Synthesis and Application of a Non-natural Nucleic Acid Fluorescent Probe Targeting Small Molecule Toxins

Abstract

This invention discloses the synthesis and application of a non-natural nucleic acid fluorescent probe targeting small molecule toxins, belonging to the field of molecular detection technology. The non-natural nucleic acid fluorescent probe of this invention uses threonose ribose as the ribose content, and the nucleic acid is modified with fluorescent and quenching groups. The quenching groups bind to the nucleic acid through π-π stacking and hydrogen bonding. This invention is the first to apply a threonose nucleic acid aptamer targeting the small molecule toxin ochratoxin A to cell imaging and in vivo animal imaging. Utilizing the targeting ability of the aptamer and the biostability of threonose nucleic acid, targeted tracking of OTA was achieved. Unexpectedly, OTA was found to accumulate not only in the kidneys and liver but also in the knee joint. Furthermore, after the aptamer binds to OTA, the OTA content in mouse serum is significantly reduced, providing an important tool for understanding the toxic mechanism of OTA and potentially offering new strategies for blocking or mitigating the toxic effects of OTA.

Description

Technical Field

[0001] This invention relates to the synthesis and application of a non-natural nucleic acid fluorescent probe targeting small molecule toxins, belonging to the field of molecular detection technology. Background Technology

[0002] Ochratoxin A (OTA) is a naturally occurring small-molecule fungal toxin that widely contaminates agricultural products such as grains, coffee, and wine, posing a serious threat to human and animal health. Studies have shown that OTA has clear carcinogenic, teratogenic, mutagenic, and hepatotoxic properties, and it has been classified as a Group 2B potential carcinogen by the International Agency for Research on Cancer (IARC) of the World Health Organization. Notably, an increasing number of epidemiological surveys have detected OTA in the blood and urine samples of pregnant women, highlighting the widespread nature of its exposure. A key characteristic of OTA's toxicological behavior after entering the body is its strong, reversible binding to plasma albumin (binding rate as high as 99.8%). This binding forms a "dynamic reservoir," significantly delaying OTA metabolism and renal clearance, resulting in an abnormally prolonged half-life in the body, thus amplifying its chronic toxicity risk. Traditionally, research has suggested that OTA mainly accumulates in metabolic organs such as the liver and kidneys; however, due to limitations in in vivo detection and tracking technologies, our understanding of the distribution and accumulation of OTA in other tissues and organs remains incomplete.

[0003] Aptamers are a class of functional oligonucleotide molecules obtained through in vitro screening technology (SELEX). They can bind to targets with high affinity and specificity and are known as "chemical antibodies." In recent years, aptamers have shown great potential in the fields of biosensing and imaging. However, aptamers, composed of natural RNA or DNA, are easily degraded by nucleases in complex biological environments, exhibiting poor stability and short lifespan. This severely limits their application in achieving long-term, high-fidelity imaging at the in vivo level.

[0004] To overcome this technical bottleneck, this study turned to a type of non-natural nucleic acid with stable structure and strong resistance to enzymatic degradation—threose nucleic acid (TNA). Due to its different glycophosphate backbone structure from natural nucleic acids, TNA can effectively evade recognition and cleavage by nucleases in vivo, and is hailed as an ideal material for constructing stable functional molecules. Although TNA theoretically possesses the potential to resist enzymatic degradation, it remains to be seen whether it can efficiently track OTA imaging for extended periods in real biological environments (such as blood and tissue fluid rich in nucleases) after being injected into live mice.

[0005] To this end, this study constructed a fluorescent TNA aptamer probe targeting OTA, aiming to achieve two core objectives: first, to leverage its excellent stability to develop highly sensitive biosensing and imaging tools; second, to utilize the probe's long cycle life and targeting capability in vivo to reveal the real distribution, transport, and metabolic patterns of OTA in intact living organisms in real time and dynamically, in order to uncover potential toxicological information previously obscured by technology. It was along this research path that we unexpectedly discovered a significant accumulation of OTA at the knee joint in organisms. This discovery not only expands our traditional understanding of the distribution and toxicity mechanisms of OTA in vivo but also provides new scientific evidence for assessing its systemic health risks and developing novel detoxification strategies. Summary of the Invention

[0006] To address the shortcomings of the existing technologies, this invention provides the synthesis and application of a non-natural nucleic acid fluorescent probe targeting small molecule toxins, aiming to solve the technical problem that natural aptamers are susceptible to degradation by nucleases, resulting in their limited lifespan in biological culture media or samples.

