Pseudomonas sp. d-3-1 with biocontrol function and application thereof

Abstract

The application belongs to the technical field of microorganisms, and particularly relates to a Pseudomonas pseudoalcaligenes D-3-1 with a biocontrol function and an application thereof. Pseudoduganella The Pseudomonas pseudoalcaligenes (Pseudomonas sp.) D-3-1 has been sent to the China Center for Type Culture Collection on January 20, 2026, and the preservation number is CCTCC NO: M 2026163. The Pseudomonas pseudoalcaligenes D-3-1 provided in the application can produce an iron carrier, has antagonistic activity on various bacteria and fungi, has broad-spectrum bacteriostatic activity, can be developed into a microbial agent, provides a new material for biological control, and has high application value.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a strain of *Durga sieboldii* D-3-1 with biocontrol function and its application. Background Technology

[0002] Natural products, also known as secondary metabolites, are produced by plants or microorganisms and have broad application prospects in many fields such as medicine, agriculture, chemical industry, and food. Among them, natural products with antibacterial activity are often used as antibiotics in the pharmaceutical field, and microbial-derived natural products account for half of antibiotic research and development. However, the natural evolution of microorganisms and the overuse of antibiotics have accelerated the formation of drug resistance, making the discovery and development of new antibiotics an urgent matter.

[0003] Iron is essential for the survival and growth of microorganisms, as it is a necessary substance for the synthesis of cytochromes and related enzymes; however, most iron in nature exists in its oxidized form. To obtain iron, microorganisms secrete siderophores, which efficiently chelate ferric iron (Fe3+) to aid in their iron uptake. Furthermore, siderophores typically possess significant antibacterial and antifungal activities, playing a dual role in the survival and growth of microorganisms, and have become a hot topic in novel drug development. Summary of the Invention

[0004] In view of the shortcomings of the prior art, the purpose of this invention is to provide a strain of *Durga niger* D-3-1 with biocontrol function and its application.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a strain of *D. pseudoduranthus* D-3-1 with biocontrol function. Pseudoduganella sp.) D-3-1 was deposited at the China Center for Type Culture Collection on January 20, 2026, with accession number CCTCC NO: M 2026163.

[0006] A second aspect of the invention provides a derivative of *Durga niger* D-3-1, characterized in that it comprises one or more of its live bacteria, inactivated bacterial cells, fermentation broth, or metabolites.

[0007] A third aspect of the invention provides a microbial agent comprising an active ingredient, said active ingredient comprising *Durgatus pseudodulans* D-3-1 or a derivative thereof.

[0008] A fourth aspect of the present invention provides a method for preparing the above-mentioned bacterial agent, comprising the step of culturing *Durgatus* D-3-1.

[0009] A fifth aspect of the invention provides the use of *Durga sieboldii* D-3-1 or a derivative thereof, or the above-described inoculum, in any of the following: (1) Inhibiting bacteria or preparing products that inhibit bacteria; (2) Inhibiting fungi or preparing products that inhibit fungi; (3) To produce ferrocarriers or to prepare products for the production of ferrocarriers; (4) Production of violacein and deoxyviolacein; The bacteria include Staphylococcus aureus (Staphylococcus aureus) Staphylococcus aureus ), Escherichia coli ( Escherichia coli Bacillus subtilis ( Bacillus subtilis ) and Pseudomonas aeruginosa ( Pseudomonas aeruginosa The fungi include white rot pathogens ( ); White rot pathogen ) and wilt pathogen ( Fusarium solani ).

[0010] A sixth aspect of the present invention provides a method for inhibiting bacteria, comprising treating an application subject with a *D. pseudoduranthus* D-3-1 derivative; said bacteria including *Staphylococcus aureus* (… Staphylococcus aureus ), Escherichia coli ( Escherichia coli Bacillus subtilis ( Bacillus subtilis ) and Pseudomonas aeruginosa ( Pseudomonas aeruginosa The method described is not for therapeutic purposes.

[0011] A seventh aspect of the present invention provides a method for inhibiting fungi, comprising treating the target organism with *D. pseudoduranthus* D-3-1 or a derivative thereof or the aforementioned fungal agent; said fungi include white rot pathogens (… White rot pathogen ) and wilt pathogen ( Fusarium solani The method described is not for therapeutic purposes.

