A method for producing tylosin A

Abstract

This invention relates to the fields of synthetic biology and metabolic engineering, specifically to a Streptomyces promoter selection marker and its application. The selection marker gene is *Streptomyces lilacinus*. Streptomyces lavendulae Glutamine indigo synthase gene derived from CGMCC 4.1386 idgS This invention screens endogenous promoters of *Streptomyces freundii* using heterologously expressed idgS genes; and constructs a detection system for endogenous promoters of *Streptomyces freundii* using this scheme, which can rapidly detect endogenous promoters of *Streptomyces freundii* and the strength of each promoter.

Description

Technical Field

[0001] This invention relates to the fields of synthetic biology and metabolic engineering, specifically to a streptomyces promoter screening marker and its application. Background Technology

[0002] Tylosin, a classic representative of 16-membered ring macrolide antibiotics, has had a significant impact on the global livestock and veterinary drug industries since its discovery and industrialization. In 1959, McGuire et al. first isolated tylosin from the fermentation broth of *Streptomyces fradiae*, opening a new path for the application of antibiotics in livestock and laying the foundation for its industrialization. In 1962, Eli Lilly and Company pioneered the industrial production of tylosin, which subsequently entered the market on a large scale and became a strategic product in the global veterinary drug field due to its three advantages: broad-spectrum antibacterial properties, capable of inhibiting and killing a variety of bacteria; growth-promoting properties, improving livestock farming efficiency; and unique pharmacokinetic characteristics, offering significant advantages in veterinary drug applications. While antibiotics as feed additives face controversies such as increased bacterial resistance, impacts on the ecological environment, and harm to human health, tylosin still maintains an important position in the veterinary drug field due to its unique advantages.

[0003] Currently, the industrial production of tylosin mainly relies on the bio-fermentation process of *Streptomyces freundii*. However, given the complex genetic background of *Streptomyces freundii* used in industrial production and its significant differences in phylogenetic relationships with model organisms, coupled with the accumulation of numerous unknown mutation sites after years of continuous mutation breeding of industrial strains, these factors collectively lead to difficulties in achieving the expected efficacy of commonly used gene elements in the field of *Streptomyces* genetic engineering in industrial *Streptomyces freundii*. Furthermore, there is currently a lack of precise qualitative and quantitative descriptions of these gene elements. Consequently, the genetic engineering modification of industrial *Streptomyces freundii* strains faces numerous severe challenges.

[0004] Because Streptomyces has a thick cell wall and is autofluorescent, fluorescent proteins are not very effective as characterization markers. Therefore, to quantitatively detect the promoter of Streptomyces, it is necessary to find markers that can cross the cell wall and have stable color signals.

[0005] Therefore, developing a high-throughput promoter detection platform specifically for *Streptomyces freundii* will be an effective way to solve this problem, and will enable a rapid increase in tylosin production through synthetic biology modification of industrial strains of *Streptomyces freundii*. Summary of the Invention

[0006] The purpose of this invention is to provide a screening marker for Streptomyces promoters and its application.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: A selectable marker gene for a Streptomyces promoter is the glutamine indigo synthase gene (idgS) derived from Streptomyces lavendulae CGMCC 4.1386.

[0008] The glutamine indigo synthase gene (idgS) has the nucleotide sequence shown in SEQ ID NO:1.

[0009] The selection marker gene was heterologously expressed in *Streptomyces freundii*, and the expression level of glutamine indigofera, i.e., the ultraviolet absorbance (OD) value of the blue compound glutamine indigofera in the fermentation broth, was used as the indicator. 600 The intensity of promoters (which is linearly correlated with OD600 value) can be used to screen for the strength of Streptomyces promoters.

[0010] An application of the Streptomyces promoter selection marker gene, wherein the selection marker gene is used in high-throughput identification of promoters in Streptomyces freundii.

[0011] The application of the high-strength promoter in *Streptomyces freundii* selected by the screening marker gene in regulating the production of tylosin A by *Streptomyces freundii*.

[0012] A recombinant plasmid (platform) for constructing high-throughput detection of the promoter of Streptomyces freundii, wherein the recombinant plasmid contains the aforementioned screening marker gene.

[0013] Furthermore, taking the industrial production strain of *Streptomyces fradiae* GS1 (Zhang, YX, Perry, K., Vinci, VA, Powell, K., Stemmer, WP, & del Cardayré, SB(2002). Genome shuffling leads to rapid phenotypic improvement in bacteria. *Nature*, 415(6872), 644-646.) as an example, partial endogenous promoter sequence information of the industrial strain GS1 was obtained through transcriptome information and literature search. Its nucleotide sequence is shown in SEQ ID NO:2-38. Taking the endogenous promoter P1 as an example, the promoter gene sequence was amplified using corresponding primers and assembled into the idgS gene using Gibson assembly, constructing the plasmid pSET152-P1-idgS. Figure 1 As shown, its nucleotide sequence is shown in SEQ ID NO:39.

[0014] A method for high-throughput detection of *Streptomyces freundii* promoters involves introducing a selection marker gene into *Streptomyces freundii*, detecting the expression intensity of the idgS gene in *Streptomyces freundii*, identifying *Streptomyces freundii* promoters as those capable of expression, and using the expression intensity to describe the promotion strength characteristics of the inserted promoter.

[0015] The plasmid was used in *Streptomyces freundii* through short-term or high-throughput fermentation culture, and the OD value of the fermentation broth was measured. 600 The ultraviolet light absorption value at a certain location indicates that the *Streptomyces freundii* promoter has an absorption value. At the same time, the difference in the ultraviolet light absorption value of the fermentation broth represents the difference in the promoter strength. Therefore, the promoter strength of different promoters can be quantitatively compared and screened to obtain high-strength promoters.

[0016] Furthermore, after transforming the plasmid into *Streptomyces freundii* and conducting short-term or high-throughput fermentation culture, the OD value of the fermentation broth was measured. 600 The ultraviolet light absorption value at that location.

[0017] Furthermore, the obtained strain was cultured in TSB seed culture medium at 28°C in a shaker for 48 hours. Then, the culture was inoculated into TYL fermentation medium at 4 wt% and cultured in a shaker at 28°C for 4 days. The fermentation broth was then diluted 10 times with DMSO, and the OD value could be detected. 600 The ultraviolet light absorption value at that location.

