Application of rose SVP transcription factors in regulating flowering time and petal size

By reducing the expression of SVP transcription factors in roses, and using VIGS and CRISPR/Cas9 technologies, the problem of regulating rose petal size and flowering time was solved, resulting in smaller petals and earlier flowering time. This provides a new method for improving rose flower shape and significantly shortens the breeding cycle.

CN122081390BActive Publication Date: 2026-07-03CHINA AGRI UNIV SANYA RES INST

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA AGRI UNIV SANYA RES INST
Filing Date
2026-04-24
Publication Date
2026-07-03

AI Technical Summary

Technical Problem

The size of rose petals and the control of flowering period are difficult to intervene in precisely. Traditional breeding cycles are long and inefficient. Existing technologies lack direct gene function verification methods, and the genetic transformation system is immature, making it difficult to improve flower shape.

Method used

By utilizing rose SVP transcription factors, through VIGS transient silencing, RNA interference, or CRISPR/Cas9 gene editing technologies, the expression of SVP transcription factors in plants can be reduced, resulting in smaller petal area, smaller flower diameter, and earlier flowering period.

Benefits of technology

It enables precise control over the size of rose petals and flowering period, significantly shortens the breeding cycle, provides a method for targeted improvement of large-flowered rose varieties, and improves the consistency of flower organ morphology.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122081390B_ABST
    Figure CN122081390B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of plant genetic engineering technology, specifically relating to the application of rose SVP transcription factors in regulating flowering time and petal size. This invention aims to provide a new option for regulating rose flower organs by studying SVP, a member of the MADS-box transcription factor family in roses. The technical solution of this invention is the application of rose SVP transcription factors in regulating plant flowering time and / or petal size, and the amino acid sequence of the SVP transcription factor is shown in SEQ ID NO.2. Using the method of this invention, precise intervention in rose petal size and flowering time can be achieved through RhSVP silencing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the application of rose SVP transcription factors in regulating flowering period and petal size. Background Technology

[0002] Rose ( Rosa hybrida As a pillar species in the global cut flower industry, the flower organ traits of roses, especially petal size, directly determine the commercial value and ornamental quality of varieties. However, the complex genetic background and prominent polyploid characteristics of roses have led to a long-term reliance on traditional hybridization breeding for flower shape improvement. This method is time-consuming, inefficient, and makes precise intervention in the quantitative trait of petal size difficult. Traditional hybridization breeding requires multiple generations of screening and trait stabilization, and cultivating a new variety with a large flower shape typically takes 8-12 years, making it difficult to quickly respond to market demands. Petal size is a quantitative trait, regulated by multiple genes, and severe segregation of representative types after hybridization makes targeted improvement difficult. Methods such as radiation mutagenesis and chemical mutagenesis are highly random, with low frequencies of beneficial mutations, and are often accompanied by the chain introduction of undesirable traits. Existing research on rose flower organ development mainly focuses on expression profiling and homologous gene comparison, lacking direct gene function verification experiments (such as gene silencing and overexpression). Although virus-induced gene silencing (VIGS) technology has achieved rapid trait improvement in some horticultural plants, there has been no industrial breakthrough in the functional analysis and precise regulation of key genes in rose flower organ development. As a woody plant, the rose's genetic transformation system is immature, making it difficult to obtain stable transgenic materials and hindering research on gene function. Most existing large-flowered rose varieties are the result of natural mutations or polyploid breeding, with complex genetic backgrounds that make it difficult to analyze single-gene effects. SVP (Short Vegetative Phase), a member of the MADS-box transcription factor family, plays multiple regulatory roles in plant growth and development. Besides its classic function as a flowering inhibitor, recent studies have revealed that SVP homologs have conserved regulatory effects on floral organ size. In Arabidopsis, the SVP loss-of-function mutant svp-41 not only flowers earlier but also exhibits significant changes in the size of its petals, stamens, and other floral organs. More direct evidence comes from Isatis indigotica (…). Isatis indigotica Studies have shown that heterologous expression of IiSVP significantly reduces the size of petals, stamens, and pistils in transgenic Arabidopsis thaliana, with some transgenic plants even having their petals enclosed by sepals, exhibiting significant phenotypic variation. In pecans (…),… Carya cathayensisIn *Rose*, overexpression of CcSVP resulted in petal loss or elongation, and short, sparse stamens, further confirming the regulatory function of SVP in floral organ morphogenesis. In *Lilium × formolongi*, silencing of LfSVP not only led to early flowering but also caused floral organ defects; protein-protein interaction experiments showed that LfSVP can form a complex with the floral organ characteristic determinant LfAP1, jointly regulating floral organ differentiation. ChIP-seq analysis showed that SVP directly regulates multiple flower development-related pathways during reproductive development, forming a regulatory network with proteins such as AP1 to control the precise development of floral organs. However, the function of SVP homologs in the regulation of rose floral organ size has not yet been reported. Summary of the Invention

