgaat tttaacggcc agaataccga aattaacaac atgaatttca ccaaatttaaaaacttcacg ggtctgttcg aattttatagctgctgcgcg tcatcaccag taagaccaaaagcctcgata agggttataa caaggctctg aacgatctgt gcatcaaagt taacaactgg gatctttcttcagcccgag cgaagataat ttcactaacg acctgaataa gggtgaagag atcacctctg acacgaatatcgaggctgcg gagacttata tcagctcat tcatcag tgacctttaa cttcgataatgagccggaga acatctccat cgagaacctg agctcggata tcattggcca attggagctt atgccgaatatcgaacgctt tccgaatggt aaaaagtacg agctggataa gtatacgatg tttcattatc tgcgtgcacaggagttcgatag ccggcattcgc gcggcattcg tccgtgaacg aagcactgct gaatccgtcgcgcgtaca cctttttcag cagcgattac gttaaaaagg tcaataaggc aacggaagcg gcaatgttcctgggttgggt tgaacagctg gtttatgattttactgacga gacatctgag gtctctacca ctgataagatcgccgatatc acgatcatta ttccgtatat cggtccggca ttgaatattg gcaatatgct gtacaaagacgacttcgttg gtgcgcttat cttttcaggt gcggtgattc tgctggagtt tattccggaa atcgccatcccggttctggg cacgtttgcg ttagtgtcct atattgctaa taaggttctg accgttcaga ccattgacaacgctttgtcc aagcggaacg aaaagtggga tgaagtctat aaatacattg tgaccaactg gctggccaaagtgaacaccc agattgacct gattcgtaaa aagatgaaag aggctttgga gaaccaagcg gaagcgaccaaggcgatcat aaattatcag tataaccaat acaccgagga ggagaagaac aacattaatt tcaacatcgacgatttgtcg tcaaaactta acgagtctat taacaaggct atgattaata ttaacaaatt tctgaatcagtgtagcgtta gctatttaat gaattccatg attccgtacg gcgttaagcg tttggaagac ttcgacgcgtccctaaagga tgcgctactg aaatacatct atgacaacag aggcaccctg ataggccagg ttgaccgtctgaaggataag gtcaacaaca cgctgagcac cgacatccca tttcagctga gcaagtacgt ggacaaccagcgtttgctgt caaccttcac cgaatatatc aagaacatca tcaacaccag catcctgaac ctgcgttacgaatctaacca cctgattgat ctgtcccgtt atgcttctaa gatcaacatt ggtagcaaag ttaattttgaccccatcgat aaaaaccaaa ttcaactgtt taacttggagagcagcaaga ttgaagtcat cttgaaaaacgcaattgtct acaacctat gtatgagaac ttctcgacga gttttggat ccgcattccg aaatacttcattcag cctgaataat gagtacacca gcatcactg tatggactaac atagcggtt ggagactcagttagt caagaaatca agcagcgtgt ggtgttcaagtactcccaa tgatcacat tagcgactat atcaccgct ggatttttgt caccatacc ataatagactgaatacag cagatctac attaatgtc gtctgattga ccagaacct attagcaacc tcggtactatggcaactaccagcag cgtgataccc atcgttatat ctggattaaatacttcacc tgttcgacaa agaactgaac gaaaagaga tcaggacct ctacgacaac caaagcactctgggatcct gaaggacttc tgggggatt atttgcaata cgataagccg tattacatgt tgacaattg agtatgtagtaccgaat cgcggttata tgcgttata tgtacctgaa aggtccacgtgtagcgtta tgaccaccaa catctacctg aactctctt ataccgcgg taccaaattt atcatcagaaatacgcgtc cggcacaag vakacacacg tgcgcaataa cgacagagtg tacatcaccagacgacg tg cgacgaacgc tagtcaggca ggcgttgaa aaatcctgtc ggcgctggagatcccggacg tggcaactt gttgttatga agagcaagaacgaccagggt atcaccaacaagtgcaaaat gaacttgcaa gacaacaacg gtaacgacat cggattcatc ggcttccacc agtttaacaacatcgctaaa ttggttgcta gcaattggta taaccgtcaa attgaacgca gcagccgcac tctgggctgcagctgggaat ttatcccggt ggacgacggc tggggcgaac gcccgctgtg a.
[0125] Botulinum toxin type A (BoNT / A) is synthesized within Clostridium botulinum as a single-chain polypeptide of approximately 150 kDa. This precursor protein is non-toxic to nerve tissue, but when cleaved by proteases or proteases produced by the target cells themselves, it generates two polypeptide chains linked by a disulfide bond: a 50 kDa light chain (LC) and a 100 kDa heavy chain (HC), which then becomes toxic. HC acts as a transport carrier; its carboxyl terminus (HC) is the receptor-binding region, responsible for binding to specific neuronal surface receptors and transporting LC into the neuronal cell. LC is the catalytically active center of the toxin, causing neuromuscular paralysis and exerting its toxicity.
[0126] The present invention employs a method that, by altering the amino acid sequence and purification schemes, can improve the soluble expression level of botulinum toxin protein and effectively isolate botulinum toxin protein based on codon optimization.
[0127] The test materials used in this invention are all common commercial products and can be purchased on the market.
[0128] The present invention will be further described in conjunction with specific embodiments.