[0018] An application of the method described herein, wherein the method screens for high-strength promoters in *Streptomyces freundii* and uses them to regulate the production of tylosin A by *Streptomyces freundii*.

[0019] A promoter for Streptomyces freundii, wherein the promoter sequences screened using the method are any one of the sequences shown in SEQ ID NO:2-38.

[0020] A promoter for regulating tylosin production by *Streptomyces freundii*, wherein the promoter is a high-strength promoter obtained by screening using the method described above.

[0021] A high-yield strain for tylosin production, the strain containing the aforementioned promoter.

[0022] The strain containing the promoter, and overexpressing the tylF gene or other genes, can be an engineered strain that produces high levels of tylosin.

[0023] A method for producing tylosin A, wherein high yield and high purity tylosin A can be obtained by fermentation culture of the strain.

[0024] The promoter is expressed in Streptomyces. The obtained strain is cultured in TSB seed culture medium at 28°C in a shaker for 72 hours. Then, the culture is inoculated into TYL fermentation medium at a rate of 4 wt% and cultured in a shaker at 28°C for 7 days to obtain high-yield, high-purity tylosin A.

[0025] The beneficial effects of this invention are as follows: This invention utilizes heterologously expressed idgS genes to screen endogenous promoters in *Streptomyces freundii*. A detection platform for *Streptomyces freundii* endogenous promoters is constructed using this method, enabling rapid qualitative and quantitative detection of *Streptomyces freundii* endogenous promoters and their strength. The heterologously expressed idgS gene produces glutamine-indole synthase, which catalyzes the generation of a blue marker. Rapid detection of the characteristic blue color using a spectrophotometer determines the transcriptional intensity of the idgS gene, thereby identifying the promoter and further determining its strength and timing. Overexpression of the tylF gene, obtained through screening of *Streptomyces freundii* endogenous promoters, enables the complete conversion of tylosin C in industrial fermentation strains to tylosin A, thus improving the purity of tylosin products and effectively increasing the yield of tylosin A, demonstrating high industrial application value. Attached Figure Description

[0026] Figure 1 The image of the plasmid pSET152-P1-idgS for detecting the intensity of the endogenous promoter P1 of Streptomyces freundii provided in this embodiment of the invention.

[0027] Figure 2 The graph shows the difference in the promoter strength of different promoters between *Streptomyces freundii* GS1 and *Streptomyces azureense* M145 over time, based on platform detection provided in this embodiment of the invention.

[0028] Figure 3 The graph shows the difference in promoter strength of different endogenous promoters in Streptomyces freundii GS1, based on platform detection, as provided in this embodiment of the invention.

[0029] Figure 4 The graph shows the difference in promoter strength of the Streptomyces fradiae GS1 endogenous promoter in the model strain Streptomyces fradiae CGMCC 4.576, as provided in this embodiment of the invention.

[0030] Figure 5 HPLC chromatograms of fermentation broths of Streptomyces freundii GS1 strains expressing TylF protein with different promoters, as provided in embodiments of the present invention. Detailed Implementation

[0031] The present invention will be further described in detail below with reference to embodiments, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field. Test methods in the following embodiments that do not specify specific experimental conditions are generally performed according to conventional experimental conditions or experimental conditions recommended by the manufacturer. Unless otherwise specified, the reagents and raw materials used in the present invention are all commercially available, including *Streptomyces lavendulae* CGMCC 4.1386, *S. fradiae* industrial strain GS1, *Streptomyces coelicolor* M145 (CGMCC 4.7172), and the *Streptomyces fradiae* type strain CGMCC 4.576, all of which are commercially available.

[0032] This invention utilizes glutamine blue-indigo derived from Streptomyces as a biomarker for strong promoters in Streptomyces freundii. A high-throughput detection platform is established to quantify the strength of endogenous promoters in Streptomyces freundii, enabling rapid detection of strong promoters. The use of strong promoters can improve the yield and purity of tylosin in Streptomyces freundii.

[0033] The primers and sequences used in the following examples are shown in Table 1.

[0034] Table 1 Primers used in the experiment

[0035] Example 1: Construction of a high-throughput detection platform for the *Streptomyces freundii* promoter based on the idgS gene To construct a blue light signal-based promoter detection platform for Streptomyces freundii, it is first necessary to complete the heterologous expression of the idgS gene in Streptomyces freundii.

[0036] The specific operation is as follows: First, the idgS gene fragment was amplified from Streptomyces lavendulae CGMCC 4.1386 using primers 152-kas-IDG-F and 152-kas-IDG-R. The PCR product was recovered and purified to obtain the idgS gene fragment, and the base sequence is shown in SEQ ID No. 1.

[0037] The pSET152 vector was amplified using primers 152-F and 152-R. The vector fragment of the PCR product was recovered, and the linear pSET152 vector was ligated with the idgS gene fragment using a one-step cloning kit. After transformation into E. coli DH10B, the plasmid pSET152-kasOp*-idgS was obtained. Correct clones were selected and sequenced for verification.

[0038] The recombinant plasmid pSET152-kasOp*-idgS obtained above was transformed into E. coli ET12567 / UZ8002 and demethylated. Then, it was conjugated and transferred into the industrial strain GS1 of *S. fradiae* and the control strain *Streptomyces coelicolor* (M145, CGMCC 4.7172) (the process can be found in Mazodier P, Petter R, Thompson C. Intergeneric conjugation between Escherichia coli and Streptomyces species. J Bacteriol. 1989 Jun;171(6):3583-5. doi: 10.1128 / jb.171.6.3583-3585.1989. PMID: 2656662.). Conjugates were obtained by screening with apramycin antibiotic, and subsequently, a single-exchangeon strain S was identified by PCR screening. fradiae-kasOp*-idgS and control strain S.coelicolor M145-kasOp*-idgS.

[0039] The spores of the obtained S. fradiae-kasOp*-idgS and S. coelicolor M145-kasOp*-idgS strains were inoculated into TSB seed culture medium and cultured in a shaker at 28°C for 48 h. Then, the obtained culture solution was inoculated at 4 wt% into a 500 mL Erlenmeyer flask containing 100 mL of TYL fermentation medium and cultured in a shaker at 28°C for 6 days.