[0003] This invention aims to provide a new option for regulating rose flower organs by studying SVP, a member of the MADS-box transcription factor family in roses.

[0004] The technical solution of the present invention is the application of rose SVP transcription factor in regulating the flowering period and / or petal size of plants, and the amino acid sequence of the SVP transcription factor is shown in SEQ ID NO.2.

[0005] Furthermore, the coding sequence of the SVP transcription factor is shown in SEQ ID NO.1.

[0006] Specifically, the application involves reducing petal area, flower diameter, and / or advancing flowering time by decreasing the expression of rose SVP transcription factors in plants.

[0007] Furthermore, the methods for reducing the expression of rose SVP transcription factors in plants include transient VIGS silencing, RNA interference, or CRISPR / Cas9 gene editing.

[0008] The plant in question is a member of the Rosaceae family.

[0009] Specifically, the Rosaceae plants mentioned are roses, rose bushes, or wild roses.

[0010] The present invention also provides a method for creating rose varieties with small petal area, small flower diameter and / or earlier flowering time, which is achieved by reducing the expression of rose SVP transcription factors.

[0011] Specifically, the methods for reducing the expression of rose SVP transcription factors include transient VIGS silencing, RNA interference, or CRISPR / Cas9 gene editing.

[0012] More specifically, the aforementioned method includes the following steps: constructing a VIGS transient silencing recombination vector; genetic transformation to obtain transformants.

[0013] The genetic transformation process is as follows: the VIGS transient silencing recombinant vector is transferred into Agrobacterium, rose tissue culture seedlings are vacuum-infected, cultured for one month, and positive transformants are screened out.

[0014] Specifically, when vacuum-infecting rose tissue culture seedlings, the vacuum level is 0.8 atmospheres, maintained for 5 minutes, and repeated 3 times.

[0015] Specifically, the post-infection culture conditions were: 3 days in darkness at 4℃, followed by transplanting to a nutrient soil:vermiculite = 2:1 substrate, 16h / 8h light exposure, 22±1℃ temperature, and 40-60% humidity. The beneficial effects of this invention are: This invention provides the application of RhSVP transcription factors in regulating flowering time and petal size in roses. RhSVP-silenced plants showed reduced petal area, smaller flower diameter, and improved uniformity of floral organ morphology, confirming that RhSVP acts as a negative regulator of petal size in roses; it can also advance the flowering period. This result not only provides key functional evidence for the study of floral organ development in Rosaceae woody plants but also opens up an operable molecular target for the targeted improvement of small-flowered rose varieties. This invention provides a new molecular target for the targeted improvement of rose flower type. Using the method of this invention, precise intervention in rose petal size and flowering time can be achieved through RhSVP silencing, significantly shortening the cycle compared to traditional breeding methods, and providing core technical support for the targeted improvement of large-flowered rose varieties. This invention not only provides core technical support for the targeted improvement of large-flowered rose varieties, but also opens up new technical paths for the improvement of floral organ traits of other Rosaceae woody flowers, which has important theoretical significance and application value. Attached Figure Description

[0016] Figure 1 For TRV2- RhSVP Carrier map.