[0007] The first technical solution provided by this invention is a non-natural nucleic acid fluorescent probe, wherein the ribose of the non-natural nucleic acid is composed of threose, and the non-natural nucleic acid is modified with fluorescent groups and / or quenching groups. The quenching groups can also bind to the nucleic acid through π-π stacking and hydrogen bonding.

[0008] In some embodiments, the 5' or 3' end of the nucleic acid is modified with a fluorescent group or a quenching group.

[0009] Furthermore, the fluorescent groups include FAM, CY3, CY5, TAMRA, and ROX, and the quenching groups include GO, TAMRA, BHQ, Dabcyl, and IBFQ.

[0010] In some embodiments, the base sequence of the non-natural nucleic acid fluorescent probe is as shown in SEQ ID NO.2 or SEQ ID NO.3.

[0011] The second technical solution provided by this invention is a method for preparing the above-mentioned non-natural nucleic acid probe, comprising the following steps: (1) Prepare a reaction system for threonine extension and carry out threonine extension. The reaction system includes threonine primers with fluorescent groups or quenching groups, DNA templates with nucleotide sequences as shown in SEQ ID NO.4, and threonine triphosphates; (2) Threonine nucleic acid was recovered by gel cutting via denaturing polyacrylamide gel electrophoresis; (3) The recovered threonine nucleic acid solution was freeze-dried and stored at -20℃ for later use; (4) Dissolve the ribose-modified threonine nucleic acid to obtain a nucleic acid solution with modified ribose groups; (5) Incubate the nucleic acid solution in the dark at a gradient temperature to allow it to form a spatial structure; (6) Add the nucleic acid solution to the quencher solution and continue incubation in the dark to obtain the non-natural nucleic acid fluorescent probe.

[0012] In some embodiments, the specific operation method for extending the threononucleotide is as follows: S1, using the obtained DNA template and threonine primers, mixed with water and reaction buffer, then annealed at 90°C to 4°C and placed on ice; S2, add Mn 2+ Ions and Kod-RI (5VU5) DNA polymerase; S3, add threonucleotide triphosphate, and perform primer extension reaction at 55℃, i.e., threonucleotide transcription.

[0013] In some embodiments, the quencher is graphene oxide, and the molar ratio of the quencher to the fluorescently labeled threonine nucleic acid is 380-400:1.

[0014] In some embodiments, the nucleic acid solution is incubated at a gradient temperature in the dark at 90°C for 10 min, followed by rapid cooling to 4°C; the incubation conditions after adding the quencher are incubated at 37°C at 220 rpm for 30 min.

[0015] In some embodiments, the non-natural nucleic acid fluorescent probes with a length of less than 35 nt are obtained by solid-phase synthesis, while those with a length of more than 35 nt are synthesized by polymerase chain synthesis and purified by gel electrophoresis-gel recovery to obtain the final threonine nucleic acid chain.

[0016] The third technical solution provided by the present invention is a biosensor containing the non-natural nucleic acid fluorescent probe described in the first technical solution.

[0017] The fourth technical solution provided by the present invention is a cell containing the non-natural nucleic acid fluorescent probe described in the first technical solution.

[0018] In some embodiments, the cell may be an animal cell, a plant cell, or a microbial cell.

[0019] The fifth technical solution provided by the present invention is a method for detecting ochratoxin A. The method involves interacting the probe described in the first technical solution with the sample to be tested, and detecting ochratoxin A by detecting the signal of the reporter group.

[0020] The sixth technical solution provided by this invention is the application of the non-natural nucleic acid fluorescent probe described in the first technical solution, the biosensor described in the third technical solution, or the cell described in the fourth technical solution in the preparation and detection of ochratoxin A products.

[0021] In some implementations, the product includes a reagent kit.

[0022] The seventh technical solution provided by this invention is the application of the non-natural nucleic acid fluorescent probe described in the first technical solution in the fields of molecular diagnosis and / or disease diagnosis and treatment.