[0129] Example 1 Construction of recombinant botulinum neurotoxin strain
[0130] 1. The amino acid sequence of the neurotoxin from Clostridium botulinum strain Hall (accession number AF488749) was analyzed and optimized using common E. coli codons. Without altering the amino acid sequence, two codon optimizations were performed to construct the original plasmids pET28a-BoNT / A(1) and pET28a-BoNT / A(2). The amino acid sequences are shown in SEQ ID NO:8, the nucleic acid sequences of pET28a-BoNT / A(1) are shown in SEQ ID NO:7, and the nucleic acid sequences of pET28a-BoNT / A(2) are shown in SEQ ID NO:13. Induced expression and SDS-Page verification revealed that the soluble botulinum toxin yield of pET28a-BoNT / A(2) was significantly lower than that of pET28a-BoNT / A(1). Therefore, pET28a-BoNT / A(1) was selected as the starting recombinant strain in this invention.
[0131] Based on the constructed original plasmid pET28a-BoNT / A(1), a first polypeptide fragment (histidine tag-enterokinase cleavage site) was added to the N-terminus of the light chain of botulinum toxin type A. The nucleotide sequence of the first polypeptide fragment is shown in SEQ ID NO:9, and the amino acid sequence is shown in SEQ ID NO:10. An enterokinase cleavage site was added between the light and heavy chains of botulinum toxin type A. The nucleotide sequence of the second cleavage site structural region is shown in SEQ ID NO:11, and the amino acid sequence is shown in SEQ ID NO:12. Finally, by deleting 1-15 amino acids from the C-terminus of the recombinant botulinum neurotoxin protein light chain and / or deleting 1-3 amino acids from the N-terminus of the heavy chain, a batch of recombinant Escherichia coli strains with improved soluble expression were constructed. The deleteable nucleotide sequence of the C-terminus of the light chain is shown in SEQ ID NO:2, and the amino acid sequence is shown in SEQ ID NO:5. The deleteable nucleotide sequence of the N-terminus of the heavy chain is gccctgaac, and the amino acid sequence is Ala Leu Asn (i.e., ALN).
[0132] 2. In this embodiment, the optimized recombinant botulinum neurotoxin nucleotide sequence was synthesized by deleting 1-15 amino acids from the C-terminus of the light chain of the recombinant botulinum neurotoxin protein and / or deleting 1-3 amino acids from the N-terminus of the heavy chain.
[0133] Table 1: Deletion Site Design Table
[0134]
[0135] In this invention, pET28a-(rBoNT-MX) is used to refer to pET28a-(rBoNT-M00~M64). The original plasmid pET28a-BoNT / A(1) (containing only the full-length light and heavy chains) is named pET28a-(rBoNT-M00). Based on the addition of tag proteins and restriction enzyme sites, the following plasmids are named as follows: pET28a-(rBoNT-M01) with no deletion of the type A botulinum toxin amino acid sequence; pET28a-(rBoNT-M16) with a deletion of 15 amino acids from the C-terminus of the type A botulinum toxin light chain; pET28a-(rBoNT-M19) with a deletion of 3 amino acids from the N-terminus of the heavy chain; and pET28a-(rBoNT-M64) with a deletion of 15 amino acids from the C-terminus of the light chain and 3 amino acids from the N-terminus of the heavy chain. The mass spectrum information of the recombinant plasmids is as follows: Figures 1-4 As shown.
[0136] 3. The optimized sequence was designed and inserted between the NdeI and XhoI restriction sites of the pET28a(+) plasmid.
[0137] 4. The optimized synthetic nucleotide sequences of the Clostridium botulinum type A (Hall strain) neurotoxin gene region, pET28a-BoNT / A (1), pET28a-BoNT / A (2), and pET28a-(rBoNT-MX) plasmids, were transformed into Escherichia coli competent cells BL21(DE3) and cultured overnight at 37°C. After PCR and sequencing confirmation, the bacterial culture was mixed with 50% (V / V) glycerol solution at a 1:1 ratio and then aliquoted into sterile 2mL cryovials. The cryovials were then flash-frozen in liquid nitrogen and stored at -80°C.
[0138] Example 2 Expression of recombinant botulinum neurotoxin pET28a-BoNT / A (1) and pET28a-BoNT / (2) strains
[0139] 1. Fermentation expression
[0140] The preliminarily identified recombinant botulinum toxin expression strains pET28a-BoNT / A (1) and pET28a-BoNT / A (2) were inoculated into 100 mL of LB liquid medium (50 mg / L kanamycin) for resuscitation and culture. They were then inoculated into 0.8 L of fermentation liquid medium at a 1:100 inoculation ratio and fermented in a 1.5 L fermenter for expression. OD... 600 When the protein growth reaches 30±5°C, adjust the temperature to 16°C. After cooling, add IPTG to induce protein expression and monitor OD at regular intervals. 600 The bacterial weight was measured, and the culture was terminated and the bacterial solution was harvested after 16 hours of induction culture.