[0017] Figure 2 Silence for VIGS RhSVP Post-flowering time statistics for roses. A. RT-PCR silencing efficiency. B. qRT-PCR silencing efficiency. C. Bar chart of flowering time in days. D. Phenotypic chart of flowering period. E. Bar chart of plant height at flower bud emergence. F. Bar chart of leaf number at flower bud emergence. G. Bar chart of number of three-leaflets at flower bud emergence. H. Bar chart of number of five-leaflets at flower bud emergence. Figure 3 Silence for VIGS RhSVP Statistics on the phenotype and number of floral organs of the rose. A represents the petal phenotype; B represents the area of ​​the outermost petal; C represents the total area of ​​the petals; D represents the number of deformed petals; E represents the number of normal petals. Detailed Implementation

[0018] To further illustrate the technical means and effects of the present invention in achieving its intended purpose, the following detailed description of the specific implementation methods, structures, features, and effects of the present invention, in conjunction with the accompanying drawings and preferred embodiments, is provided below.

[0019] Example 1: Construction of VIGS silencing vector

[0020] 1. Rose SVP Cloning of CDS sequences

[0021] "Samantha" was extracted using the FastPure Plant Total RNA Isolation Kit (Polysaccharides & Polyphenolics – Rich (Vazyme™)). Rosa hybrida Total RNA from the 'Samantha' rose was extracted and reverse transcribed using HiScript III All-in-one RT SuperMix Perfect for qPCR (Vazyme™) to obtain total cDNA. Primers (F, SEQ ID NO.4: ATGGCTCGGGAGAAGATTCA; R, SEQ ID NO.5: TCAACCAGAATAAGGTAGC) were designed based on the homologous gene RchiOBHmChr7g0236801 in the 'Samantha' genome (https: / / lipm-browsers.toulouse.inra.fr / pub / RchiOBHm-V2 / ). The PCR product was cloned into the pMD18-T vector (Takara) and sequenced for correction. RhSVP The CDS sequence of the gene is shown in SEQ ID NO.1.

[0022] SEQ ID NO.1 RhSV P gene CDS sequence:

[0023] ATGGCTCGGGAGAAGATTCAGATCAAGAAGATTGACAACGCCACAGCGAGGCAGGTGACGTTTTCAAAGAGAAGAAGAGGGCTTTTGAAGAAGGCCGAGGAGCTCTCAGTTCTCTGTGATGCAGATATTGCTCTTATTATCTTCTCTTCTACCGGAAAGCTCTTTGAATATGCTAGCTCAAGCATGAAGGAAATCTTAGAAAGGCACCGCTTGCACTCCAAAAATCTTGGCAAACTAGAACAGCCCTCTCTTGAGTTACAGCTAGTGGAGAACAGCAACTACTCCAGGTTGAGCAAGGAAATAGCAGCAAAAAGCCATCAACTTAGGCAGATGAGGGGAGAAGAACTTCATGGATTAAAATTGGAAGAACTGCAACAGCTGGAGAACTCACTTGAATCTGGATTGGGCCGCGTGATTGAGAAAAAGGGTGAAAAGATTATGACAGAGATCACTGAGCTTCAGAAAAATGCCGTCCAGTTGATTGAGGAGAATGAACGCTTAAGACAGCAAGTGGTGGAAAGAACTGATGGCAGACGGAGGCATGTTCATGCTGATTCAGAGAACAGAATTACGGAGGAGGGCCAGTCATCAGAGTCCGTAACCAATCTCTGTAACTCTAATAATGCTCCTCAAGACTATGACAGCTCAGATACGTCTCTCAAGTTAGGGCTACCTTATTCTGGTTGA。