[0012] Compared with the prior art, the technical solution of the present invention has the following beneficial effects: The *D. 3-1* strain provided by this invention can produce siderophores and has antagonistic activity against a variety of bacteria and fungi. It has broad-spectrum antibacterial activity and can be developed into a microbial agent, providing a new material for biological control and having high application value. Attached Figure Description

[0013] Figure 1 The colony morphology and Gram staining results of *D. pseudoduranthus* D-3-1 are shown; where A represents colony morphology and B represents Gram staining results.

[0014] Figure 2 Phylogenetic tree of *D. doxorubicin* D-3-1.

[0015] Figure 3The inhibitory activity of *D. pseudoduranthus* D-3-1 cells against two fungi is shown; where A represents the inhibition result against white rot pathogen and B represents the inhibition result against wilt pathogen.

[0016] Figure 4 The study evaluated the inhibitory activity of the crude fermentation extract of *D. pseudoduranthus* D-3-1 against six tested bacteria. A represents the inhibition result against *Staphylococcus aureus*; B represents the inhibition result against *Bacillus subtilis*; C represents the inhibition result against *Pseudomonas aeruginosa* PAO1; D represents the inhibition result against *Escherichia coli*; E represents the inhibition result against *Fusarium wilt*; and F represents the inhibition result against *White rot*. CK1 represents the methanol extract of the control group's modified Gao's No. 1 medium, CK2 represents the ethyl acetate extract of the control group's modified Gao's No. 1 medium, 1 represents the methanol extract of the D-3-1 fermentation broth, and 2 represents the ethyl acetate extract of the D-3-1 fermentation broth.

[0017] Figure 5 The siderogen activity of crude D-3-1 ethyl acetate extracts obtained by two fermentation methods was detected; where 1 represents crude D-3-1 fermented extract obtained by modified Gao's No. 1 culture, and 2 represents crude D-3-1 fermented extract obtained by culture in modified Gao's No. 1 medium containing 2 mM FeCl3.

[0018] Figure 6 The peaks representing the differences in HPLC detection of the crude ethyl acetate extract of *D. pseudoduranthus* D-3-1 obtained by the two fermentation methods are shown. The blue peaks represent the crude extract of D-3-1 obtained by the modified Gao's No. 1 culture medium, and the black peaks represent the crude extract of D-3-1 obtained by the modified Gao's No. 1 culture medium containing 2 mM FeCl3.

[0019] Figure 7 This is a schematic diagram comparing the pdb gene cluster of *D. pseudoduranthus* D-3-1 with the tnb gene cluster responsible for turnerbactin synthesis.

[0020] Figure 8 The peaks represent the difference between the ethyl acetate extracts of *D. pseudoduranthus* D-3-1 fermentation broth under iron-containing and iron-free conditions.

[0021] Figure 9 The peaks represent the EIC ions of four iron-supported compounds.

[0022] Figure 10 These are secondary mass spectrometry fragment peaks of four iron-supported compounds.

[0023] Figure 11 The diagram shows the structure of four iron carriers.

[0024] Figure 12The detection of violacein and deoxyviolacein produced by *D. dodecanoides* D-3-1; where A represents the EIC ion peak of violacein and deoxyviolacein in the fermentation broth of D-3-1; B represents the secondary mass spectrometry fragment peaks and structures of violacein and deoxyviolacein.

[0025] Figure 13 To knock out the D-3-1 purple bacitracin gene cluster of *D. pseudodactylon* ( vio In ) vioB Schematic diagram of the effect of gene knockout on violacein and deoxyviolacein produced by *D. pseudoduranthus* D-3-1; where A represents the gene knockout location; B represents the knockout location. vioB EIC ion peaks of violacein and deoxyviolacein in the ethyl acetate extracts of fermentation broths of *D. dodecanoate* D-3-1 and wild-type *D. dodecanoate* D-3-1; C represents knockout. vioB Culture plate images of *D. pseudoduranthus* D-3-1 and wild-type *D. pseudoduranthus* D-3-1; in the images, D-3-1-WT and WT both represent wild-type *D. pseudoduranthus* D-3-1, and D-3-1△... vioB , △ vioB All indicate knockout vioB The gene of *D. dodecandella* D-3-1.