[0141] 2. Expression yield verification
[0142] The pET28a-BoNT / A(1) and pET28a-BoNT / A(2) bacterial cultures after induction culture were centrifuged at 4℃ and 5000g to collect bacterial cells. 1g of bacterial cells was resuspended in 15mL of 20mM PB + 1.5M NaCl + 2mM PMSF (pH=7.5) and then sonicated (200W, 2s operation, 3s interval, 20mins). The bacterial cell lysate was centrifuged at 4℃ and 10000g to collect the supernatant, which was then subjected to SDS-PAGE electrophoresis to identify the expression of recombinant botulinum neurotoxin protein, such as... Figure 5 As shown.
[0143] Given that the botulinum toxin production of pET28a-BoNT / (2) is much lower than that of pET28a-BoNT / A(1), this invention selects the pET28a-BoNT / A(1) expression cells constructed by codon optimization method 1 for subsequent purification.
[0144] Example 3: Fermentation and purification of recombinant botulinum neurotoxin pET28a-(rBoNT-M00) strain
[0145] 1. Fermentation expression
[0146] The preliminarily identified recombinant botulinum toxin expression strain pET28a-BoNT / A(1) was inoculated into 100 mL LB liquid medium (50 mg / L kanamycin) for resuscitation and culture. Then, it was inoculated into 10 L of fermentation liquid medium at a 1:100 ratio and fermented in a 15 L fermenter for expression. OD... 600 When the protein expression reached 30±5°C, the temperature was adjusted to 16°C. After cooling, the added IPTG began to induce protein expression, and OD was monitored periodically. 600 The bacterial weight was measured, and the culture was terminated and the bacterial solution was harvested after 16 hours of induction culture.
[0147] 2. Purification and enzymatic activation of botulinum toxin protein
[0148] (1) Cell disruption
[0149] After induction culture, the pET28a-BoNT / A(1) bacterial culture was centrifuged at 4℃ and 5000g to collect bacterial cells. 400g of bacterial cells were resuspended in 2L of 20mM PB + 1.5M NaCl + 5mM imidazole + 2mM PMSF (pH=7.5), and then homogenized (800~1500 bar). The bacterial cell lysate was centrifuged at 4℃ and 10000g to collect the supernatant, which was then subjected to SDS-PAGE electrophoresis to identify the expression of recombinant botulinum neurotoxin protein, such as... Figure 6 Lane S is shown.
[0150] (2) Membrane-encapsulated ultrafiltration
[0151] The supernatant after centrifugation of the bacterial culture was filtered through a 0.45 μm filter membrane for sterilization. The clarified solution was then subjected to ultrafiltration using a 50 kDa membrane: the pump speed was adjusted to 200-400 rpm to begin ultrafiltration, and the sample was concentrated to the system's minimum circulation volume. Simultaneously, the buffer solution was replaced with a 20 mM PB + 1.5 M NaCl (pH=7.0) buffer. The permeate valve was closed, and the reflux valve was opened simultaneously. The sample was collected and washed with at least one volume of equilibration buffer, and the washed samples were combined. Figure 6 As shown in lane E1.
[0152] (3) Hydrophobic Chromatography
[0153] The ultrafiltration harvest solution was subjected to hydrophobic chromatography using Capto phenyl (HS) or Capto Butyl Impres packing material. The equilibration buffer used for hydrophobic chromatography was 20 mM PB + 1.5 M NaCl (pH=7.0). After washing the column with the hydrophobic chromatography equilibration buffer, the sample was loaded. After loading, the hydrophobic groups of the target protein bound to the hydrophobic ligands of the chromatography medium. The column was then washed with the hydrophobic chromatography equilibration buffer. A step-by-step elution program was used with 20 mM PB (pH=7.0) as the elution buffer. During elution, collection began when the A280 absorbance reached 10 mAU, and ended when the peak decreased to 10 mAU. Figure 6 As shown in lane E2.
[0154] (4) Ion exchange
[0155] Hydrophobic chromatography was performed using Capto Q Impres packing material for anion exchange chromatography. The equilibration buffer was 50 mM Tris-HCl (pH=8.5). After washing with the ion exchange equilibration buffer until the baseline stabilized, the UV was zeroed. The column was then equilibrated until conductivity and pH stabilized before sample loading. The target protein was loaded and then bound to the stationary phase. The column was then washed with the ion exchange equilibration buffer for 3–5 CV until the baseline stabilized. Finally, a gradient elution mode of 0–100% B was set using 50 mM Tris-HCl + 1 M NaCl (pH=8.5) at an elution volume of 20 CV. During gradient elution, collection began when the A280 absorbance reached 10 mAU / mm and ended when the absorbance dropped to 50 mAU / mm after peak formation. Figure 6 As shown in lane E3.
[0156] (5) Enzyme digestion and activation
[0157] The purified, non-neurotoxic botulinum toxin precursor protein, approximately 150 kDa, was digested with proteases. A small-scale trypsin digestion was performed first (using a small sample) to determine the optimal enzyme concentration. After determining the optimal trypsin concentration, the botulinum toxin precursor protein was then subjected to a large-scale digestion. After digestion, a single 150 kDa protein band was visible on the SDS non-reducing gel image. Two protein bands were visible on the SDS reducing gel image: a 50 kDa light chain (LC) and a 100 kDa heavy chain (HC). This demonstrates that the botulinum toxin precursor protein has been cleaved by trypsin, forming a botulinum toxin protein composed of a disulfide-linked light and heavy chain. The recombinant botulinum neurotoxin was activated by protease digestion; the results are shown below. Figure 6 Lanes N and D are shown.
