A SNP molecular marker related to abnormal content of serum alkaline phosphatase of pig on chromosome 3 and application thereof

By discovering and applying SNP molecular markers located on chromosome 3 in Wuzhishan pigs, the genetic improvement problem of abnormal serum alkaline phosphatase content in Wuzhishan pigs was solved, enabling early and precise breeding selection, reducing the incidence of abnormal ALP content, and improving the health and economic benefits of pigs.

CN122081516BActive Publication Date: 2026-07-21SANYA RESEARCH INSTITUTE OF HAINAN ACADEMY OF AGRICULTURAL SCIENCES (HAINAN EXPERIMENTAL ANIMAL RESEARCH CENTER)
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SANYA RESEARCH INSTITUTE OF HAINAN ACADEMY OF AGRICULTURAL SCIENCES (HAINAN EXPERIMENTAL ANIMAL RESEARCH CENTER)
Filing Date
2026-04-21
Publication Date
2026-07-21

AI Technical Summary

Technical Problem

Existing technologies lack molecular markers that can be directly used for genetic improvement of serum alkaline phosphatase (ALP) content in Wuzhishan pigs, resulting in low breeding efficiency, difficulty in achieving early and precise genetic selection, and impacting the growth rate, physical condition, and economic benefits of pig farming.

Method used

To develop SNP molecular markers located on chromosome 3 that are associated with abnormal serum alkaline phosphatase levels in pigs, specifically the T/C mutation at position 53681151 bp on chromosome 3 of the International Swine Reference Genome 11.1, and to provide corresponding detection products and breeding methods by detecting the incidence of abnormal serum alkaline phosphatase levels in the TC and CC genotypes and the TT genotype, thereby screening out pigs with low incidence of abnormal serum alkaline phosphatase levels.

Benefits of technology

This study achieved early and precise genetic improvement of ALP abnormalities in Wuzhishan pigs, reduced the incidence of ALP abnormalities, improved the health and economic benefits of breeding pigs, and enhanced the scientific research value and market competitiveness of Wuzhishan pigs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122081516B_ABST
    Figure CN122081516B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of animal molecular genetics and breeding, and particularly relates to a SNP molecular marker related to abnormal content of serum alkaline phosphatase of pigs and an application thereof. The SNP molecular marker corresponds to a T / C mutation at 53681151 bp on chromosome 3 of an international pig reference genome 11.1 version, and the polymorphism of the base at the site affects the incidence of abnormal content of serum alkaline phosphatase of Wuzhishan pigs. By selecting the advantageous allele of the above mutation site, the frequency of the advantageous allele can be increased generation by generation, and the incidence of abnormal content of serum alkaline phosphatase of Wuzhishan pigs can be reduced. The application solves the genetic improvement problem of abnormal content of serum alkaline phosphatase of Wuzhishan pigs by using the method of molecular breeding, improves the commercial and scientific research value of Wuzhishan pigs, speeds up the genetic improvement progress of Wuzhishan pigs, and thus effectively improves the economic benefits of pig breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of animal molecular genetics and breeding technology, specifically relating to a SNP molecular marker located on chromosome 3 that is associated with abnormal levels of alkaline phosphatase in porcine serum and its application. Background Technology

[0002] Alkaline phosphatase (ALP) is a key enzyme indicator of serum biochemical metabolism in pigs. Its activity level directly reflects the skeletal metabolic status, hepatobiliary function, and intestinal absorption health of pigs. In pig farming and breeding practices, abnormal ALP activity (significantly elevated or decreased) may indicate skeletal development disorders, nutritional metabolic imbalances, or potential hepatobiliary diseases, directly affecting the growth rate, physical condition, and economic benefits of pig farming.

[0003] Wuzhishan pig, a rare local pig breed in my country, possesses excellent characteristics such as delicious meat and strong disease resistance. Furthermore, its small size, light weight, docile temperament, consistent phenotype, and genetic stability make it an ideal experimental animal model. In biomedical research, the stability and normality of its serum biochemical indicators are the cornerstone for constructing reliable disease models, evaluating drug effects, and conducting nutritional metabolism research.

[0004] Therefore, maintaining and breeding a stable and healthy Wuzhishan pig population with biochemical indicators is not only a requirement for healthy pig farming, but also a prerequisite for ensuring its scientific research value as a model animal.

[0005] However, the genetic regulatory mechanism of abnormal ALP activity in Wuzhishan pigs remains unclear, and the lack of molecular markers that can be directly used for breeding selection limits its application in genetic improvement. Genetic selection targeting ideal ALP activity phenotypes (such as suitable and stable activity levels) has significant practical value for developing new Wuzhishan pig breeds with robust bones, excellent liver function, and high overall health.