[0040] The TSB seed culture medium composition / L consists of 30g of tryptone soybean broth (TSB) per 1 liter of water, autoclaved at 115℃ for 30 minutes. The TYL fermentation medium composition / L consists of 17g of corn flour, 10.5g of corn gluten, 0.37g of betaine, 1g of sodium chloride, 0.9g of potassium chloride, 0.37g of diammonium hydrogen phosphate, 0.1g of magnesium sulfate heptahydrate, 1ml of 0.4% nickel sulfate, 1ml of 0.3% cobalt chloride, 1.9g of calcium carbonate, 42ml of soybean oil, and 10.5g of fish meal per liter of water, autoclaved at 115℃ for 30 minutes.

[0041] Samples were taken daily after 2 days of fermentation. 0.1 mL of fermentation broth was added to 1.9 mL of DMSO, mixed thoroughly, and then sonicated to disrupt the bacterial cells for 5 min. The disrupted broth was then centrifuged at 12000 rpm for 10 min, and the blue supernatant was collected. The supernatant was then analyzed using a microplate reader to detect the OD value. 600The concentration of blue pigment in the supernatant was quantified by the ultraviolet absorbance value. Each reaction was repeated in triplicate, and the microplate reader used was a SpectraMax i3x multi-functional microplate reader purchased from Meigu Molecular Instruments (Shanghai) Co., Ltd.

[0042] The fermentation broths of *S. fradiae-kasOp*-idgS* and *S. coelicolor M145-kasOp*-idgS* strains, after background subtraction, were measured and calculated at OD0.05. 600 The ultraviolet light absorption value at that location (e.g.) Figure 2 (As shown), comparing the OD values ​​of S. fradiae-kasOp*-idgS and S. coelicolor M145-kasOp*-idgS strains. 600 The ultraviolet light absorbance at 4 days indicates that the general strong promoter kasOp* of Streptomyces exhibits high initiation strength in *S. coelicolor*, with an OD value of [missing value]. 600 The value was 16.5 ± 2.2, but the initiation strength in *S. fradiae* GS1 was low, with an OD of 4 days. 600 The value was only 1.3 ± 0.3. The results indicate that the promoter strength detection platform based on the expression of the idgS gene is available in *S. fradiae* GS1 and *S. coelicolor* M145, and can detect the expression intensity of the marker pigment at any time. Meanwhile, the universally used strong promoter kasOp* in *Streptomyces* showed no significant expression intensity in the industrial *Streptomyces* GS1, thus this method was used to screen for its specific high-strength promoter.

[0043] Example 2: High-throughput screening and quantitative characterization of the GS1 promoter of Streptomyces fradiae. Endogenous promoters usable in *Streptomyces fradiae* GS1 were screened. The partial endogenous promoter sequence information of the industrial strain GS1 of *Streptomyces fradiae* was obtained through transcriptome information and literature search. Its nucleotide sequence is shown in SEQ ID NO: 2-38. Using the primers listed in Table 1, and following the method described in the examples, the promoter *kasOp* in plasmid pSET152-kasOp*-idgS was replaced with the *Streptomyces fradiae*'s own promoter for testing. This example uses P1 as an example to construct plasmid pSET152-P1-idgS. The specific operation is as follows: First, the pSET152 plasmid fragment containing the idgS gene in plasmid pSET152-kasOp*-idgS was amplified using primers IdgS-F and 152-R2. The PCR product was then recovered and purified to obtain the vector fragment.

[0044] The promoter P1 gene fragment was amplified from *Streptomyces fradiae* GS1 using primers 152-P1-F and IDG-P1-R. The sequence is shown in SEQ ID No. 2. The P1 promoter gene fragment of the PCR product was recovered, and the linear pSET152-idgS vector was ligated to the P1 promoter gene fragment using a one-step cloning kit. After transformation into *E. coli* DH10B, the plasmid pSET152-P1-idgS was obtained (see [link to product]). Figure 1 Select the correct clone and sequence it for verification.

[0045] The recombinant plasmid pSET152-P1-idgS obtained above was transformed into E. coli ET12567 / UZ8002 for demethylation modification, and then transferred into the industrial strain GS1 of S. fradiae via conjugation. The conjugate was obtained by screening with apramycin antibiotic, and then a single-exchangeon strain S. fradiae-P1-idgS was obtained by PCR screening and identification.

[0046] The spores of the obtained S. fradiae-P1-idgS strain were inoculated into TSB seed culture medium and cultured in a shaker at 28°C for 48 h. Then, the obtained culture solution was inoculated into a 500 mL Erlenmeyer flask containing 100 mL of TYL fermentation medium at a volume of 4 wt% and cultured in a shaker at 28°C for 6 days.

[0047] The TSB seed culture medium composition / L consists of 30g of tryptone soybean broth (TSB) per 1 liter of water, autoclaved at 115℃ for 30 minutes. The TYL fermentation medium composition / L consists of 17g of corn flour, 10.5g of corn gluten, 0.37g of betaine, 1g of sodium chloride, 0.9g of potassium chloride, 0.37g of diammonium hydrogen phosphate, 0.1g of magnesium sulfate heptahydrate, 1ml of 0.4% nickel sulfate, 1ml of 0.3% cobalt chloride, 1.9g of calcium carbonate, 42ml of soybean oil, and 10.5g of fish meal per liter of water, autoclaved at 115℃ for 30 minutes.

[0048] Samples were taken daily after 2 days of fermentation. 0.1 mL of fermentation broth was added to 1.9 mL of DMSO, mixed thoroughly, and then sonicated to disrupt the bacterial cells for 5 min. The disrupted broth was then centrifuged at 12000 rpm for 10 min, and the blue supernatant was collected. The supernatant was then analyzed using a microplate reader to detect the OD value. 600 The concentration of blue pigment in the supernatant was quantified by the ultraviolet absorbance value. Each reaction was repeated in triplicate.

[0049] Based on the above experimental results, the OD of the fermentation broth... 600 The OD value changed most significantly at 4 days, therefore, the fermentation broth OD value at 4 days was recorded. 600 Values ​​that describe the relative strength of the promoter (e.g.) Figure 3 (As shown).