[0158] Example 4: Fermentation and purification of recombinant botulinum neurotoxin pET28a-(rBoNT-M16 / 19 / 64) strain
[0159] 1. Fermentation expression
[0160] The correctly identified recombinant botulinum toxin expression strain pET28a-(rBoNT-M16 / 19 / 64) was inoculated into 100 mL LB liquid medium (50 mg / L kanamycin) for resuscitation and culture. Then, it was inoculated into 10 L of fermentation liquid medium at a 1:100 inoculation rate and fermented in a 15 L fermenter for expression. OD... 600 When the protein growth reaches 30±5°C, adjust the temperature to 16°C. After cooling, add IPTG to induce protein expression and monitor OD at regular intervals. 600 The bacterial weight was measured, and the culture was terminated and the bacterial solution was harvested after 16 hours of induction culture.
[0161] 2. Purification of recombinant botulinum toxin protein
[0162] 2.1 Purification Method 1 for Recombinant Botulinum Toxin Protein
[0163] (1) Cell disruption
[0164] After induction culture, bacterial cells were collected by centrifugation at 4°C and 5000g. 400g of bacterial cells were resuspended in 2L of a resuspension solution of 20mM PB + 1.5M NaCl + 5mM imidazole + 2mM PMSF (pH=7.5), and then homogenized (800~1500 bar). The lysate was centrifuged at 4°C and 10000g, and the supernatant was collected for SDS-Page electrophoresis to identify the expression of recombinant botulinum neurotoxin protein. The results are as follows: Figures 7-9 Lane S is shown.
[0165] (2) Affinity chromatography
[0166] The supernatant after centrifugation of the bacterial culture was filtered through a 0.45 μm filter membrane for sterilization. The clarified solution was then purified using NiSepharos Excel packing material for affinity chromatography. The equilibration buffer used for affinity chromatography was 20 mM PB + 1.5 M NaCl + 5 mM imidazole (pH=7.5). The column was washed with the affinity buffer for at least 2 CV until the baseline stabilized, and the UV was zeroed. The filtered supernatant was loaded with 7-8 CV. The column was then washed with the affinity buffer for at least 5 CV until the baseline stabilized. A gradient elution program was set using 20 mM PB + 1.5 M NaCl + 500 mM imidazole (pH=7.5), with a elution volume of 10 CV from 0 to 100% B. The eluted sample was collected. Figures 7-9 As shown in lane E1, the target protein was initially captured. Most impurities failed to bind to the packing material and flowed through, thus achieving coarse separation of the tagged protein from the impurity protein.
[0167] (3) Hydrophobic Chromatography
[0168] Affinity chromatography eluent was used with Capto phenyl (HS) or Capto Butyl Impres packing material for hydrophobic chromatography. The equilibration buffer for hydrophobic chromatography was 20 mM PB + 1.5 M NaCl (pH=7.0). The column was washed with hydrophobic chromatography equilibration buffer for at least 2 CV until the baseline stabilized, and the UV was zeroed. The affinity chromatography eluent was then loaded onto the sample. After loading, the hydrophobic groups of the target protein bind to the hydrophobic ligands of the chromatography medium. The column was washed with hydrophobic chromatography equilibration buffer for at least 5 CV. A step-by-step elution program was used with 20 mM PB (pH=7.0) eluent. During elution, collection began when the A280 absorbance reached 10 mAU, and ended when the peak decreased to 10 mAU. Figures 7-9 Lane E2 is shown. Hydrophobic chromatography utilizes the reversible interaction between proteins and the surface of the hydrophobic chromatography medium, based on the different hydrophobicities of the protein surface, to remove histidine-tagged protein impurities with molecular weights of approximately 10 kD to 130 kD.
[0169] (4) Ion exchange
[0170] Hydrophobic chromatography was performed using Capto Q impres packing material for anion exchange chromatography. The equilibration buffer was 50 mM Tris-HCl (pH=8.5). The ion exchange equilibration buffer was used at a flow rate ≤150 cm / h, with an equilibration volume of at least 2 CV. After washing until the baseline stabilized, the UV was zeroed. The sample was loaded, and the target protein bound to the stationary phase. The column was washed with the ion exchange equilibration buffer for 3-5 CV until the baseline stabilized. A gradient elution mode of 0-100%B was set using 50 mM Tris-HCl + 1 M NaCl (pH=8.5) as the elution buffer, with an elution volume of 20 CV. During gradient elution, collection began when the A280 absorbance reached 10 mAU / mm and ended when the absorbance dropped to 50 mAU / mm after peak formation. Figures 7-9 As shown in lane E3, the target protein is finely purified by utilizing the difference in charge properties between the target protein and impurity proteins. Process-related impurities such as critical host cell proteins (HCP), host cell DNA (HCD), and endotoxins are also removed.
[0171] 2.2 Purification Method 2 for Recombinant Botulinum Toxin Protein
[0172] (1) Cell disruption
[0173] After induction culture, the bacterial cells were collected by centrifugation at 4°C and 5000g. 400g of bacterial cells were resuspended in 2L of a resuspension solution of 20mM PB + 1.5M NaCl + 5mM imidazole + 2mM PMSF (pH=7.5), and then homogenized (800~1500 bar). The lysate was centrifuged at 4°C and 10000g, and the supernatant was collected for SDS-Page electrophoresis to identify the expression of recombinant botulinum neurotoxin protein, such as... Figures 10-12 Lane S is shown.