[0023] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention is the first to apply a threonine aptamer targeting the small molecule toxin ochratoxin A (OTA) to cell imaging and in vivo animal imaging. Utilizing the aptamer's targeting ability and the biostability of threonine, targeted tracking of OTA is achieved, providing an important tool for understanding the toxic mechanisms of OTA and potentially offering new strategies for blocking or mitigating the toxic effects of OTA. Specific advantages are as follows: (1) This invention is the first to apply threonine nucleic acid (TNA) aptamers targeting OTA to in vivo imaging in living animals, breaking through the bottleneck of traditional detection methods being limited to in vitro, and providing an irreplaceable tool for visually studying the distribution, metabolism and accumulation behavior of OTA in real physiological environment; (2) The innovative use of non-natural threonine nucleic acid backbone solves the problem that natural nucleic acid aptamers are easily degraded, allowing them to maintain structural integrity and functional activity in complex biological environments, thus ensuring the reliability and accuracy of imaging results. (3) This technology can not only accurately reveal the dynamic trend and toxic mechanism of OTA in vivo, but also is expected to develop new active intervention strategies that can block the binding of toxins to biomolecules or promote their clearance, thereby fundamentally reducing the harm of OTA to the body. Attached Figure Description

[0024] Figure 1 Construction of pET21-kod-RI(5VU5) plasmid.

[0025] Figure 2 Expression of kod-RI(5VU5) polymerase: A is the principle of kod-RI(5VU5) polymerase expression; B is the verification of kod-RI(5VU5) polymerase expression.

[0026] Figure 3 A shows the mass spectra of DNA and TNA nucleic acids; A is the chromatogram; B is the mass spectrum.

[0027] Figure 4To investigate the stability of DNA and TNA nucleic acids; A and B are schematic diagrams of the molecular structure and biological stability of TNA and DNA, respectively; C and D are the stability of TNA and DNA under 2U DNase I conditions, respectively; E is the stability of TNA under 50% fetal bovine serum conditions; F is the stability of DNA under 10% fetal bovine serum conditions; G and H are the stability of TNA and DNA under 50% acetonitrile conditions, respectively.

[0028] Figure 5 This is a biosensor based on TNA nucleic acid probes.

[0029] Figure 6 For A498 high-content imaging.

[0030] Figure 7 Confocal imaging for HepG2 (A) and A498 (B).

[0031] Figure 8 This is a fluorescence image of a supine in vivo imaging patient.

[0032] Figure 9 Quantitative fluorescence images of the abdomen (A) and knee joint (B).

[0033] Figure 10 This is a fluorescence image of an organ.

[0034] Figure 11 The images show quantitative fluorescence imaging of the kidney (A), liver (B), and knee joint (C) and the serum OTA content (D). Detailed Implementation

[0035] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0036] Raw materials used in the examples: 1. HepG2 and A498 were purchased from Wuhan Pronosei Life Sciences Co., Ltd. (Wuhan, China); Hoechst 33342 staining solution was purchased from Sangon Biotech Co., Ltd. (Shanghai, China); MEM basal culture medium was purchased from Yizefeng Biotechnology Co., Ltd. (Shanghai, China); 6-8 week old BALB / c nu female nude mice were purchased from Spiford (Beijing) Biotechnology Co., Ltd. (Beijing, China); SDS-PAGE protein electrophoresis kit was purchased from Shanghai Yamei Biomedical Technology Co., Ltd. (Shanghai, China); graphene oxide (GO) was purchased from Jiangsu Xianfeng Nanomaterials Technology Co., Ltd. (Nanjing, China). TNA nucleic acids below 30 nt were obtained by solid-phase synthesis, and tNTPs were purchased from Suzhou Beixin Biomedical Technology Co., Ltd. (Suzhou, China).

[0037] 2. DNA aptamer: GGCAGTGTGGGCGAATCTATGCGTACCGTTCGATATCGTG (SEQ ID NO.1).

[0038] 3. TNA aptamer: AATAGGGTAAAAAAAAAAAGTTGGTCCTATG (SEQ ID NO.2).

[0039] 4. TNA aptamers: GCCGAGATTGCACTTACTATCTCAATAGGGTAAAAAAAAAGTTGGTCCTATGGGTGGGTTGTTCAGTAATTGAATAAGCTGGTATGCGC (SEQ ID NO. 3).