[0006] Currently, traditional breeding methods rely on phenotypic testing to screen individuals for target traits, which suffers from problems such as long cycles, low efficiency, and accuracy being greatly affected by the environment. Molecular marker-assisted breeding technology, by screening genetic markers closely associated with target traits, can achieve early, rapid, and precise selection, significantly accelerating the breeding process. Genome-wide association study (GWAS) refers to screening genetic markers that are significantly associated with the target trait across the entire genome. GWAS has been widely applied to the genetic improvement of important traits in livestock and poultry.

[0007] However, no SNP molecular markers related to ALP content in Wuzhishan pigs have been reported, and the lack of molecular tools that can be directly applied to breeding practices limits the efficiency of genetic improvement of ALP content in Wuzhishan pigs. Therefore, identifying SNP molecular markers that are significantly associated with ALP content in Wuzhishan pigs and developing corresponding detection technologies and breeding methods are of significant theoretical and practical value for promoting the improvement of Wuzhishan pig breeds and enhancing the economic benefits of pig farming. Summary of the Invention

[0008] To overcome the shortcomings and defects of the prior art, the primary objective of this invention is to provide a SNP molecular marker located on chromosome 3 that is associated with abnormal levels of alkaline phosphatase (ALP) in porcine serum.

[0009] Another object of the present invention is to provide applications of the above-mentioned SNP molecular markers.

[0010] Another object of the present invention is to provide an application of a product for detecting the above-mentioned SNP molecular markers.

[0011] The fourth objective of this invention is to provide a method for detecting the high or low incidence of abnormal alkaline phosphatase levels in porcine serum.

[0012] The fifth objective of this invention is to provide a method for screening pigs with a low incidence of abnormal serum alkaline phosphatase levels.

[0013] The sixth objective of this invention is to provide a method for genetic improvement of pigs.

[0014] The objective of this invention is achieved through the following technical solution:

[0015] A molecular marker of a SNP located on chromosome 3 that is associated with abnormal serum alkaline phosphatase levels in pigs has been identified. The SNP site corresponds to the T / C mutation at position 53681151 bp on chromosome 3 in the International Pig Reference Genome 11.1. The polymorphism of the base at this site affects the incidence of abnormal serum alkaline phosphatase levels in pigs. The incidence of abnormal serum alkaline phosphatase levels is higher in pigs with the TC and CC genotypes than in pigs with the TT genotype.

[0016] The preferred type of pig is the Wuzhishan pig.

[0017] The preferred nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein M in the sequence is T or C. This molecular marker affects the incidence of abnormal levels of alkaline phosphatase in porcine serum.

[0018] The SNP site of the SNP molecular marker is the single base mutation of C103-T103 at position 103 of the sequence marked in SEQ ID NO.1, named g.103 T / C (corresponding to position 53681151 bp on chromosome 3 of the International Pig Reference Genome Version 11.1).

[0019] The preferred type of pig is the Wuzhishan pig.

[0020] The application of the molecular markers includes at least one of the following (1)-(5):

[0021] (1) Identify traits related to abnormal levels of alkaline phosphatase in porcine serum;

[0022] (2) Prepare products for identifying traits related to abnormal levels of alkaline phosphatase in porcine serum;

[0023] (3) Screening pigs with a low incidence of abnormal serum alkaline phosphatase levels;

[0024] (4) Prepare products from pigs with low incidence of abnormal serum alkaline phosphatase levels;

[0025] (5) The incidence of abnormal serum alkaline phosphatase content in pigs is related to genetic breeding of related traits.

[0026] The preferred type of pig is the Wuzhishan pig.

[0027] The application of a product for detecting SNP molecular markers located on chromosome 3 that are associated with abnormal levels of alkaline phosphatase in porcine serum, said application comprising at least one of the following (1)-(5):

[0028] (1) Identify traits related to abnormal levels of alkaline phosphatase in porcine serum;

[0029] (2) Prepare products for identifying abnormalities in porcine serum alkaline phosphatase levels and related traits;

[0030] (3) Screening pigs with a low incidence of abnormal serum alkaline phosphatase levels;

[0031] (4) Prepare products from pigs with low incidence of abnormal serum alkaline phosphatase levels;

[0032] (5) The incidence of abnormal serum alkaline phosphatase content in pigs is related to genetic breeding of related traits.

[0033] The preferred type of pig is the Wuzhishan pig.