[0174] (2) Membrane-encapsulated ultrafiltration
[0175] The supernatant after centrifugation of the bacterial culture was filtered through a 0.45 μm filter membrane for sterilization. The clarified solution was then subjected to ultrafiltration using a 50 kDa membrane: the pump speed was adjusted to 200-400 rpm to begin ultrafiltration; the buffer solution was replaced with 20 mM PB + 1.5 M NaCl (pH=7.0) buffer, the permeate valve was closed, and the reflux valve was opened simultaneously. The sample was collected, and the ultrafiltration system was washed with replacement buffer at least once the minimum circulation volume of the system. The washed samples were then combined and collected. Figures 10-12 As shown in lane E1.
[0176] (3) Hydrophobic Chromatography
[0177] The ultrafiltration concentrate was subjected to hydrophobic chromatography using Capto phenyl (HS) or Capto Butyl Impres packing material. The equilibration buffer used for hydrophobic chromatography was 20 mM PB + 1.5 M NaCl (pH=7.0). The column was washed with hydrophobic chromatography equilibration buffer for at least 2 CV until the baseline stabilized, and the UV was zeroed. The membrane-bound ultrafiltration harvest was then loaded with the sample. After loading, the hydrophobic groups of the target protein bind to the hydrophobic ligands of the chromatography medium. The column was washed with hydrophobic chromatography equilibration buffer for at least 5 CV. A step-by-step elution program was used with 20 mM PB (pH=7.0) as the elution buffer. During elution, collection began when the A280 absorbance reached 10 mAU, and ended when the peak value decreased to 10 mAU. Figures 10-12 Lane E2 is shown.
[0178] (4) Ion exchange
[0179] Hydrophobic chromatography was performed using Capto Q impres column material for anion exchange chromatography. The equilibration buffer was 50 mM Tris-HCl (pH=8.5). The column was eluted for at least 2 CV until the baseline stabilized. After loading the sample, the target protein in the sample bound to the stationary phase. The column was then washed with the ion exchange equilibration buffer for 3-5 CV until the baseline stabilized. A gradient elution mode of 0-100%B was set using 50 mM Tris-HCl + 1 M NaCl (pH=8.5) as the elution buffer. During gradient elution, collection began when the A280 absorbance reached 10 mAU / mm and ended when the absorbance dropped to 50 mAU / mm after peak formation. Figures 10-12 As shown in lane E3.
[0180] 3. Recombinant botulinum toxin protease cleavage activation
[0181] The non-neurotoxic, approximately 150 kDa botulinum toxin precursor protein, purified using methods 1 and 2, was subjected to protease digestion. First, enterokinase (EK) digestion was performed to cleave the single-chain precursor protein into two polypeptide chains linked by disulfide bonds (the double-chain form is the active form of botulinum toxin). This enzyme was also used to cleave the N-terminal His tag of the target protein, determining the optimal enzyme concentration. After determining the optimal EK enzyme concentration, the botulinum toxin precursor protein underwent large-scale digestion. After digestion, a single 150 kDa protein was visible on the SDS non-reducing gel image. Two protein bands were visible on the SDS reducing gel image: a 50 kDa light chain (LC) and a 100 kDa heavy chain (HC). This demonstrates that the botulinum toxin precursor protein has been cleaved by EK enzyme, forming a botulinum toxin protein composed of a disulfide-linked light and heavy chain. Recombinant botulinum neurotoxin was activated by protease digestion, see [link to relevant documentation]. Figures 7-12 Lanes N and D are shown.
[0182] 4. SDS-Page and HPLC analysis
[0183] Recombinant botulinum neurotoxin protein M00 was purified by membrane ultrafiltration, hydrophobic chromatography, anion exchange, and non-specific enzyme digestion (trypsin digestion) to obtain a double-stranded botulinum toxin protein composed of disulfide-linked light and heavy chains. M16, M19, and M64 were purified by affinity chromatography / membrane ultrafiltration, hydrophobic chromatography, anion exchange, and specific enzyme digestion (enterokinase digestion) to obtain a double-stranded botulinum toxin protein composed of disulfide-linked light and heavy chains. The advantages and disadvantages of the two purification and enzymatic activation methods for preparing high-purity botulinum toxin protein were then analyzed by SDS-Page and HPLC. The results showed that the protein after digestion was mainly at 100 kDa and 50 kDa, indicating that the protease cleaved the target protein, and that specific protease digestion was superior for preparing high-purity botulinum toxin protein. SDS-Page analysis is shown below. Figures 6-12 HPLC detection is shown in the figure. Figures 13-19 .
[0184] according to Figures 13-19 It can be further confirmed that, in terms of preparing high-purity botulinum toxin protein, the two purification and specific enzymatic digestion activation methods in Example 4 are superior to the purification and non-specific enzymatic digestion activation methods in Example 3, and there is no significant difference in the purity of botulinum toxin protein prepared by the two different purification methods.