[0040] 5. TNA synthesis template: GCGCATACCA GCTTATTCAA TTACTGAACA ACCCACCCAT AGGACCAACTTTTTTTTTTT ACCCTATTG AGATAGTAAG TGCAATCTCG GC (SEQ ID NO. 4).

[0041] 6. TNA synthesis primer: FAM-GCCGAGATTGCACTTACTATCT (SEQ ID NO.5).

[0042] Example 1: Expression of non-natural nucleic acid polymerase and preparation of threonine. Using the PDB database and NCBI website to mine existing XNA polymerase genes, this example uses the TNA polymerase Kod-RI (5VU5) with pET21a(+) as the vector, as follows: Figure 1 The synthesized plasmid pET21-kod-RI(5VU5) (nucleotide sequence shown in SEQ ID NO.6) was purified using a 6×His tag and transformed into the expression host E. coli BL21(DE3) for expression. The expression principle is as follows: Figure 2A. Specifically: Take out 100 μL (1 tube) of E. coli BL21(DE3) competent cells frozen at -80℃, incubate on ice for 5 min to warm up, add 5 μL of plasmid with a concentration greater than 100 ng / μL (117 ng / μL), pipette a few times, and let stand on ice for 30 min; (2) heat shock in a water bath at 42℃ for 90 s to allow the plasmid to enter E. coli, take it out and immediately incubate on ice for 2-3 min (to close the channels on the cell membrane); (3) add 600 μL of liquid LB medium to the above solution, and culture at 37℃ and 150 rpm for 45 min; (4) take 100 μL of bacterial solution and spread it evenly on the cooled ampicillin LB agar medium, and incubate upside down at 37℃ for 12-16 h.

[0043] Pick a single colony and inoculate it into a 50 mL sterile centrifuge tube containing 5 mL of Amp-resistant LB medium. Incubate at 37°C and 220 rpm for 12–16 h to obtain the seed culture. Take 1 mL of the seed culture and add it to a 500 mL shake flask containing 100 mL of Amp-resistant LB liquid medium. Incubate at 37°C and 220 rpm for 4 h, then add IPTG to a final concentration of 0.4 mM, and incubate at 37°C and 220 rpm for 12 h. After fermentation, collect the cells by incubating the fermentation broth at 4°C and 4000 g for 20 min. Wash the cell pellet twice with 0.1 times the volume of fermentation broth in PBS and resuspend the cells to an OD600 of 10. Perform cell disruption using a high-pressure cell disruptor (800 bar) until the system is clear and transparent (disruption), then centrifuge at 4°C and 12000 g for 20 min. Filter the supernatant through a 0.22 μm filter membrane for later use. Perform batch purification of AKTA GO protein, or perform preliminary purification using a gravity column. After ultrafiltration, the protein sample was added to a final concentration of 20% glycerol, flash-frozen in liquid nitrogen, and stored at -80°C.

[0044] The enhanced green fluorescent protein plasmid was used as a positive control, and BL21(DE3) without plasmid transformation was used as a negative control. Expression of the non-natural polymerase was verified using SDS-PAGE. Results are as follows: Figure 2 B. By comparison, it was found that the positive control and KOD-RI (5VU5) samples after IPTG induction showed target protein bands that were different from those before induction or the negative control, indicating that the protein expression was successful.

[0045] TNA transcription: First, mix TNA synthesis primers (2.0 μL 10 μM), TNA synthesis template (1 μL 1 μM), reaction buffer (5 μL), and water (38 μL), heat to 90℃ for 5 min, then anneal to 4℃ at 10℃ / min for 10 min, and then place on ice for 3 min. During annealing, pre-mix engineered polymerase KOD-RI (5VU5) (1 μL 0.77 mg / mL) and MnCl2 (2 μL 1 mM) and add to the reaction system. Initiate the reaction by adding threononucleotide triphosphate (tNTP, 1 μL 10 mM); incubate at 55℃ in the dark for 6 h.

[0046] The solution obtained from bulk TNA transcription was concentrated to 100 μL using n-butanol, followed by denaturing PAGE gel recovery. The recovered TNA was then concentrated using ultrafiltration centrifuge tubes and analyzed by electrospray ionization mass spectrometry (ESI). MS) determination, the determination method refers to GB / T 43629.1-2023 / ISO 20688-1:2020.