[0024] SEQ ID NO.2 Amino acid sequence of RhSVP protein:

[0025] MAREKIQIKKIDNATARQVTFSKRRRGLLKKAEELSVLCDADIALIIFSSTGKLFEYASSSMKEILERHRLHSKNLGKLEQPSLELQLVENSNYSRLSKEIAAKSHQLRQMRGEELHGLKLEELQQLENSLESGLGRVIEKKGEKIMTEITELQKNAVQLIEENERLRQQVVERTDGRRRHVHADSENRITEEGQSSESVTNLCNSNNAPQDYDSSDTSLKLGLPYSG。

[0026] 2. Extraction of rose genomic DNA

[0027] Genomic DNA was extracted from the rose 'Samantha' using the CTAB method. Rose leaves were broken and added to preheated extraction buffer (65°C), then rapidly vortexed to mix. The sample was incubated in a 65°C water bath for 30 min, inverted every 10 min. Extraction was then performed using a chloroform / isoamyl alcohol (24:1) solution. The mixture was centrifuged at 12000 rpm for 30 min at room temperature. The supernatant was transferred to a new 2 mL centrifuge tube, and two volumes of anhydrous ethanol were added. The tube was then incubated at -20°C for at least 2 h to allow precipitation. After precipitation, the tube was centrifuged at 12000 rpm for 30 min at room temperature, the supernatant was discarded, and the sample was washed with pre-cooled 75% ethanol and centrifuged at 12000 rpm for 15 min at room temperature. The supernatant was discarded. After the ethanol in the centrifuge tube had evaporated, 50 μL of ddH2O was added to dissolve the precipitate, yielding the rose DNA solution.

[0028] 3. Constructing the TRV2-SVP plasmid

[0029] Based on the sequence of SEQ ID NO.1, a related VIGS vector was designed to construct homologous recombination primers; using the DNA of the rose 'Samantha' as a template, the target fragment was amplified using 2×Taq mix with high-fidelity enzyme. RhSVP Insert the fragment sequence into the TRV2 vector. Colony PCR reaction system: 25 μL 2 × Taq Master Mix (Vazyme™), 2 μL each of F / R primers, 2 μL DNA template, and up to 50 μL ddH2O. PCR program: 95℃ for 4 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 45 s, 35 cycles; 72℃ for 5 min; 4℃ for 10 min. After recovering the target band and determining its concentration, ligate it into the TRV2 vector using homologous recombination and transform it into *E. coli* DH5α.

[0030] Homologous recombination primers for VIGS vector construction: TTACCGAATTCTCTAGACTTTTCTCACATAT (SEQ ID NO. 6); AGACGCGTGAGCTCGGTACCTTCTAAGATT (SEQ ID NO. 7).

[0031] SEQ ID NO.3, RhSVP Fragment sequence inserted into the TRV2 vector:

[0032] CTTTTCTCACATATAACAACAACTTCCTTGCCTTTTTCTGGTTAGTATTCGTTGATTATACGCTGGTTTTCCCTGACCGAGATAACCCAAAATTTCCAAAAAAAGGTAGATAGTTCACATATGCATCATTATTCTCATCATATTGGATTTGTTCTTTCCAGAAGAAGAAAAAGTGGGAGAACTCATCAAGAATTTGAGTG ATGGCTCGGGAGAAGATTCAGATCAAGAAGATTGACAACGCCACAGCGAGGCAGGTGACGTTTTCAAAGAGAAGAAGAGGGCTTTTGAAGAAGGCCGAGGAGCTCTCAGTTCTCTGTGATGCAGATATTGCTCTTATTATCTTCTCTTCTACCGGAAAGCTCTTTGAATATGCTAGCTCAAGCATGAAGGAAATCTTAGAA.