[0185] 5. Production Analysis
[0186] Recombinant botulinum neurotoxin protein M00 was prepared by membrane ultrafiltration, hydrophobic chromatography, anion exchange, and non-specific enzyme digestion (trypsin digestion) to obtain high-purity double-stranded botulinum toxin protein composed of disulfide-linked light and heavy chains. M16, M19, and M64 were prepared by affinity chromatography / membrane ultrafiltration, hydrophobic chromatography, anion exchange, and specific enzyme digestion (enterokinase digestion) to obtain high-purity double-stranded botulinum toxin proteins composed of disulfide-linked light and heavy chains. Protein concentration was determined by HPLC and BCA method, showing that the disulfide-linked double-stranded botulinum toxin proteins prepared from M16, M19, and M64 were superior to those prepared from M00. Specific analytical results are shown in Table 2 below.
[0187] Table 2: Statistical Analysis of Neurotoxin Protein Yields from Recombinant Botulinum Toxin
[0188]
[0189] Note: M00 indicates the expression engineered bacteria or its expressed protein without protein tags and specific restriction sites; protein yield unit mg / g is the total protein yield measured per 1g of recombinant botulinum toxin cells after purification and activation; μg / g is the botulinum toxin protein yield measured per 1g of recombinant botulinum toxin cells after purification and activation.
[0190] This invention uses GraphPad Prism for significant difference analysis, where ns is P>0.05, * is P<0.05, ** is P<0.005, *** is P<0.0005, and **** is P<0.0001. Significant difference analyses were performed on the botulinum toxin protein yield of M00 as a control and on M16-1, M16-2, M19-1, M19-2, M64-1, and M64-2, and further significant difference analyses were performed between M16-1 and M16-2, M19-1 and M19-2, and M64-1 and M64-2. The results are shown below. Figure 20 .
[0191] Experimental result discrimination: based on Figures 6-20 As shown in Table 2, the protein purity and yield of the different recombinant botulinum neurotoxin protein expression strains (M01~M64) constructed in this invention are superior to those of the final product obtained from the original expression strain (M00). By replacing the traditional affinity chromatography in Example 2.1 with the membrane ultrafiltration technology in Example 4.2, the protein purity and yield of the final product obtained from the different recombinant botulinum neurotoxin protein expression strains (M01~M64) are comparable to those of the original expression strain (M00), and the production cost can be significantly reduced and the potential risk of chromatographic media contamination can be reduced.
[0192] according to Figures 5-12 It can be preliminarily seen that, in terms of preparing high-purity botulinum toxin protein, the two purification and specific enzymatic digestion activation methods in Example 4 are not significantly different from the purification and non-specific enzymatic digestion activation methods in Example 3.
[0193] according to Figures 13-20 It can be further confirmed that, in terms of preparing high-purity botulinum toxin protein, the two purification and specific enzymatic digestion activation methods in Example 4 are superior to the purification and non-specific enzymatic digestion activation methods in Example 3, and there is no significant difference in the purity of botulinum toxin protein prepared by the two different purification methods in Example 4.
[0194] 6. Circular dichroism analysis
[0195] After soaking the cuvettes in 2M HNO3 overnight and rinsing them with deionized water, they were dried and then scanned with background and blank buffer solutions in sequence. Then, an appropriate amount of the test sample was added to the cuvettes for near-ultraviolet (250-340nm) and far-ultraviolet (190-260nm) scanning.
[0196] The scanned spectra were processed using Pro-Data Viewer software with average and smoothing effects, and the smoothing times were set to 3. The ratio of peak to trough CD values of the standard sample was calculated, and the effective ratio range was 2.08 ± 0.06. Secondary structure prediction of the spectra was performed using CDNN software.
[0197] The secondary structures of the test samples M00 and M19 were fitted and calculated using CDNN software, including helix, β-pleated sheet (including antiparallel and parallel), β-turn, and random coil. The statistical results of the secondary structure analysis of M00 and M19 are shown in Table 3.
[0198] Table 3: Statistical Table of Secondary Structure Prediction for M00 and M19
[0199]
[0200] Experimental results: The secondary structures of M00 and M19 botulinum toxin proteins were analyzed by circular dichroism spectroscopy. According to the results in Table 3, the M19 botulinum toxin protein with protein tags and specific enzyme cleavage sites was basically consistent with the structure of M00 after enzyme cleavage and activation.
[0201] Example 5: Study on the toxicity of recombinant botulinum neurotoxin protein in mice.
[0202] 1. Experimental preparation:
[0203] Experimental animals: Kunming rats (weighing 22g), 6 rats in each experimental group, all of which were female; Test samples: Recombinant botulinum neurotoxin proteins (M00, M16-1, M16-2, M19-1, M19-2, M64-1 and M64-2: 1ug / mL) after enzyme switching solution were diluted 10-fold with commercial physiological saline to a total of 6 concentrations: 10ng / mL, 1ng / mL, 100pg / mL, 10pg / mL, 1pg / mL and 0.1pg / mL.
[0204] 2. Experimental Procedure:
[0205] Mice were injected intraperitoneally with 0.1 mL of double-stranded botulinum neurotoxin prepared in Example 3 and M16-1, M16-1, M16-2, M19-1, M19-2, M64-1 and M64-2 prepared in Example 4, which were serially diluted 10 times.
[0206] Mice were observed for 96 hours after inoculation. The mental status of mice in each group was recorded, the mortality rate was calculated, and the median lethal dose (LD50) was calculated using the Reed-Muench method.
[0207] 3. Test Results:
[0208] In the experimental group mice, the clinical neurological symptoms (such as scratching the head and back, abdominal collapse, etc.) and time of death after inoculation were correlated with the dose of recombinant botulinum neurotoxin protein. The higher the dose, the faster the neurological symptoms and death time, showing a dose-dependent relationship. The clinical observation results of the mouse toxicity test of recombinant botulinum neurotoxin protein are shown in Table 4.
[0209] Table 4: Clinical observation results of the mouse toxicity test of recombinant botulinum neurotoxin protein
[0210]
[0211] Experimental Results: According to the mouse toxicity test results, the median lethal dose (LD50) of recombinant botulinum neurotoxin protein M00 was 10.0 pg / mouse, the LD50 of M16-1 was 7.4 pg / mouse, the LD50 of M16-2 was 7.4 pg / mouse, the LD50 of M19-1 was 4.6 pg / mouse, the LD50 of M19-2 was 6.5 pg / mouse, the LD50 of M64-1 was 6.5 pg / mouse, and the LD50 of M64-2 was 4.5 pg / mouse. The mouse toxicity test showed that the botulinum toxins prepared by the different recombinant botulinum neurotoxin protein expression systems M01~M64 constructed in this invention using the two purification methods in Example 4 were all superior to the botulinum toxin prepared by M00 in Example 3, and there was no significant difference in the toxicity of the botulinum toxins prepared by the two purification methods from M01 to M64. The median lethal dose (LD50) represents the minimum number of bacteria or toxins required to cause the death of half of a certain number of animals of a specific weight or age within a specified time period through a designated route of infection. In toxicology, the LD50 is a commonly used indicator to describe the toxicity of toxic substances or radiation. This project determined that a single-chain recombinant botulinum neurotoxin protein fused to a recombinant strain, constructed by adding a protein tag, restriction enzyme sites, and partially or completely deleting 1-15 amino acids from the C-terminus of LC and / or 1-3 amino acids from the N-terminus of HC, after purification and enzymatic activation, yielded a double-chain recombinant botulinum neurotoxin protein consisting of a light chain and a heavy chain linked by a disulfide bond, which exhibits neurotoxicity.
[0212] Example 6: Study on the neurotoxicity of recombinant botulinum neurotoxin protein in rats
[0213] 1. Experimental preparation:
[0214] Experimental animals: Myrat rats (weight 220g), 4 rats in each experimental group, all of which were female; Test sample: Recombinant botulinum neurotoxin protein (1ug / mL) after enzyme switching solution. The LD50 of each group of botulinum toxin protein was taken as 1U and diluted with commercial physiological saline. Three concentrations were obtained, corresponding to 4U, 12U and 16U respectively. The LD50 of botulinum toxin protein in each group is shown in Table 5.
[0215] Table 5: LD50 of recombinant botulinum neurotoxin protein in each group
[0216]
[0217] 2. Experimental Procedure:
[0218] The experimental group of mice were injected with double-stranded botulinum neurotoxin prepared in Examples 3 and 4 into the gastrocnemius muscle of the left leg.
[0219] Mice were observed for 15 days after inoculation. The hind toe eversion status of each group of mice after inoculation was recorded.
[0220] 3. Test Results:
[0221] In the experimental group mice, the clinical neurological symptoms of hind toe abduction and the time to death were both correlated with the dose of recombinant botulinum neurotoxin protein. The higher the dose, the more pronounced the hind toe abduction (the higher the degree of muscle denervation), showing a dose-dependent relationship. The clinical neurotoxicity observation results of the recombinant botulinum neurotoxin protein mouse neurotoxicity test are shown in Table 6.
[0222] Table 6: Clinical neurotoxicity (hind toe abduction) observation results of recombinant botulinum neurotoxin protein mouse neurotoxicity test
[0223]
[0224] Note: Hind toe abduction is scored as high as 4 and low as 0. The values in the table are the average scores for hind toe abduction in each group of animals.
[0225] Clinical neurotoxicity (hind toe abduction) observation results from mouse neurotoxicity tests show that the botulinum toxins prepared by the different recombinant botulinum neurotoxin protein expression systems M01~M64 constructed in this invention through two purification methods are all superior to the botulinum toxins prepared by M00, and there is no significant difference in the toxicity of botulinum toxins prepared by the two purification methods from M01~M64.
[0226] The Digit Abduction Score (DAS) is used to test the degree of muscle denervation and is an important indicator of the effectiveness of botulinum toxin. This project determined that the single-chain recombinant botulinum neurotoxin protein expressed in *E. coli*, after purification and enzymatic digestion, yielded a double-chain recombinant botulinum neurotoxin protein composed of a light chain and a heavy chain linked by a disulfide bond. This double-chain protein possesses extremely strong biological activity and can be further used for the production of recombinant botulinum neurotoxin.
[0227] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.
[0228] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.