[0047] Compared to DNA mass spectra of the same length and sequence, although TNA is FAM-labeled while DNA is not, the molecular weight of DNA is still larger than that of TNA. Figure 3 A) This is because the ribose in TNA is a four-carbon sugar, while the ribose in DNA is a five-carbon sugar. (Mass spectrum) Figure 3 B) A large number of corresponding m / z bands can be found, and some bands show a trend of DNA being larger than TNA.

[0048] Example 2: Stability assessment and OTA biosensor based on non-natural nucleic acid fluorescent probes To gain a more intuitive understanding of the stability of TNA and DNA, an in vitro environmental tolerance study was conducted. Equal volumes of DNA or TNA aptamers were added to fetal bovine serum (FBS) or 50% acetonitrile or 2U DNase I, respectively, to a final concentration of 50% (TNA) or 10% (DNA). The volume was then brought to a final volume of 20 μL with sterile water. The mixture was gently mixed and briefly centrifuged. After incubation at 37°C for a certain period, 2 μL of 50mM EDTA was added, and the reaction was terminated by incubation at 65°C for 10 min. A suitable amount of the treated aptamers was then subjected to denaturing PAGE characterization. The results are as follows: Figure 4 TNA aptamers showed almost no degradation after treatment with DNase I, 50% fetal bovine serum, and 50% acetonitrile for 12 h. DNA aptamers showed no original bands after treatment with 2U DNase I for 1 min, and after treatment with 10% fetal bovine serum for 4 h, the original bands showed significant degradation and could no longer be clearly observed. After treatment with 50% acetonitrile for 12 h, the bands showed almost no degradation.

[0049] Sensor preparation: The aptamer was first pre-renatured (90℃ for 10 min, 4℃ for 10 min), then OTA toxin was added, and the mixture was incubated at 37℃ in the dark for 2 h. After incubation, GO (quencher) in proportion to the aptamer concentration was added, and the mixture was incubated in the dark for another 30 min. After centrifugation, the fluorescence values ​​of the supernatant were measured (Ex-485 nm, Em-520 nm). To better understand the detection performance of this sensor, the response of the sensor was investigated with OTA solutions of different concentrations (1, 10, 50, 500, 1000, 5000, 10000 nM).

[0050] The fluorescence ratio of this sensor gradually increases with increasing OTA concentration. The detection limit of the sensor constructed from the TNA aptamer is 2.26 nM = 0.91 ug / kg. Figure 5 ).

[0051] Example 3: In vivo tracking in cells and animals - comparative example To capture the process of probes gradually tracking OTA and to compare the effects of TNA and DNA probes in cell imaging, high-content imaging was performed using TNA (SEQ ID NO.2) and DNA probes, respectively. High-content imaging based on A498 and HepG2 cells: Different cell types (HepG2 and A498) were seeded in 96-well microplates (10,000 cells / well) and cultured at 37°C and 5% CO2 for 24 h. The culture medium was then changed for the next step (washed 1-3 times with 100 μL PBS, and cultured again). Afterward, the complete culture medium was aspirated, and OTA solution diluted with culture medium was added. After culturing for 1 h, OTA on the cell surface was washed away with PBS. A mixture of 1 μM OTA aptamer and 10 ug / ml GO was prepared in 200 μL per well and continuously recorded using the high-content imaging system.

[0052] Imaging results ( Figure 6 The results showed that the TNA probe exhibited intracellular fluorescence aggregation after 7.5 h, while the DNA probe did not show intracellular fluorescence aggregation. Based on the tolerance test results, it is speculated that the DNA probe degraded in the culture medium containing fetal bovine serum, resulting in the inability to track intracellular OTA.