[0034] The products include reagents, reagent kits, chips, and testing equipment.

[0035] The reagent comprises primer pairs or probes, wherein the primer pairs are used to amplify nucleic acid fragments containing the above-mentioned SNP sites, and the probes are capable of specifically recognizing and binding to the nucleic acid sequences of the above-mentioned SNP sites; probes carrying different labeling groups (e.g., fluorescent groups) can be designed to correspond to different genotypes of the above-mentioned SNP sites, thereby achieving genotyping detection.

[0036] The primer pair preferably comprises primers primer-F and primer-R, and their nucleic acid sequences are as follows:

[0037] Upstream primer-F: 5'-CAGGGCCAAGTGGTGTTACC-3';

[0038] Downstream primer primer-R: 5'-TGACCTCAAAAGCTCAGGTGT-3'.

[0039] The kit preferably contains the primer pairs or probes described above, and more preferably also contains reaction buffer, etc.

[0040] The chip uses a solid-phase carrier to fix the primer pairs or probes to achieve high-throughput detection.

[0041] The aforementioned detection equipment is compatible with the detection process of the above-mentioned reagents, kits, and chips, and completes signal acquisition, genotype interpretation, and result output.

[0042] A method for detecting a high or low incidence of abnormal alkaline phosphatase levels in porcine serum, comprising the following steps:

[0043] The SNP sites of the aforementioned SNP molecular markers on pig chromosome 3 were detected, and the incidence of abnormal serum alkaline phosphatase levels in pigs was determined based on whether the single nucleotide of the SNP site was T or C. Among them, the incidence of abnormal serum alkaline phosphatase levels in pigs with TC and CC genotypes was higher than that in pigs with TT genotypes.

[0044] The preferred type of pig is the Wuzhishan pig.

[0045] A method for screening pigs with a low incidence of abnormal serum alkaline phosphatase levels includes the following steps:

[0046] The SNP sites of the above-mentioned SNP molecular markers on pig chromosome 3 were detected, and individuals with the TT genotype were selected as breeding pigs, while individuals with the TC and CC genotypes were culled. Among them, the incidence of abnormal serum alkaline phosphatase levels in pigs with the TC and CC genotypes was higher than that in pigs with the TT genotype.

[0047] The preferred type of pig is the Wuzhishan pig.

[0048] The detection method includes the following steps:

[0049] (1) Extract genomic DNA from the pigs to be tested;

[0050] (2) Using the above primer pair as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification was performed to obtain PCR amplification products;

[0051] (3) Sequencing the PCR amplification products to obtain sequencing results;

[0052] (4) Determine the genotype based on the sequencing results.

[0053] A method for genetic improvement of pigs, comprising the following steps:

[0054] The above-mentioned SNP molecular markers of breeding pigs in the core breeding pig herd were identified, and corresponding selections were made based on the molecular markers: the TT genotype individuals at chromosome 53681151 bp on chromosome 3 of the International Swine Reference Genome 11.1 were selected for successive generations, and TC and CC genotype individuals were eliminated, so as to increase the frequency of the T allele at this locus in each generation, thereby reducing the incidence of abnormal ALP content in pigs.

[0055] The preferred type of pig is the Wuzhishan pig;

[0056] The above applications or methods are for purposes other than disease treatment or diagnosis.

[0057] The present invention has the following advantages and effects compared with the prior art:

[0058] (1) Based on genome-wide association analysis and genotype filling strategy, this invention studies and identifies the SNP molecular marker associated with abnormal ALP content in Wuzhishan pigs located at 53681151 bp on chromosome 3 of the International Pig Reference Genome Version 11.1, which is a T / C mutation. The polymorphism of this mutation site is significantly associated with the incidence of abnormal ALP content in Wuzhishan pigs.

[0059] (2) Based on the above molecular markers, the present invention provides a method for identifying products (primer pairs, kits, etc.) of the above molecular markers and for genetic improvement of Wuzhishan pigs. It establishes an efficient and accurate molecular marker-assisted breeding technology and applies it to the genetic improvement of abnormal ALP content in Wuzhishan pigs, thereby reducing the incidence of abnormal ALP content in Wuzhishan pigs, increasing enterprise profits and scientific research value, and increasing core competitiveness.