[0026] Figure 14 The growth curve of *D. doxorubicin* D-3-1. Detailed Implementation

[0027] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0028] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments of the present invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, and / or combinations thereof.

[0029] As mentioned earlier, siderophores generally exhibit significant antibacterial and antifungal activities, playing a dual role in the survival and growth of microorganisms, and have become one of the hot topics in the research and development of new drugs.

[0030] A typical embodiment of the present invention provides a strain of *D. pseudoduranthus* D-3-1 with biocontrol function. *D. pseudoduranthus* ( Pseudoduganellasp.) D-3-1 was deposited at the China Center for Type Culture Collection on January 20, 2026, with accession number CCTCC NO: M 2026163.

[0031] Another typical embodiment of the present invention provides a derivative of *Durga niger* D-3-1, including one or more of its live cells, inactivated cells, fermentation broth, or metabolites.

[0032] In this invention, the term "metabolite" refers to the primary or secondary metabolites produced during microbial metabolism. Primary metabolism refers to the process by which microorganisms absorb various nutrients from the external environment and generate substances and energy to sustain life activities through catabolism and anabolism. The products of primary metabolism are called primary metabolites, such as monosaccharides or monosaccharide derivatives, nucleotides, vitamins, amino acids, fatty acids, and various macromolecular polymers composed of them, such as proteins, nucleic acids, polysaccharides, and lipids. Secondary metabolism refers to the process by which microorganisms, during a certain growth stage, use primary metabolites as precursors to synthesize substances that have no clear function for the life activities of microorganisms. The products of secondary metabolism are called secondary metabolites, and most are compounds with relatively complex molecular structures.

[0033] In this invention, the metabolites can be obtained from cultures of *Pseudomonas pseudodurantulatus* D-3-1. The metabolites can be sterile metabolites of *Pseudomonas pseudodurantulatus* D-3-1 or bacterial metabolites of *Pseudomonas pseudodurantulatus* D-3-1. The sterile metabolites of *Pseudomonas pseudodurantulatus* D-3-1 can be prepared as follows: *Pseudomonas pseudodurantulatus* D-3-1 is cultured in a liquid culture medium; the *Pseudomonas pseudodurantulatus* D-3-1 is removed from the liquid culture (fermentation broth) by centrifugation; the supernatant is extracted to obtain the sterile metabolites of *Pseudomonas pseudodurantulatus* D-3-1. The bacterial metabolites of *Pseudomonas pseudodurantulatus* D-3-1 can be prepared as follows: *Pseudomonas pseudodurantulatus* D-3-1 is cultured in a liquid culture medium; the fermentation broth is collected, and this fermentation broth is the bacterial metabolite of *Pseudomonas pseudodurantulatus* D-3-1.

[0034] In a specific embodiment of the present invention, the metabolite is a secondary metabolite.

[0035] In a specific embodiment of the present invention, the culture medium can be a modified Gao's No. 1 culture medium.

[0036] In another typical embodiment of the present invention, a microbial agent is provided, comprising an active ingredient, said active ingredient including *Durgaeria pseudodactylon* D-3-1 or a derivative thereof. The active ingredient of the microbial agent may also contain other biological and / or non-biological components. Other active ingredients of the microbial agent can be determined by those skilled in the art based on antibacterial effects, disease-resistant effects, etc.

[0037] Furthermore, the bacterial agent includes *Durgatus pseudodulans* D-3-1 and its metabolites.

[0038] In some embodiments, the microbial agent, in addition to the active ingredient, also contains a carrier. The carrier can be a biologically inert carrier commonly used in the pesticide field. No specific limitations are made here.

[0039] In some embodiments, the microbial agent may be in various dosage forms, such as liquid, emulsion, suspension, powder, granules, wettable powder or water-dispersible granules.

[0040] Another typical embodiment of the present invention provides a method for preparing the above-mentioned bacterial agent, including the step of culturing *Durgatus pseudodulans* D-3-1.

[0041] In some embodiments, the steps include: inoculating *Durga niger* D-3-1 into a liquid culture medium to obtain a seed culture, and inoculating the seed culture into a modified Gao's No. 1 medium and culturing at 30°C for 72 h to obtain a fermentation broth.