[0053] To more intuitively and clearly examine the performance of TNA probes in cell imaging, confocal microscopy was performed using A498 and HepG2 cells. Confocal microscopy based on A498 and HepG2 cells: at 5 × 10⁻⁶ cells... 4Inoculate 500 μL of single-cell suspension at a density of / dish into a confocal dish and culture it at 37 °C under 5% CO2 for 24 h. After that, aspirate the complete medium, add the OTA solution diluted with the medium, and wash the OTA on the cell surface with PBS after 1 h of culture. Prepare a 1 μM OTA aptamer with the medium, and the total volume of the 10 ug / ml GO mixture is 500 μL. Culture it at 37 °C under 5% CO2 for 4 h. After the incubation, aspirate the medium, wash it 2-3 times with PBS solution, stain it with the nuclear dye Hoechst33342 for 15 min, then wash it 2-3 times with PBS solution, add 500 μL of complete medium and perform fluorescence imaging under a high-resolution laser confocal microscope. Confocal: First collect DAPI (excitation at 405 nm), and then collect FAM (excitation at 488 nm). Filter settings: Hoechst 33342: Emission filter bandwidth ~410 - 480 nm (emission detection range). FAM: Emission filter bandwidth ~500 - 550 nm (emission detection range). Take the pixel intensity of the laser confocal imaging map obtained from the blank control group as A0, and the pixel intensity of the laser confocal imaging map obtained when there is OTA stimulation as A. Use A / A0 to represent the relative pixel intensity corresponding to the confocal image.

[0054] The experimental results are as Figure 7 , as can be seen from the figure, as the concentration of OTA increases, the fluorescence intensity of the TNA probe in the cells gradually deepens. It can be seen that this TNA probe can achieve the detection and imaging of OTA in cells.

[0055] To verify whether the TNA probe is still effective in a complex biological system, here we investigated the effects of the TNA and DNA probes on tracking OTA imaging in mice based on mouse experiments. First, adapt the purchased mice for one week of feeding, then perform OTA gavage, and then inject the probe into the tail vein 1 h later. The details are as follows: BALB / c nu female nude mice at 6 - 8 weeks of age (Spebefu (Beijing) Biotechnology Co., Ltd., production license: SCXK (Beijing) 2024 - 0001). The inspection process was completed in a barrier system laboratory (air cleanliness ≤ 10,000 levels, air change rate 10 - 20 times / hour, temperature 20 - 26 °C, daily temperature difference ≤ 3 °C, relative humidity 40 - 70%), and a 12 h light and 12 h dark cycle was given. Adapt the animals for one week of feeding with sufficient mouse food and sufficient drinking water.

[0056] Mice were fasted overnight the day before the experiment and anesthetized by inhalation of 1% isoflurane. One hour before administration, each mouse was gavaged with 3 mg / kg of OTA toxin. The control group received 200 μL of physiological saline, the TNA group received 200 μL of a mixture of TNA probe and GO, and the DNA group received 200 μL of DNA probe and GO at the same concentration as TNA. The probes in the TNA and DNA groups underwent renaturation treatment: reacting at 90℃ for 5 min and 4℃ for 10 min, then mixed with GO, diluted with physiological saline to the specified concentration, and injected via tail vein. In vivo imaging and organ imaging results of the mice were observed at 15 min, 30 min, 1 h, 2 h, 3 h, 6 h, 9 h, 12 h, and 24 h after injection using a multi-modal animal in vivo imaging system (AniView 600, Guangzhou Boluteng Biotechnology Co., Ltd.). The excitation wavelength was 605 nm, and the emission wavelength was 680 nm.

[0057] Results of mouse supine in vivo imaging from 0 h to 24 h are as follows: Figure 8 Abdominal and knee joint fluorescence quantitative quantification, such as Figure 9 The anatomical organ imaging results after 24 hours are as follows: Figure 10 The results of organ imaging fluorescence quantitative quantification and serum OTA content are as follows: Figure 11 .

[0058] Depend on Figure 8 and Figure 9 As shown in Figure A, compared to the Control group, the abdominal fluorescence of mice in both the TNA and DNA probe groups peaked at 15 min, and then gradually decreased over time. After 6 h, the fluorescence in the DNA probe group gradually disappeared, while the TNA probe group still showed significant fluorescence, with a signal difference of 2-3 times. Furthermore, it is noteworthy that compared to the Control group, the fluorescence values ​​in the knee joints of mice in the TNA and DNA probe groups peaked at 30 min and 15 min, respectively, and then gradually decreased over time. Figure 9 B).

[0059] To more clearly observe the accumulation of OTA in mice, anatomical and organ imaging was performed on the mice 24 hours after imaging. The results are as follows: Figure 10 and 11 The diagram shows the kidneys ( Figure 11 The highest fluorescence intensity was observed in A), and in the liver ( Figure 11 Fragile fluorescence was observed in C), consistent with the previously reported primary accumulation site of OTA being the kidneys, followed by the liver. However, it is noteworthy that fluorescent signals were observed in the knee joint of both the TNA and DNA probe groups. Figure 11B), and the signal strength of the TNA probe group in the knee joint was approximately 7 times that in the liver tissue. Figure 11 C). This signal has not received attention in previous studies.