[0050] Then, based on the above description and the primers listed in Table 1, the strength of each endogenous promoter in *Streptomyces fradiae* GS1 was further evaluated. Figure 3 The experimental results showed that promoters P25, P26, P28, P34, and P39 were strong promoters, all of which could strongly express glutamine blue (IDG) in Streptomyces freundii, with their initiation strength being more than 10 times higher than that of the universal promoter kasOp; P2, P6, P19, P46, and P47 were medium-strength promoters; and P4.2, P16, and P45 were low-strength promoters, all of which can be used as basic elements for synthetic biology modification.

[0051] Example 3: Characterization of the promoter strength of the GS1 endogenous promoter in the *Streptomyces fradiae* model strain *Streptomyces fradiae* CGMCC 4.576 To verify that the method described in Example 2 is universally applicable to Streptomyces fradiae and that the screened promoter can be used in different Streptomyces fradiae, the recombinant plasmid pSET152-P1-idgS described in Example 2 was transformed into E. coli ET12567 / UZ8002 for demethylation modification, and then transferred via conjugation into the Streptomyces fradiae model strain Streptomyces fradiae CGMCC 4.576. The conjugate was obtained by screening with apramycin antibiotic, and then a single-exchangeon strain S. fradiae CGMCC 4.576-P1-idgS was obtained by PCR screening and identification.

[0052] The spores of the obtained S. fradiae CGMCC 4.576-P1-idgS strain were inoculated into TSB seed culture medium and cultured in a shaker at 28°C for 48 h. Then, the obtained culture solution was inoculated into a 500 mL Erlenmeyer flask containing 100 mL of TYL fermentation medium at a volume of 4 wt% and cultured in a shaker at 28°C for 6 days.

[0053] The TSB seed culture medium composition / L consists of 30g of tryptone soybean broth (TSB) per 1 liter of water, autoclaved at 115℃ for 30 minutes. The TYL fermentation medium composition / L consists of 17g of corn flour, 10.5g of corn gluten, 0.37g of betaine, 1g of sodium chloride, 0.9g of potassium chloride, 0.37g of diammonium hydrogen phosphate, 0.1g of magnesium sulfate heptahydrate, 1ml of 0.4% nickel sulfate, 1ml of 0.3% cobalt chloride, 1.9g of calcium carbonate, 42ml of soybean oil, and 10.5g of fish meal per liter of water, autoclaved at 115℃ for 30 minutes.

[0054] Samples were taken daily after 2 days of fermentation. 0.1 mL of fermentation broth was added to 1.9 mL of DMSO, mixed thoroughly, and then sonicated to disrupt the bacterial cells for 5 min. The disrupted broth was then centrifuged at 12000 rpm for 10 min, and the blue supernatant was collected. The supernatant was then analyzed using a microplate reader to detect the OD value. 600 The concentration of blue pigment in the supernatant was quantified by measuring the ultraviolet absorbance at a specific temperature. Each reaction was repeated in triplicate. The OD of the fermentation broth was recorded at 4 days. 600 Values ​​that describe the relative strength of the promoter (e.g.) Figure 4 (As shown).

[0055] Figure 4 The experimental results showed that the above-mentioned Streptomyces fradiae promoter screening platform was still usable in the model strain Streptomyces fradiae CGMCC 4.576, and the expression intensity of the same promoter differed greatly between the industrial strain and the model strain, demonstrating the necessity of using this method to screen for specific promoters for industrial strains.

[0056] Example 4: Application of the endogenous strong promoter of *Streptomyces fradiae* GS1 in improving the purity of tylosin. Genomic studies have revealed that the tylosin-O-methyltransferase encoded by the tylF gene is the rate-limiting switch for the conversion of tylosin C to tylosin A, and overexpression of this enzyme can effectively increase the content of the active ingredient A in tylosin. However, the use of the Streptomyces universal promoters kasOp* and ermEp*p* could not increase the proportion of tylosin A in the industrial strain *S. fradiae* GS1 (e.g., Figure 5 As shown in the diagram, even using the tylF gene's own promoter for multi-copy overexpression only increases the proportion of tylosin A to 68-72%, still not meeting the requirements for complete transformation. Therefore, a suitable strong promoter may increase the transcriptional amount of the tylF gene, thereby completely converting tylosin C to tylosin A.

[0057] Taking the construction of plasmid pSET152-P39-tylF as an example, the specific operation is as follows: First, use primers 152-P39-F and pset152-R to amplify the pSET152 plasmid fragment containing the P39 promoter from plasmid pSET152-P39-idgS, and then recover and purify the PCR product to obtain the vector fragment.

[0058] The tylF gene fragment was amplified from *Streptomyces fradiae* GS1 using primers P39-25tylF-F and 152-tylF-R. The tylF gene fragment from the PCR product was recovered, and the linear pSET152-P39 vector and the tylF gene fragment were ligated using a one-step cloning kit. After transformation into *E. coli* DH10B, the plasmid pSET152-P39-tylF was obtained, and the correct clones were selected for sequencing verification.

[0059] The recombinant plasmid pSET152-P39-tylF obtained above was transformed into E. coli ET12567 / UZ8002 for demethylation modification, and then transferred into the industrial strain GS1 of S. fradiae via conjugation. The conjugate was obtained by screening with apramycin antibiotic, and then a single-exchangeon strain S. fradiae-P39-tylF was obtained by PCR screening and identification.

[0060] The spores of the obtained S. fradiae-P39-tylF strain were inoculated into TSB seed culture medium and cultured in a shaker at 28°C for 48 h. Then, the obtained culture solution was inoculated into a 500 mL Erlenmeyer flask containing 100 mL of TYL fermentation medium at a volume of 4 wt% and cultured in a shaker at 28°C for 7 days.

[0061] The TSB seed culture medium composition / L consists of 30g of tryptone soybean broth (TSB) per 1 liter of water, autoclaved at 115℃ for 30 minutes. The TYL fermentation medium composition / L consists of 17g of corn flour, 10.5g of corn gluten, 0.37g of betaine, 1g of sodium chloride, 0.9g of potassium chloride, 0.37g of diammonium hydrogen phosphate, 0.1g of magnesium sulfate heptahydrate, 1ml of 0.4% nickel sulfate, 1ml of 0.3% cobalt chloride, 1.9g of calcium carbonate, 42ml of soybean oil, and 10.5g of fish meal per liter of water, autoclaved at 115℃ for 30 minutes.