[0042] In some embodiments, the steps include: inoculating *D. pseudoduranthus* D-3-1 into a liquid culture medium to obtain a seed culture; inoculating the seed culture into a modified Gao's No. 1 medium and culturing it at 30°C for 72 h to obtain a fermentation broth; and extracting the fermentation broth to obtain metabolites of *D. pseudoduranthus* D-3-1.

[0043] In some embodiments, the liquid culture medium is O238 liquid culture medium.

[0044] In some embodiments, the amount of seed liquid inoculated is 1% to 5%, preferably 2%.

[0045] In some embodiments, the solvents used for extraction include ethyl acetate and methanol.

[0046] Another typical embodiment of the present invention provides the use of *Durgatus pseudodulans* D-3-1 or its derivatives, or the above-mentioned inoculum, in any of the following: (1) Inhibiting bacteria or preparing products that inhibit bacteria; (2) Inhibiting fungi or preparing products that inhibit fungi; (3) To produce ferrocarriers or to prepare products for the production of ferrocarriers; (4) Production of violacein and deoxyviolacein; The bacteria include Staphylococcus aureus (Staphylococcus aureus) Staphylococcus aureus ), Escherichia coli ( Escherichia coli Bacillus subtilis ( Bacillus subtilis ) and Pseudomonas aeruginosa ( Pseudomonas aeruginosa The fungi mentioned include white rot pathogens and wilt pathogens.

[0047] In some embodiments, the product includes antibacterial agents or antibiotics.

[0048] Another typical embodiment of the present invention provides a method for inhibiting bacteria in vitro for non-therapeutic purposes, comprising treating the target organism with *D. pseudoduranthus* D-3-1 or a derivative thereof or the above-mentioned bacterial agent; said bacteria include *Staphylococcus aureus* (… Staphylococcus aureus ), Escherichia coli ( Escherichia coli Bacillus subtilis ( Bacillus subtilis ) and Pseudomonas aeruginosa ( Pseudomonas aeruginosa ).

[0049] Another typical embodiment of the present invention provides a method for inhibiting fungi in vitro for non-therapeutic purposes, comprising treating the target organism with *D. pseudoduranthus* D-3-1 or its derivatives or the aforementioned fungal agents; the fungi include white rot pathogens (… White rot pathogen ) and wilt pathogen ( Fusarium solani ).

[0050] The culture media used in the examples are: 0238 liquid culture medium: peptone 5.0 g / L, yeast extract 5.0 g / L, MgSO47H2O 1.0 g / L.

[0051] 0238 solid culture medium: peptone 5.0 g / L, yeast extract 5.0 g / L, MgSO47H2O 1.0 g / L, agar powder 12 g / L.

[0052] The modified Gao's No. 1 solid culture medium was purchased from Qingdao Haibo Biotechnology Co., Ltd., product number HB8550.

[0053] The modified Gao's No. 1 liquid culture medium was purchased from Qingdao Haibo Biotechnology Co., Ltd., product number HB8550-1.

[0054] PDA culture medium was purchased from Beijing Solarbio Science & Technology Co., Ltd., product number P8931.

[0055] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0056] Example 1: *Durgaea pseudoepiphyllum* ( Pseudoduganella Isolation and Identification of sp.)D-3-1 1. Separation Weigh 1 g of soil collected from Cangma Mountain, Linshu County, Linyi City, Shandong Province, China, place it in 10 mL of sterile water, shake vigorously, and let stand for 30 min. Take 1 mL of the supernatant and dilute it in 9 mL of sterile water. Dilute 10-10-1 10 -2 10 -3 Three gradients. Each is set to 10. -1 10 -3 100 μL of the supernatant from two gradients was evenly spread on actinomycete solid culture medium. Colonies that inhibited other microorganisms were screened and purified until the colony morphology remained unchanged.

[0057] Strains with antibacterial effects or siderophore activity were selected. The active strains were numbered and screened to obtain strains that inhibited the growth of bacteria and fungi and had siderophore activity, which were named D-3-1.

[0058] Strain D-3-1 can grow in modified Gao's 1 medium and O238 medium, and antibacterial and siderophore activities were found only in modified Gao's 1 medium.

[0059] Place a drop of sterile saline solution on a clean glass slide. Use an inoculation loop to pick up a small amount of bacteria and spread it onto the sterile saline solution. After drying, perform Gram staining, examine under a microscope, and observe the colony morphology and Gram staining results of strain D-3-1 as follows. Figure 1 As shown in A and B in the diagram.