[0060] The TNA probe showed stronger in vivo stability than the DNA probe, as evidenced by the significantly higher fluorescence intensity at the abdomen and knees of the TNA probe group after 6 hours compared to the DNA probe group. This result was largely consistent with high-content imaging results. To verify whether this phenomenon was due to differences in OTA concentration, the OTA content in mouse serum was measured. Figure 11 D) It was found that the OTA levels in the serum of mice in both treatment groups were basically the same, but interestingly, both were lower than those in the control group. It is speculated that after the probe binds to OTA, it competitively inhibits the binding of OTA to albumin and accelerates the metabolism of OTA, which may help reduce the damage of the toxin to mice.

[0061] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A non-natural nucleic acid fluorescent probe, characterized in that, The non-natural nucleic acid has threose ribose and is modified with fluorescent groups and / or quenching groups. The base sequence of the non-natural nucleic acid fluorescent probe is shown in SEQ ID NO.2 or SEQ ID NO.

3.

2. The non-natural nucleic acid fluorescent probe according to claim 1, characterized in that, The nucleic acid is modified with a fluorescent group or a quenching group at its 5' or 3' end. The fluorescent group includes FAM, CY3, CY5, TAMRA, and ROX, and the quenching group includes GO, TAMRA, BHQ, Dabcyl, and IBFQ.

3. A method for preparing the above-mentioned non-natural nucleic acid probe, characterized in that, Includes the following steps: (1) Prepare a reaction system for threonine extension and carry out threonine extension. The reaction system includes threonine primers with fluorescent groups or quenching groups, DNA templates with nucleotide sequences as shown in SEQ ID NO.4, and threonine triphosphates; (2) Threonine nucleic acid was recovered by gel cutting via denaturing polyacrylamide gel electrophoresis; (3) The recovered threonine nucleic acid solution was freeze-dried and stored at -20℃ for later use; (4) Dissolve the ribose-modified threonine nucleic acid to obtain a nucleic acid solution with modified ribose groups; (5) Incubate the nucleic acid solution in the dark at a gradient temperature to allow it to form a spatial structure; (6) Add the nucleic acid solution to the quencher solution and continue incubation in the dark to obtain the non-natural nucleic acid fluorescent probe.

4. The method according to claim 3, characterized in that, The specific operation method for extending the threonine nucleic acid is as follows: S1, using the obtained DNA template and threonine primers, mixed with water and reaction buffer, then annealed at 90°C to 4°C and placed on ice; S2, add Mn 2+ Ions and Kod-RI (5VU5) DNA polymerase; S3, add threonucleotide triphosphate, and perform primer extension reaction at 55℃, i.e., threonucleotide transcription.

5. The method according to claim 3, characterized in that, The quencher is graphene oxide, and the molar ratio of the quencher to the fluorescently labeled threonine nucleic acid is 380~400:1; the nucleic acid solution is incubated at a gradient temperature in the dark at 90℃ for 10 min, followed by rapid cooling to 4℃; the incubation conditions after adding the quencher are incubated at 37℃ and 220 rpm for 30 min.

6. A biosensor, characterized in that, The biosensor contains the non-natural nucleic acid fluorescent probe as described in any one of claims 1 to 2.

7. A cell, characterized in that, The cell contains the non-natural nucleic acid fluorescent probe as described in any one of claims 1 to 2.

8. A method for detecting ochratoxin A, characterized in that, The method involves interacting the probe described in any one of claims 1 to 2 with the sample to be tested, and detecting ochratoxin A by detecting the signal of the reporter group.

9. The application of the non-natural nucleic acid fluorescent probe according to any one of claims 1-2, the biosensor according to claim 6, or the cell according to claim 7 in the preparation of a product for detecting ochratoxin A, characterized in that, The product includes a reagent kit.

10. The use of the non-natural nucleic acid fluorescent probe according to any one of claims 1 to 2 in the fields of molecular diagnostics and / or disease diagnosis and treatment.

Images