[0062] After fermentation, 5g of fermentation broth was mixed with 5mL of ethanol and the cells were sonicated for 30min. Then, 40mL of ddH2O was added to dilute the fermentation broth, and the mixture was centrifuged at 4000r / min for 30min. The supernatant was collected, and tylosin in the fermentation broth was detected by HPLC. Each reaction was repeated in triplicate, with a control group also included.

[0063] Fermentation products were analyzed using an Agilent 1260 high-performance liquid chromatograph and an Agilent ZORBAX Eclipse Plus C18 column (5 μm, 4.6 mm × 150 mm, Agilent Technologies Inc., California, USA). The injection volume was 20 μL.

[0064] High-performance liquid chromatography (HPLC) conditions: An Agilent ZORBAX Eclipse Plus C18 column was used on an Agilent HPLC platform (Agilent Technologies Inc., California, USA). The flow rate was 1.0 mL / min. Mobile phase A: aqueous solution containing 2M sodium perchlorate (pH 2.5); Mobile phase B: acetonitrile. A PDA detector was used, with the detection wavelength set at 280 nm. The detector was kept at a constant temperature of 30°C. Elution conditions: 0 min–16 min, with the acetonitrile concentration maintained at a constant 40% until the detection was complete.

[0065] HPLC chromatogram after fermentation Figure 5 The results showed that the proportion of tylosin A in the fermentation broth of *S. fradiae* GS1 strain transformed with pSET152-kasOp*-tylF and pSET152-ermEp*p*-tylF plasmids was not significantly increased compared to the control group, indicating that TylF protein was not expressed in large quantities. However, the proportion of tylosin A in the fermentation broth of pSET152-tylF plasmid, which used the tylF gene's own promoter for multi-copy overexpression, increased to 68±3.6%, while tylosin C still remained at over 10% in the fermentation broth. Although TylF protein was overexpressed to some extent, the desired effect was not achieved. In the fermentation broth of *S. fradiae* GS1 strain transformed with pSET152-P39-tylF plasmid, the liquid phase retention peak of tylosin C almost completely disappeared, indicating that the proportion of tylosin C in the fermentation broth was significantly reduced (<0.5%). Furthermore, the liquid phase retention peak of tylosin A was significantly increased, indicating that it was completely converted to tylosin A during fermentation. The proportion of tylosin A in the fermentation broth was significantly higher than that of the wild type, reaching over 95%, indicating that the TylF protein was highly expressed. The P39 promoter has a stronger promoter strength than all currently known promoters and can be used as a strong endogenous promoter for overexpressing exogenous genes in *Streptomyces freundii*.