[0033] 4. Colony PCR detection

[0034] Single-clone colonies were labeled with serial numbers using a marker pen. A portion of the colonies was picked up using a sterilized white pipette tip as a template for PCR amplification. The colony PCR reaction system consisted of: 5 μL of 2 × Taq Master Mix (Vazyme™), 0.5 μL each of F / R primers, 1 μL of bacteria, and 8 μL of ddH₂O. The PCR program was: 95℃ for 4 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 45 s, 35 cycles; 72℃ for 5 min; 4℃ for 10 min. After PCR, the colonies were detected on a 1% agarose gel.

[0035] TRV2 detection primers: TGGGAGATGATACGCTGTT (SEQ ID NO.8); CCTAAAACTTCAGACACG (SEQ ID NO.9).

[0036] 5. Extract plasmids and detect their sequences.

[0037] Colonies with correctly identified bands were inoculated into liquid LB medium containing 50 mg / L kanamycin and incubated at 37°C for 12 h. Plasmids were then extracted. Plasmid DNA extraction was performed according to the Vazyme™ 8 min FastPure Plasmid Mini Kit instructions. The extracted plasmids were sent to Qingke Biotechnology Co., Ltd. for sequencing verification. A schematic diagram of the constructed vector structure is shown below. Figure 1 As shown.

[0038] Example 2 Genetic Transformation

[0039] Transform the correctly identified plasmid into Agrobacterium competent cells EHA105 (Daling Bio DLC303 DL-EHA105). After identifying single clones, pick a single clone and culture it in 5 mL of liquid LB medium (antibiotic type and concentration as above) for 12 hours, then add 100 μL of bacterial culture to 250 mL of liquid LB medium (antibiotic type and concentration as above) and culture for 12 hours.

[0040] TRV2 detection primers: TGGGAGATGATACGCTGTT (SEQ ID NO.8); CCTAAAACTTCAGACACG (SEQ ID NO.9).

[0041] TRV1 detection primers: TTACAGGTTATTTGGGCTAG (SEQ ID NO.10); CCGGGTTCAATTCCTTATC (SEQ ID NO.11).

[0042] TRV1 and TRV2-RhSVP bacterial suspensions were mixed at a 1:1 ratio and then vacuum-treated (0.8 atm, maintained for 5 min, repeated 3 times) to infect tissue culture seedlings of the rose 'Samantha'. The control group consisted of an empty TRV2 vector. After inoculation, the plants were planted in a substrate of nutrient soil:vermiculite = 1:1, under a light source of 16h / 8h, a temperature of 25±1℃, and a humidity of 40-60%. Phenotypic results were observed and samples were taken after 14 days. RhUBI was used as an internal control, and gene expression was detected by qRT-PCR and RT-PCR.

[0043] qRT-PCR detection primers: GAGGAGCTCTCAGTTCTCTG (SEQ ID NO.12); CCACTAGCTGTAACTCAAGAGAG (SEQ ID NO.13).

[0044] The results of qRT-PCR and RT-PCR detection showed that ( Figure 2 A and Figure 2 B), the silent group RhSVP The expression level was significantly lower than that in the control group (P<0.001). Phenotypic observation and petal area size analysis showed that the flowering time of the silent group was significantly earlier, the petals were significantly smaller, while the total number of petals, the number of stamens and pistils remained unchanged, and the number of deformed petals remained unchanged, indicating that... RhSVP Silence promotes flowering and reduces petal size, but does not affect the change in the number of floral organs. Figure 2 and Figure 3 ).

[0045] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. Use of reduced expression of Rosa chinensis SVP transcription factor in reducing petal area of Rosa chinensis, characterized in that: The amino acid sequence of the SVP transcription factor is shown in SEQ ID NO.

2.

2. Use according to claim 1, characterized in that: The coding sequence of the SVP transcription factor is shown in SEQ ID NO.

1.

3. A method of creating a rose variety with small petal area, characterized by: This is achieved by reducing the expression of the rose SVP transcription factor; the amino acid sequence of the SVP transcription factor is shown in SEQ ID NO.2.