[0060] 2. PCR identification Using the bacterial culture as a template, a universal 16S rRNA primer (27F: 5') was selected. AGAGTTTGATCCTGGCTCAG 3' (SEQ ID NO: 2); 1492R: 5' GGTTACCTTGTTACGACTT 3' (SEQ ID NO:3) Primers were synthesized by Beijing Qingke Biotechnology Co., Ltd., and PCR amplification was performed using the synthesized primers.

[0061] The PCR amplification system was as follows: 1 μL of culture, 12.5 μL of 2× ApexHF CL Buffer, 0.5 μL of ApexHF HS DNA Polymerase CL, 1 μL of 27F primer, 1 μL of 1492R primer, and double-distilled water (dd H2O) to a final volume of 25 μL. The PCR amplification conditions were: 94℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s; 58℃ annealing for 10 s; 72℃ extension for 30 s, for 30 cycles; and 72℃ final extension for 10 min.

[0062] Agarose gel electrophoresis: PCR amplification products were detected by electrophoresis using a 1% agarose gel with 1×TAE buffer as the electrophoresis medium. Electrophoresis conditions: voltage 120 V, current 400 mA, time 20 min. PCR product sequencing was performed by Qingke Biotechnology Co., Ltd., and the sequencing results were submitted to the NCBI database for comparison to determine the species. A phylogenetic tree was constructed using MEGA12, and the results are as follows. Figure 2 As shown, the strain was confirmed to be *Durgaea pseudobulbarum*. Pseudoduganella sp.). The 16S rRNA sequence of this strain is as follows:

[0063] 3. Strain preservation The selected strain D-3-1 was deposited at the China Center for Type Culture Collection (CCTCC), Wuhan University, Wuhan, Hubei Province, China, with accession number CCTCC NO: M 2026163, and classified as follows: Pseudoduganella sp.D-3-1, deposited on January 20, 2026.

[0064] Example 2: Fermentation culture and extraction of secondary metabolites of *D. pseudoduranthus* D-3-1 The fermentation broth of *D. pseudoduranthus* D-3-1 was extracted using ethyl acetate and methanol.

[0065] 1. Fermentation culture of *D. pseudoduranthus* D-3-1 Select a single colony of *D. pseudoduranthus* D-3-1 and inoculate it into 0238 liquid medium. Incubate at 30°C for 12-16 h. Then, inoculate it into 50 mL of modified Gao's No. 1 medium at a ratio of 2% and incubate at 30°C for 72 h to obtain the fermentation broth of *D. pseudoduranthus* D-3-1.

[0066] 2. Extraction of secondary metabolites from *D. pseudoduranthus* D-3-1 The fermentation broth of *D. pseudoduranthus* D-3-1 was extracted with ethyl acetate and methanol, respectively.

[0067] (1) Extraction of fermentation broth of *D. pseudoduranthus* D-3-1 by ethyl acetate The pH of the *D. pseudoduranthus* D-3-1 fermentation broth was adjusted to 2-3, and the fermentation supernatant was obtained by centrifugation at 8000 rpm and 4℃ for 10 min using a high-speed refrigerated centrifuge.

[0068] The collected supernatant was transferred to a separatory funnel and an equal volume of ethyl acetate was added. The addition of ethyl acetate was to transfer the secondary metabolites from the aqueous phase to the organic phase by solvent extraction.

[0069] Mixing: Vigorously shake the mixture of supernatant and ethyl acetate and allow it to stand to ensure that secondary metabolites can be efficiently transferred from the aqueous phase to the organic phase.

[0070] Separation of phases: After mixing, ethyl acetate and water will form two distinct phases. Typically, ethyl acetate will settle at the bottom, while the aqueous phase will rise to the top. At this point, the lower ethyl acetate fraction needs to be carefully collected. The upper aqueous phase is then extracted again with an equal volume of ethyl acetate, and the lower ethyl acetate fraction is collected and combined with the ethyl acetate fraction obtained from the first extraction.

[0071] Rotary evaporation: The collected ethyl acetate is transferred to a round-bottom flask and completely evaporated using a rotary evaporator in a fume hood, leaving the secondary metabolites.