[0066] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

[0067] idgS gene SEQ ID No. 1: 1. Promoter P1 gene SEQ ID No.2: ggtgccggcgggcgtgacggccgggagccgagggcgccgacgggcccggggcgggccggggtggcgcggatcacgctctcccggtgccgggcgggaatgatctggctcccgcgccggttgttgacgtacgatggaccacagcgccaccgggtgttgcacaccgggtgtgcttgtcaaatcaacat 2. Promoter P2 gene SEQ ID No.3: ggcgagttgacacctccgggggccgaccgtagtgttctccgggttgccacggatccccgaggatcccggcggccacttcccgccgctttcggcggcacccattgaagcagggtctccccgataggggatgggttccggcatgccggaattcgataccgaaaggctcgattatgagccggccggtgaatccgctaacgtaggggccgcgccggaaggcgcagcggaaaccctctccaacgggggccggatacggaatgcggaccgggaaatcggttcggaaagtgtctggtagggttggaaacaccgaagggaagcgcccggagggcccggagacggggccgaaggaagcgtccgttccttgagaactcaacagcgtgccaaaagtcaacgccagatatgttgataccccgtccgggcggcaactcttgtgtgctgccgggatgaggttcctttgaagcaagtcctcccgtgccaccgattgtggtggcggtcgggaggcaattttacagcgaggacgctgtgcgcggcctggattattcctccgggctgcgccgctcttgcgtgaagcattc 3. Promoter P4.1 gene SEQ ID No.4: gggcggtgcgccggaccggccggacccttctccgccggtccggaaaatctcctgtggccgttgtagacattcgagggcaggggagttaacgtttcttgtgtaaccgaaggcggagtcaagtcaacgggacgcggcagcgacgaccgcgtgagcaggacggcacggtggtgcggtggttggggccggcagtgggaaaggggccccggcgccggcggccgggccgggcggctccaggagccgccggagcagtatcaccacgttgatcaccggaagagaggagcacatcaccatcgggatcgcccgggcggcgcccccctcgccaccccgggtacggcaaggccaggaaaggcaaggtggtcctcggtcacgcattcaaagatccccgtatccccggcctccggccggcgtacggaacgagtgagaccggcgcagtgagccggtagatggtgttgtatccctcggggctccggtgccagcacggcaccggagcccctcgacgcgcgttcacaaggacagggctcagagacagaggtgcag Promoter P4.2 gene SEQ ID No.5: ccgctctcctcccgctctcgccgccttgactgccttacagtataaggctaacgtgccttacatcgtaaggttgatgtttcggcggaagggccgcgcc Promoter P6 gene SEQ ID No.6: cggcgcccctcggattacgtccatcacgcggcggcgggtaggctgggccgacgtaggtagtgtgggctcggacgccccgcaccgagtgatgcgaagtaagcgagggtagtc Promoter P7 gene SEQ ID No.7: ggccgctgcggcaccgaatggcgccgccgggcggcggggcggcggcgggtgccccgccgcccggcgggagcgccggtgccgggtccgtaccgctggacggcgcgggccgggaacgcagacgacccgcgagcctcttccccccgcgccgggccaacggctcggcggcaagggggccggtcggacgtaccggcggctcgcgggtcgggtgactgctgggaattgggccggctgcacgcatctctcacgtgctggtccggcggtgcgcagagcgcgacgacggactgctagcccgcagtcacctcacgcgtccggatttctgacatctgccgaaccacctcccttctcgtgtgctgcgagggtaggcggacgacccgccgggactcaacgctttttcgggggacttctccggacagggcgggcggccgggttccccgcccgccgtccgagtgtgtcccccctcccaactgcctgccggttcacggctgttgcggcccgctcccggccccggtcgtcgccccgggccaccgatttccgggaacacggtgtgggctccatcacgttcgagttcaatgaaacgggattacggattacggagtacgtacagcgctacgcagccacgtcgtctggaggtgccag Promoter P9 gene SEQ ID No.8: ggccgctgcggcaccgaatggcgccgccgggcggcggggcggcggcgggtgccccgccgcccggcgggagcgccggtgccgggtccgtaccgctggacggcgcgggccgggaacgcagacgacccgcgagcctcttccccccgcgccgggccaacggctcggcggcaagggggccggtcggacgtaccggcggctcgcgggtcgggtgactgctgggaattgggccggctgcacgcatctctcacgtgctggtccggcggtgcgcagagcgcgacgacggactgctagcccgcagtcacctcacgcgtccggatttctgacatctgccgaaccacctcccttctcgtgtgctgcgagggtaggcggacgacccgccgggactcaacgctttttcgggggacttctccggacagggcgggcggccgggttccccgcccgccgtccgagtgtgtcccccctcccaactgcctgccggttcacggctgttgcggcccgctcccggccccggtcgtcgccccgggccaccgatttccgggaacacggtgtgggctccatcacgttcgagttcaatgaaacgggattacggattacggagtacgtacagcgctacgcagccacgtcgtctggaggtgccag Promoter P10 gene SEQ ID No.9: ggtgccggcgggcgtgacggccgggagccgagggcgccgacgggcccggggcgggccggggtggcgcggatcacgctctcccggtgccgggcgggaatgatctggctcccgcgccggttgttgacgtacgatggaccacagcgccaccgggtgttgcacaccgggtgtgcttgtcaaatcaacat Promoter P11 gene SEQ ID No.10: gctcgttccccttcctgaaaccagctcacagtcagccgacggcccctgataggcagcgtcaccggcatcgaacagattgcttccaggccattatcccgcatcgcgggacccgatgaccaacatcggtctgcatcgcttgcacaacgggcttccgcaaatactgacaattggcccatgcggctgccatactccgccgccgcccggcctccccggccgatccaccaccttgacgcaggtcacatgtccgccgccgtccgtctccgtcatgctgtgatccgaccgcccaccaccattcccaccagccctgacggaggtagccggcg Promoter P12 gene SEQ ID No.11: Accccgcacaggggatatccgggggaacggccgcggcggcgcggagggggagccgccgcggccgccgcgtctcatggattctttgcggaatggtctctttctttggtcatccttcgtaagatttcggccaagaccacagaatttccgtcacggcctccatagattcgggcaagaaacgcgttgccaccctggaatgaggagaagaa Promoter P13 gene SEQ ID No.12: gccgccggaccgggcggtccggaagcggatcacccggtggacccaccctgcgtcaccgcgattgccccctccgtcaaagaagcggagggggtaattccgcgtcgttgagcgcggtacagttggttcgatccctttccggcatccgccgaccgcagacgagaacgcgacaacctgtgtccgaaggacgagggcgatttgtcgcgaaggtccgtcatgcccggtccgggttgccccggattctccgggaatcccccggaatcccccttccggccgcggctgaattctcgtccgattgacctgttgcagagggcagttgggcagatacattcggccgcggtcgacgcgttccggcgcacacttcccggtggtccccccatgccgacggccaagggaccgctgggtcgtgaggtctgacccgggtccgcggagtgcggtcctgcgcaagggccagtaataggggagttagga Promoter P16 gene SEQ ID No.13: tcctctctcggtcggggagtcgggggtgccgcctgccagttgacccgctctgacctgcataaaggacggagttgagtggcaggttgtcaagttttctcgtgcggtgtatataagaagtgtgtagggcatcgcaagcagtgccacatggagggagatgacccgtg Promoter P17 gene SEQ ID No.14: 14. Promoter P18 gene SEQ ID No.15: cgcggacgacggtggagcggtagtgtacgcctttgaccacagggcggaccgttactgcaagctgaatcaggagaagcactgggtgacatctcctgccagatgtgacaaaccgggccatggtgggtacaacaaggggcggcacgacgggcgacgcatgtcccgcaacgggaatctttaccgccgaccggacgttgaccggatgacgacgacagcgacacctgtcctgtgggcgacaagcccgggaggcacaattc 15. Promoter P19 gene SEQ ID No.16: gctccggcgcacccccgttccgggaaatccgccgaccgggtggcgaggggagaaaagggggcggcaggattcccccgaatccggaaaactaaccggaatgcggccgtgtgtacgggaacctcaggggcacaagcttccatggaggttgataaac 16. Promoter P20 gene SEQ ID No.17: gccgccggcccgtgatacggcggccgccggcggaatggtccggagatcaccgtgagagaacggcgatgacctggtggttgccaagaacgcgccgccgtgcaaggctgcggccataaggatgatctccgccccccgcgggccttccggagagagcagcgccgcatgtcagagcggcgcgcccccgggacgcccggcgatacggggtgtgatcgtgttgaccgtcaaaccatttggtgagacgctggaatccccgcgcaccccacctgttcagcaccgggaatgacggtggtggcaggcaccgcgggtgcgactagctcacgacccacaccgcatcggtcggtcactcagtgtggaggaccatccatc 17. Promoter P23 gene SEQ ID No.18: cgccgaccgccttccctttcggagctcaccggacgccgctcacgctatgggcttggagtgcactcgaagcaagcgggtgcgggattcgtttccagccattccgggcgtgccccgtccgcgtacccgcacggcccccgcccacccgggccgcgccccgtcaccacccttgcccgtgttccgctcccccggctgacccggccggacgcatgaggcgcccggcggccggttaggctcccggcc 18. Promoter P24 gene SEQ ID No.19: ggccaacagcctacccagccaaatgagatgacttcttaggagttcgagcaacgcggcttcacgagtttcggatgcctgggagtcaaggtcgtcacggatcgctggtagctgctgctgtctgccatcgtggatgtcaggcgtggatgtcaggctggccgaggcacgatgttcaccgctcggtagtcgtatccgtcttgcttgaagccaggggcttgccactggaggtctacccgttgtcccggcgacagcgtgcggaacccttccatctggatgtgggagtaatggctccaacaaccgccgggtgtctccggggagtcgagtacgccccacccttcctcgtcgcgccactcacggacagtcgcagtcaccatgggcggaactgtacgggatcccactgtggcggcagcccgtcgacgcttgccgggacttaaggaaaaccttaaggttggtcttg 19. Promoter P25 gene SEQ ID No.20: cggggggcgtcccctcggggaacacccgcacgaccggcggcggatgtccacccacaggagtagccggagggcccggccgtcatcctgcgggaggcccggaatcgatacgaggggctgacgaccgggcacggccgcgcctctaatgttgaagtcaagcggcgggcggacgcactcgtcccccgaggtcacacgcccgccgctccaaacatgacaggagcggggcg Promoter P26 gene SEQ ID No.21: cgccgcacgcgggagcgtctaacgtagcccgagccgcttgagacgggcagggctgcgggacggcggagagccggacctgcggaagcccctcagcgacatcaccactacgacgagatccccgctcggggtttctcggtgatgccggaaattctggaattggctcgattatgagccggccggtaaatccgctaacgtaggggccgcgccggaaggcgcagcggaaaccctctccaacggggaccggaaacggaatgcggatcgggaaatcggttcgggaagtgtctggtagggttggaaacaccgaagggaagcgcccggagggcccggagacggggccgaaggaagcgtccgttccttgagaactcaacagcgtgccaaaagtcaacgccagatatgttgataccccgtccgggcggcaactcttgtgtgctgccgggatgaggttcctttgaaacaagtcctcccgtgccaccgattgtggtggcggtcgggaggcgattttacagcgaggacgctgtgcgcggcctggattattcctccgggctgcgccgctcttgcgtgaagcattc [[ID=⑧]]Promoter P28 gene SEQ ID No.22: It should be noted that there is a small error in the original text where "21.启动子P28基因" is written as "21.启动子P28基因" in Chinese. I have translated it as "Promoter P28 gene" in English according to the correct content. Also, the symbol "⑧" in the original text seems to be an incorrect character, and I have translated it as "Promoter P28 gene" based on the context. If this is not what you intended, please provide more accurate information.ctcggctctctcatcgggctggtgcgggaaggcatcccggtgcggggagacatcctgctgcgggaaggaatcctggtgcgggaaggcaacgactgcgggacgcgggagaaaggggaatcggcgggaatttccgccgcgcggcggggacggtgccggagaacaacggcggggaaacagcccgcggtccgtgacgccaacggaaactatggtccgcttcctccgtccgcaaggcggaacctgacatagtccccgcccacgcggaaatcccgcacggcggcccgccggccgccgcaccggacctgacatagcctcgccggaccgctccggtgcggccaccccgttggtgttgggtgatgaggtaccggatcagaggagaaagcaccatgccccgcccctcggccagcgaaccgcgcgggaccacccgttcggcgaccgcgctggcgcgccgccgtggaccgggccgtaactcccctgcgccatcgaatacttcgcccctcgaatccctcaccgggcgagttccaggaccgcccctcgctctcgccataccggagaacgaacccgaacggcacggcggaaagcccgtccgcaatgcccgggacattcctgtgacccgacaacacggtttgccgacacggttcgccgcaacgcttgttggcaggctcaccggcacggcccgctgacacagctcggtgacacggcagcctgacgggaaaccgccgaagcctctggagtcctcgcacattccggagagaacaggtgtcttccgcgctgcggcgcgcggtgcaatccaactgtggctacggagacctc Promoter P30 gene SEQ ID No.23: ggtgggccgcggcgctcatccgaacgccgtatctccctgctgaaaaaggagagttc Promoter P31 gene SEQ ID No.24: gccgtgctccggccggtgcgggaccgggggcggaatcccgatgagttccgcacggtccggccgtctgtcctcctgtgaagcctgcgacaggaggacgccg Promoter P32 gene SEQ ID No.25: ccggccggcggaccggcaccacgacatcgaggcgaccgcaccgaacacccccagggggaaagct Promoter P34 gene SEQ ID No.26: ggccgtgccgcccccggcggagcactgcacgggcgggcccccggacgccggccccgggccccagacctggactccggccccgaaccccggtgcccggtccggtagcggccccggccacccctacgggtggctgcgcctccggtggtacggaacccggccggtggaggagcgttctcctcccctgggactacccgaagttgatgccgccggttgacgccccgccccgttctctttgatgtgatgggagtacgaacgcggcggactcgggagacaatggaccgggtgggcagcgccccgaccggccgggaagcccggacggcggggcccgaaggtgttacgcgaaccgccgccgaccacggaggtagggcac Promoter P35 gene SEQ ID No.27: cgccagatcatcgcaagaagaggggccctctggtcatgaacaccgggacggcgttagcgtggggtctgcctttgcacacgcgggagctcggagcaccgggctgagagggcgctgacctccgtacacggggtggccgggaccggccgtaccgtcgcggaagccgctgcgccgaccgccgaacctggtaccgggtaatgccggcgtagggagtaggtctc Promoter P37 gene SEQ ID No.28: cgccagatcatcgcaagaagaggggccctctggtcatgaacaccgggacggcgttagcgtggggtctgcctttgcacacgcgggagctcggagcaccgggctgagagggcgctgacctccgtacacggggtggccgggaccggccgtaccgtcgcggaagccgctgcgccgaccgccgaacctggtaccgggtaatgccggcgtagggagtaggtctc Promoter P-38 gene SEQ ID No.29: tccccggcacgggcaccgggcccgggcacgcggaaggggcgggccc Promoter P-39 gene SEQ ID No.30: gaggtctccgtagccacagttggattgcaccgcgcgccgcagcgcggaagacacctgttctctccggaatgtgcgaggactccagaggcttcggcggtttcccgtcaggctgccgtgtcaccgagctgtgtcagcgggccgtgccggtgagcctgccaacaagcgttgcggcgaaccgtgtcggcaaaccgtgttgtcgggtcacaggaatgtcccgggcattgcggacgggctttccgccgtgccgttcgggttcgttctccggtatggcgagagcgaggggcggtcctggaactcgcccggtgagggattcgaggggcgaagtattcgatggcgcaggggagttacggcccggtccacggcggcgcgccagcgcggtcgccgaacgggtggtcccgcgcggttcgctggccgaggggcggggcatggtgctttctcctctgatccggtacctcatcacccaacaccaacggggtggccgcaccggagcggtccggcgaggctatgtcaggtccggtgcggcggccggcgggccgccgtgcgggatttccgcgtgggcggggactatgtcaggttccgccttgcggacggaggaagcggaccatagtttccgttggcgtcacggaccgcgggctgtttccccgccgttgttctccggcaccgtccccgccgcgcggcggaaattcccgccgattcccctttctcccgcgtcccgcagtcgttgccttcccgcaccaggattccttcccgcagcaggatgtctccccgcaccgggatgccttcccgcaccagcccgatgagagagccgag Promoter P41 gene SEQ ID No.31: gggtcccgggggcggtaccggccggacgccggtgccgcccccgggggtgggagccgccgttccgggcggcgggccggtgaacggcccgcacggccccgcgggcaccgggacgaaagtgatcaacggcaggtctcccggccctccgtaccgggaccgatgggccctgggtccggcggagcccccggcagaagactggggttgtcgggaagagcaacgagggagtggtcgga Promoter P44 gene SEQ ID No.32: ctaaggagcacttctcacccggttctgccgggtcaggggccagaacaccggcgagtgtccggtgctggttgctcatgggtggaacgttgactattcggcacggccggttggccggtcaccagtactgctcttcggggcgtggaacgtgatcgggtaacgggtcgggccgggcgcgctgttgggtgtctgagggtacgggctgtgaagcttgtgtccttcggttgccggtcccggtgtactcaccccttgggggtggggtggcgggtggctggtcgttgtttgagaactgcacagtggacgcgagcatctgtggc Promoter P45 gene SEQ ID No.33: ggtggggcctcttccttggtgaggacgtacctccacggtcgcccggaacaccggcgcccgacaggtccctgtcgtccccgcgcgggggaccgatcggccccaagggtccccgccgtcccggcggtcccggccgggacccggcccggggtcccggtcgtaccccggttttggagccccatcggcctgccgcggcgggaccttcgggacctgtggacggccccgtcggtgcggaagtctgatggacgaggggcggcaaccagcccccgggacacggccccaccggaccgagccccgcgatccgcaatggtcacgcgaccccacgacggaggctcaccgca Promoter P46 gene SEQ ID No.34: aggggctcctcggacctgcgagagcggtaattactaagcggtaacttaatcagtattcctgagattacccaggatcgaggaccgcttgaaggcggctggccggtgatctgtgtcgctcaccgggcctccgggcgccctccggcgcgccctcccgcgcatcccggcgggctcccgaggtacgcggaagtatggcctccggccggcgccggtgtcatggcgcgcggcgtcgtgggtgccgggaatgccgaggatgtccggggtggggggcctcggggtgcctccgcggcggccgtgcggaggccgtgcggagtccgtgcggtgcgtgacagaggctcccgcacaagacttgagccggggcggctcagctcctttgacagaaccgcacgggtccggcacccttgagtcagttccactcaagtcagctggaggaatcaacc Promoter P47 gene SEQ ID No.35: ggtgtccactcccctggggctgcctcggcttctctccagcatccggcggtaccgggacggccgcaggggctggtgggggcacggcggcagggccgttcggccccggtgcgccgccgccggccgggccccccggaacccgtccgggtaccggcgccgcgagcagggccgaacggcctccccgggcccgggccgctcggtccccgaaccgcccccgggcaggggccgtacggcgtgcccggggactcccgtcggccctgtccggggggagggcccgggccggaggatggacaccgatgagaggcgcccgcagggacaccccccgaagcggcgccgcgaagacatgcggaggcagtg Promoter P48 gene SEQ ID No.36: ccggccggcggagcacacccggccgtctccggcccggccgcggccgggccggaagccatccgccgcccacccggtaccgacccctcaagcccttcaagcccttcgacccgtccgatcagtcagtccggcggtcctccacgaccggtccggaatcgcccccacacgagtcaggaagcacacc Promoter P49 gene SEQ ID No.37: tgcggtgagcctccgtcgtggggtcgcgtgaccattgcggatcgcggggctcggtccggtggggccgtgtcccgggggctggttgccgcccctcgtccatcagacttccgcaccgacggggccgtccacaggtcccgaaggtcccgccgcggcaggccgatggggctccaaaaccggggtacgaccgggaccccgggccgggtcccggccgggaccgccgggacggcggggacccttggggccgatcggtcccccgcgcggggacgacagggacctgtcgggcgccggtgttccgggcgaccgtggaggtacgtcctcaccaaggaagaggccccacc Promoter P50 gene SEQ ID No.38: gccgggagcaactgagcggacccgtatgggttacgcagagttggcaaacgggtacgcaacgtggtagcgacgggggcgtacgaggcgtccgaggggacgcaatggtgttcgcccgtagctgagcgacgggggtcgcgccgcatggactgtcggtccccgggggtaagacttgccttgtggggagggacggagcgcggttgtcgcgggcccggggcgccacccggcgttcgccatcggcgtactgccgaggtggatagatgcctggcctgcgggaacatcgtctcgcaccatcgggttggagctgttgtcggctgtccggggcaggagacttgtgggagtaagtccccgtaaccagcgggggagaccggacgggtgtcggcagatggaatgagctgtcccctgttgcgggactagcatgcggaaggacagggaggggaccgtccccgatctgcccgaccgctctgaggagcgattaacg 38. Plasmid pSET152-P1-idgS SEQ ID No.39:

Claims

1. A method for producing tylosin A, characterized in that: By overexpressing the tylF gene using the P39 promoter, tylosin C in Streptomyces freundii strains was converted into tylosin A, resulting in high yield and high purity of tylosin A. The promoter P39 sequence is shown in SEQ ID No. 30.

Images