[0060] (3) This invention uses molecular breeding to solve the problem of genetic improvement of abnormal ALP content in Wuzhishan pigs. By selecting the superior alleles of the above-mentioned mutations, the frequency of superior alleles can be increased generation by generation, the incidence of abnormal ALP content in Wuzhishan pigs can be reduced, and the genetic improvement of Wuzhishan pigs can be accelerated, thereby effectively improving the economic benefits of breeding pigs. Attached Figure Description

[0061] Figure 1 This is a genome-wide association study (GWAS) diagram showing abnormal ALP levels on chromosome 3 in Wuzhishan pigs; the horizontal axis represents the chromosome number of the Wuzhishan pig, and the vertical axis represents -log 10 ( P -value).

[0062] Figure 2 This is a graph showing the abnormal incidence of ALP content in different genotypes of Wuzhishan pigs (all individuals in the experimental pig population).

[0063] Figure 3 This is a box plot showing the distribution of serum ALP levels in different genotypes of Wuzhishan pigs. The box plot displays the median (horizontal line inside the box), interquartile range (box height), and beard range (extended lines above and below the box line). The scatter plot represents individual values, and the two horizontal dashed lines represent the lower limit (103.00 U / L) and upper limit (244.05 U / L) of the normal reference range, respectively. Detailed Implementation

[0064] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0065] Example 1 explains in detail the process of obtaining the reference range of normal serum alkaline phosphatase (ALP) levels in this invention.

[0066] 1. Laboratory animals and sampling

[0067] (1) Experimental pig herd: A total of 161 Wuzhishan pigs were used in this embodiment, including 33 pigs at 1 month old (post-weaning), 47 pigs at 3 months old (pre-sexual maturity), 37 pigs at 5 months old (post-sexual maturity), and 44 pigs at 12 months old (post-physical maturity). The experimental pig herd used in this embodiment was the core breeding pig herd of a certain Wuzhishan pig farm, and the herd pedigree records were detailed. In order to ensure the reliability and consistency of the experimental data, the healthy Wuzhishan pigs selected in this embodiment all met the following criteria: glossy skin, normal appetite, free movement and no respiratory abnormalities, and no obvious signs of disease.

[0068] (2) Sampling: All 3, 5, and 12-month-old sows were not pregnant at the time of sampling to rule out the potential influence of pregnancy on hematological and biochemical indicators. Before sampling, all pigs were fasted for 12 hours (with free access to water) to standardize their metabolic state; blood samples were collected between 7:00 and 10:00 AM to eliminate diurnal variations. No sedatives were used during sampling; gentle restraint was performed by trained personnel to minimize stress-induced physiological changes. During the experiment, the pigs were managed using conventional feeding and watering methods, with free access to feed and water, and feeding conditions were consistent with the environment.

[0069] (3) Determination of serum ALP levels

[0070] ① Let all blood samples from pigs collected in step (2) stand at room temperature for 2 hours, and then centrifuge at 3000 rpm for 10 minutes at 4℃ to separate serum.

[0071] ②Using a fully automated biochemical analyzer (Hitachi 3110 model) and an alkaline phosphatase assay kit (AMP buffer method) (Shanghai Kehua, catalog number: K115), strictly follow the instrument and kit instructions to determine the serum ALP content (U / L).

[0072] 2. Determination of the reference range for normal serum ALP levels

[0073] To ensure data accuracy, samples with coagulation and hemolysis were excluded. Serum samples from 161 Wuzhishan pigs were ultimately tested. After outlier removal, 98 valid samples remained. Data recording was performed using Microsoft Excel, and all statistical analyses were conducted using SPSS 27.0 for Windows, as detailed below:

[0074] ① The Shapiro-Wilk test was used to assess the normality of the distribution, and the identification of outliers was combined with the Dixon test (α=0.05) and box plots (outside 1.5 interquartile range).

[0075] ② For normally distributed traits, the results are expressed as “mean ± standard deviation (SD)”, and the reference range (RI) is calculated as mean ± 2 SD; for non-normally distributed traits, the reference range is estimated using the 2.5th and 97.5th percentiles, and the results are expressed as “median (interquartile range, IQR)”.

[0076] ③ The reliability of the reference range was evaluated by calculating a 95% confidence interval using the Bootstrap method (1000 resampling).

[0077] The Shapiro-Wilk test showed that the serum ALP content of Wuzhishan pigs exhibited a non-normal distribution, and the reference range is shown in Table 1. Table 1 indicates that the normal serum ALP content of Wuzhishan pigs ranges from 103.00 to 244.05 U / L.

[0078] Table 1. Reference range of serum alkaline phosphatase (ALP) levels in Wuzhishan pigs.

[0079]

[0080] Note: n is the sample size used to determine the reference range after excluding outliers.

[0081] Example 2 explains in detail the process of determining abnormal serum ALP levels in this invention.