[0072] Drying and Storage: After evaporation, the secondary metabolites will remain dry at the bottom of the round-bottom flask. At this point, the secondary metabolites can be fully dissolved in 1 mL of imported methanol and stored in a -20°C refrigerator for subsequent activity testing.

[0073] (2) Extraction of fermentation broth of *D. doxorubicin* D-3-1 with methanol For methanol extraction, after three days of culture of *D. pseudoduranthus* D-3-1, 1 mL of resin is added, and the mixture is incubated at 30°C for 1 day without pH adjustment. The precipitate is obtained by centrifugation at 8000 rpm for 10 minutes at 4°C. 20 mL of methanol is added to the precipitate, vortexed, and incubated with shaking for 2-3 hours. The supernatant is then obtained by filtration. Subsequent steps are the same as those for ethyl acetate extraction, including rotary evaporation and drying for storage.

[0074] Example 3: Determination of the antifungal activity and siderophore activity of *D. pseudoduranthus* D-3-1 fermentation broth 1. Antifungal activity of *D. pseudoduranthus* D-3-1 fermentation broth The quality control strain was selected from white rot pathogens ( White rot pathogen ) and wilt pathogen ( Fusarium solani For fungal inoculation, PDA medium was used. Activated indicator bacteria were divided into 1cm × 1cm pieces, inverted onto fresh PDA medium, and wells were made using a 100 μL pipette tip. 10 μL of 72-h fermentation broth of strain D-3-1 was added. The mixture was then incubated at 30℃ and observed. Results are as follows: Figure 3 As shown in A and B, the fermentation broth of *D. pseudoduranthus* D-3-1 significantly inhibits the growth of white rot pathogens and wilt pathogens.

[0075] 2. Siderophore activity test of *D. pseudoduranthae* D-3-1 fermentation broth The siderophore activity of the extracted crude fermentation extract was tested using CAS medium. Using a 100 μL pipette tip, a well was made in the CAS solid medium, and 10 μL of 72 h fermentation broth of strain D-3-1 was added. A control was also included. The mixture was incubated at room temperature for 1–2 h. The results are shown below. Figure 3 As shown in C, it exhibits good siderogenic activity.

[0076] Example 4: Determination of the antibacterial activity and siderophore activity of secondary metabolites of *D. pseudoduranthesperidium* D-3-1 1. Antibacterial activity of D-3-1 secondary metabolites of *D. pseudoduranthesperidone* The antibacterial ability of the secondary metabolites extracted in Example 2 was tested using the filter paper disc method. The quality control bacteria were Gram-negative Staphylococcus aureus (Staphylococcus aureus). Staphylococcus aureus ), Escherichia coli ( Escherichia coli ), Gram-positive bacteria Bacillus subtilis ( Bacillus subtilis ), Pseudomonas aeruginosa ( Pseudomonas aeruginosa For the test plates, LB medium was used, and the concentration of the indicator bacteria was adjusted to 10. 6 Using CFU / mL as the indicator bacterial suspension, pipette 100 μL of the indicator bacterial suspension and spread it evenly on the surface of the solid culture medium. Place 2-3 layers of filter paper in sections on the petri dish. Slowly add approximately 10 μL of secondary metabolite sample to each filter paper section, and set up a control. Then incubate at 37℃ for 12 h and observe the results.

[0077] The quality control strain was selected from white rot pathogens ( White rot pathogen ) and wilt pathogen ( Fusarium solani For the detection plates, PDA medium was used for fungi. Activated indicator bacteria were divided into 1cm × 1cm pieces, inverted onto fresh PDA medium, and wells were made using a 100 μL pipette tip. 10 μL of secondary metabolite sample was added, and a control was included. The plates were then incubated at 30℃ and the results were observed.

[0078] The results are as follows Figure 4 As shown in A, B, C, D, E, and F, the secondary metabolites of *D. pseudoduranthus* D-3-1 extracted with ethyl acetate have inhibitory effects on *Staphylococcus aureus*, *Escherichia coli*, *Bacillus*, and *Pseudomonas aeruginosa*, and have significant inhibitory effects on white rot pathogens and wilt pathogens.