Claims
1. A rBoNT recombinant protein precursor, characterized in that, It consists of a first polypeptide fragment, a second polypeptide fragment, and a third polypeptide fragment connected in sequence from the N-terminus to the C-terminus; The amino acid sequence of the first polypeptide fragment is shown in SEQ ID NO: 10; The second polypeptide fragment consists of a light chain functional region and a second enzyme cleavage site structural region from the N-terminus to the C-terminus. The amino acid sequence of the light chain functional region is shown in SEQ ID NO: 4; The amino acid sequence of the second restriction site structural region is shown in SEQ ID NO: 12; The third polypeptide fragment is a heavy chain protein; the heavy chain protein consists of a heavy chain variable structure region and a heavy chain functional region from the N-terminus to the C-terminus. The amino acid sequence of the heavy chain variable structure region is ALN or absent; The amino acid sequence of the heavy chain functional region is shown in SEQ ID NO:
6.
2. Nucleic acid, characterized in that It encodes the rBoNT recombinant protein precursor of claim 1.
3. The nucleic acid of claim 2, wherein, In the nucleic acid, the sequences of the nucleic acids encoding the first polypeptide fragment, the light chain functional region, the second enzyme cleavage site structural region, and the heavy chain functional region are shown in SEQ ID NO: 9, 1, 11, 3, and the nucleic acid sequence encoding the heavy chain variable structure region is gccctgaac.
4. Biomaterials characterized in that, Including any of the following: (1) An expression box, comprising the nucleic acid as described in claim 2 or 3; (2) The recombinant vector, including the expression frame described in (1); (3) A recombinant host whose genome is integrated with the nucleic acid of claim 2 or 3 or the expression cassette of (1), or contains the recombinant vector of (2).
5. A rBoNT recombinant protein characterized in that, The recombinant rBoNT protein precursor of claim 1 is obtained by enzymatic digestion; the enzyme used for digestion is enterokinase, and the amino acid sequence of the cleavage site of the enterokinase is shown in SEQ ID NO:
12.
6. The method of claim 5, wherein the rBoNT recombinant protein is prepared by, The rBoNT recombinant protein precursor described in claim 1 is digested and activated to obtain the rBoNT recombinant protein; The enzyme used for the digestion is enterokinase; the amino acid sequence of the cleavage site of the enterokinase is shown in SEQ ID NO:
12.
7. The preparation method according to claim 6, characterized in that, The method for preparing the rBoNT recombinant protein precursor includes: transferring a recombinant vector containing the nucleic acid described in claim 2 into a host, inducing expression, and purifying to obtain the rBoNT recombinant protein precursor.
8. The preparation method according to claim 7, characterized in that, The purification process includes a first purification, a second purification, and a third purification in sequence; the first purification is affinity chromatography or membrane ultrafiltration; the second purification is hydrophobic chromatography; and the third purification is ion exchange chromatography.
9. The preparation method according to claim 8, characterized in that, The affinity chromatography includes: after the affinity chromatography packing material is equilibrated, loading the primary purified sample, washing the chromatography column with equilibration buffer until the baseline absorbance is stable, eluting with elution buffer, and collecting and combining the eluent containing the target recombinant protein. The membrane ultrafiltration process includes: filtering a primary purified sample through a filter equipped with a tangential flow membrane, collecting the filtrate, and obtaining an ultrafiltered sample containing the target protein. The hydrophobic chromatography includes: after the hydrophobic chromatography packing column is equilibrated, loading the harvested sample containing the target protein obtained by affinity chromatography or membrane ultrafiltration, washing the chromatography column with equilibration buffer until the baseline absorbance is stable, eluting with elution buffer, and collecting and combining the eluent containing the target recombinant protein. The ion exchange chromatography includes: after the anion exchange chromatography column is equilibrated, loading the harvested sample containing the target protein obtained by hydrophobic chromatography, washing the chromatography column with equilibration buffer until the baseline absorbance is stable, eluting with elution buffer, and collecting and combining the eluent containing the target recombinant protein. The replacement solution used in the membrane ultrafiltration is a 20mM PB buffer containing 1.5M NaCl, pH=6.5~7.5; And / or, in the affinity chromatography, the equilibration buffer is a 20mM PB buffer containing 1.5M NaCl and 5mM imidazole, pH=7.0~8.0; the elution buffer is a 20mM PB buffer containing 1.5M NaCl and 500mM imidazole, pH=7.0~8.0; And / or, in the hydrophobic chromatography, the equilibration buffer is a 20mM PB buffer containing 1.5M NaCl, pH 6.5~7.5; the elution buffer is 20mM PB, pH 6.5~7.5; And / or, in the ion exchange chromatography, the equilibration buffer is 50 mM Tris-HCl, pH 7.5~8.5, and the eluent is 50 mM Tris-HCl buffer containing 1 M NaCl, pH 7.5~8.5; And / or, the membrane covering the tangential flow membrane is a cellulose membrane or a polyethersulfone membrane; And / or, the affinity chromatography packing material is Ni Sepharos Excel; And / or, the packing material for the hydrophobic chromatography is Capto phenyl or Capto Butyl Impres; And / or, the packing material for the ion exchange chromatography is Capto Q impres.
10. The application of the rBoNT recombinant protein according to claim 5 in the preparation of medical aesthetic products; The medical aesthetic product mentioned is a wrinkle removal product.
11. A medical aesthetic product, characterized in that, This includes the rBoNT recombinant protein as described in claim 5 and excipients acceptable for use in medical aesthetic products.