[0079] 2. Siderophoretic activity of secondary metabolites of *D. pseudoduranthae* D-3-1 The siderophore activity of the extracted crude fermentation extract was tested using CAS medium. A 100 μL pipette tip was used to make a well in the CAS solid medium, and 10 μL of ethyl acetate-extracted *D. pseudodangerina* D-3-1 secondary metabolite sample was added, with a control included. The mixture was incubated at room temperature for 1–2 h, and the results were observed. The results demonstrated that the ethyl acetate-extracted *D. pseudodangerina* D-3-1 secondary metabolite exhibited significant siderophore activity.

[0080] To further verify the siderophore activity of *D. pseudoduranthus* D-3-1, the strain was simultaneously inoculated into modified Gao's No. 1 medium and modified Gao's No. 1 medium containing 2 mM FeCl3 at the same ratio, and fermented at 30°C. The crude fermentation extract was extracted with ethyl acetate, and the siderophore activity of the extracted crude fermentation extract was tested using CAS medium combined with high performance liquid chromatography (HPLC).

[0081] HPLC detection conditions: The liquid phase was prepared using a Thermo Scientific Acclaim C18 column (4.6 × 250 mm, 5 µm); mobile phase A was H2O + 0.1% formic acid, and mobile phase B was acetonitrile; elution gradient was 0–30 min 5%–95% B, 30–40 min 95% B, and 40–48 min 5% B; UV detection wavelength was 210–330 nm, UV 254 nm, and injection volume was 10 μL.

[0082] like Figure 5 As shown, when the *D. d ...

[0083] HPLC results are as follows Figure 6 As shown, there are at least two distinct peaks between the crude extracts of the fermentation broth extracted with ethyl acetate.

[0084] Example 5: Structural analysis of secondary metabolites in *D. pseudoduranthus* D-3-1 1. Siderophore compounds 1-4 produced by *D. pseudoduranthae* D-3-1 The structure of the target iron carrier compound was identified by analyzing the metabolites produced by strain D-3-1 under iron-containing and iron-free culture conditions using HR-ESI-MS.

[0085] HPLC-MS / MS conditions: Liquid phase preparation: Thermo Scientific™ Acclaim™ C18 column (2.1 × 100 mm, 2.2 μm); Mobile phase A: H2O + 0.1% formic acid, Mobile phase B: acetonitrile; HPLC detection conditions: 1–3 min, 5% ACN; 3–18 min, 5% to 95% ACN; 18–22 min, 95% ACN; 22.1–25 min, 5% ACN; Flow rate: 0.3 ml / min; UV detection wavelength: 100–400 nm; BPC range: 100–1500 nm; Sample injection volume: 5 μL.

[0086] Secondary mass spectrometry results showed that all four compounds (1-4) contained three core fragment ion peaks at 251, 338, and 443, which are structurally similar to the previously reported turnerbactin siderophores. Antismash bioinformatics analysis of the D-3-1 strain genome revealed the biosynthetic gene cluster BGC14 (named...) pdb ) and the turnerbactin gene cluster ( tnbThe two strains share homology. A comparison was made with *D. dodecanois* D-3-1. pdb Gene clusters and those responsible for turnerbactin synthesis tnb Gene clusters, results as follows Figure 7 As shown, PdbC / PdbE / PdbB / PdbA share 56%-60% homology with TnbC / TnbE / TnbB / TnbA, and PdbF shares 52% homology with TnbF. Both compounds have similar functions and are involved in siderophore biosynthesis. The structures of the four compounds were identified using bioinformatics and mass spectrometry, and the results are as follows: Figure 8 , Figure 9 , Figure 10 and Figure 11 As shown, these are compounds 1 (DHB-Orn-Ser)2, 2 (DHB-Orn-Ser-Ser), 3 dehydrated (DHB-Orn-Ser)2, and 4 dehydrated (DHB-Orn-Ser-Ser). Among them, compounds 2 and 4 are novel compounds, which are named pseudoobactins.

[0087] 2. Viola violacein produced by *D. dodecanoides* D-3-1 The ethyl acetate extract of strain D-3-1 was analyzed by HR-ESI-MS, and the results are as follows: Figure 12 As shown in A and B, bioinformatics and mass spectrometry identified that D-3-1 can produce violacein and deoxyviolacein with multiple biological activities.

[0088] Further knockout of the violetin gene cluster (vio) vioB Gene, knockout location such as Figure 13 As shown in A, the gene knockout strain and the wild-type strain D-3-1 were simultaneously inoculated into modified Gao's No. 1 medium at the same ratio and fermented at 30°C. The results are as follows. Figure 13 As shown in B and C, strain D-3-1, which has not undergone gene knockout, can produce violacetin and deoxyviolacetin, while the gene knockout strain cannot produce violacetin and deoxyviolacetin.

[0089] Example 6: Biological characteristics of *D. pseudoduranthus* D-3-1 1. Colony morphology and growth curve of *D. pseudoduranthus* D-3-1 Activate *Durgatus pseudodulans* D-3-1 from bacterial culture, streak in three zones, and incubate at 30°C.

[0090] Inoculate *D. dodecanoides* D-3-1 into 50 mL of O238 medium to induce an initial OD of [missing information]. 600 =0.1, incubated at 30℃, and the OD of the strain was measured every 3 hours starting from 0h.600nm Record the values, repeat the experiment three times in parallel, and use blank culture medium as a control.

[0091] The results are as follows Figure 14 As shown, *Durgentobacter pseudococcus* D-3-1 follows a lag phase, logarithmic phase, stationary phase, and death phase. The strain is in the lag phase for the first 3 hours with little change, then enters the logarithmic phase, reaching its peak growth around 18 hours, then gradually decreasing, and leveling off after 36 hours. After entering the stationary and death phases, the viable cells are inhibited by their own metabolic products, and the nutrient-poor culture medium cannot meet their growth needs. Therefore, the optimal harvest time for this bacterium is determined to be 18 hours.

[0092] 2. Antibiotic screening for *D. doxorubicin* D-3-1 A single colony was inoculated into 0238 liquid medium and incubated at 30℃ for 12-16 h. 50 μL of the culture was then evenly spread onto 0238 solid medium containing different concentrations of antibiotics and incubated upside down at 30℃ for 12-16 h. The results are shown in Table 1.

[0093]

[0094] Note: 60++ in the table indicates greater than 60.

[0095] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of them. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A strain of *D. pseudoduranthus* D-3-1 with biocontrol function, characterized in that, Duchenne pyrenoidosa ( Pseudoduganella sp.) D-3-1 was deposited at the China Center for Type Culture Collection on January 20, 2026, with accession number CCTCC NO: M 2026163.

2. A microbial agent, characterized in that, It includes an active ingredient, which includes one or more of the live bacteria or fermentation broth of *Durga niger* D-3-1 as described in claim 1.

3. The method for preparing the microbial agent according to claim 2, characterized in that, This includes the steps of culturing *D. doxorubicin* D-3-1.

4. The preparation method according to claim 3, characterized in that, The steps include: inoculating *Durga niger* D-3-1 into a liquid culture medium to obtain a seed culture, and inoculating the seed culture into a modified Gao's No. 1 medium and culturing it at 30°C for 72 hours to obtain a fermentation broth.

5. The use of *Durgaea pyrenoidosa* D-3-1 as described in claim 1 or the inoculum agent as described in claim 2 in any of the following: (1) Prepare products that inhibit bacteria; (2) Preparation of products that inhibit fungi; (3) Prepare products for producing ferrocarriers; (4) Production of violacein and deoxyviolacein; in, The bacteria is Staphylococcus aureus (Staphylococcus aureus) Staphylococcus aureus ), Escherichia coli ( Escherichia coli Bacillus subtilis ( Bacillus subtilis ) and Pseudomonas aeruginosa ( Pseudomonas aeruginosa The fungus mentioned is the wilt pathogen. Fusarium solani .

6. A method for inhibiting bacteria, characterized in that, This includes treating the target organism with the bacterial agent described in claim 2; the bacteria being Staphylococcus aureus (…). Staphylococcus aureus ), Escherichia coli ( Escherichia coli Bacillus subtilis ( Bacillus subtilis ) and Pseudomonas aeruginosa ( Pseudomonas aeruginosa The method described is not for therapeutic purposes.

7. A method for inhibiting fungi, characterized in that, This includes treating the target organism with *Durgentobacter pseudodulans* D-3-1 as described in claim 1 or the fungal agent as described in claim 2; wherein the fungus is a wilt pathogen. Fusarium solani The method described is not for therapeutic purposes.

Images