[0082] 1. Laboratory animals

[0083] Experimental pig herd: This example is based on 152 Wuzhishan pig individuals with both phenotypic and genotypic data, including 30 1-month-old pigs, 47 3-month-old pigs, 35 5-month-old pigs, and 40 12-month-old pigs.

[0084] The experimental pig herd used in this invention was a core breeding herd from a pig farm in Wuzhishan, with detailed pedigree records. The pigs had free access to feed and water, and the feeding methods and rearing conditions remained consistent throughout the process, following conventional methods.

[0085] 2. Detection of serum ALP levels and determination of abnormal serum ALP levels

[0086] The serum ALP content of Wuzhishan pigs was detected and recorded according to Example 1. The serum ALP content was considered normal if it was between 103.00 and 244.05 U / L, and abnormal if it was below that range.

[0087] 3. Sample Collection

[0088] The collected pig ear-like tissue from Wuzhishan was soaked in a 75% ethanol solution and stored at -20°C for later use.

[0089] Example 3 provides a detailed explanation of the invention process of obtaining the molecular marker in this invention.

[0090] 1. Extraction of DNA from ear tissue of experimental pig herds

[0091] Genome DNA was extracted from ear tissue samples of the experimental pig population in Example 2 using the standard phenol-chloroform method. The DNA from this population was analyzed for quality and concentration using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8-2.0 and an A260 / 230 ratio of 1.7-1.9 were considered acceptable. Finally, the acceptable DNA samples were uniformly diluted to 50 ng / μL.

[0092] 2. Detection of 50K SNP genotypes in the whole pig genome

[0093] ① DNA samples were genotyped using a GeneSeek Porcine 50K SNP chip (Neogen, Lincoln, NE, United States) following standard procedures.

[0094] ② Use Plink v1.9 software to perform quality control (QC) on the genotype data obtained in step ①, with the following standards: remove individuals with a detection rate <90%, remove SNPs with a minor allele frequency (MAF) <0.05, and remove individuals that have passed the Hardy-Weinberg equilibrium (HWE) test. P Value <10 -6 SNPs were identified and removed from regions not located on the chip and from sex chromosomes.

[0095] 3. Filling in missing genotypes in pigs

[0096] Public data (https: / / doi.org / 10.1038 / s41467-023-40434-3) was used as the reference population for imputation. Beagle v5.4 software was used to impute the 50K microarray genotype data, and genotypes with MAF < 0.05 and model-based imputation accuracy (DR) were removed. 2 The variation is less than 0.75.

[0097] 4. Genome-wide association study (GWAS)

[0098] Genome-wide association analysis (GWAS) based on quantitative traits was employed. This involved detecting differences in allele and genotype frequencies between normal and abnormal individuals at each variant locus across the entire genome, thereby identifying loci in linkage disequilibrium that control the target trait. In this embodiment, GEMMA v0.98 software, jointly developed by Xiang Zhou of the University of Michigan and Matthew Stephens of the University of Chicago, was used for GWAS analysis of Wuzhishan pigs. Normal individuals were defined as those with normal serum ALP levels, while those with ALP levels exceeding the normal range were considered abnormal. In this embodiment, the serum ALP levels of 62 Wuzhishan pigs used for subsequent analysis were abnormal, while those of 90 Wuzhishan pigs were within the normal range. The specific analysis method is as follows:

[0099] ① The linear mixture model used is:

[0100] y = Wα + Xβ + u + ε

[0101] u ~MVN n (0, λτ -1 K); ε ~ MVN n (0, λτ -1 I n )

[0102] in, n =152 represents the number of individuals; y for n The phenotypic value vector of ×1 represents the individual's serum ALP content (measured value). W for n × c ( c A covariate (fixed effect) design matrix was created for the number of covariates, including the first three eigenvectors obtained from principal component analysis (calculated using GCTA v1.92.4 beta), and sex and age in months as fixed effect covariates. (The eigenvectors of the first three principal components were calculated based on genome-wide SNP genotype data (after quality control and imputation of SNP loci). The specific steps were: constructing a genome kinship matrix (GRM) using GCTA v1.92.4 beta software, performing eigenvalue decomposition on the GRM, and extracting the three eigenvectors with the largest eigenvalues ​​(i.e., principal components PC1, PC2, and PC3) to correct for the influence of population genetic stratification on the association analysis results.) α for c A fixed effects coefficient vector of ×1; X for n ×1 SNP genotype vector;β The effect value corresponding to the label; u for n A random effects vector of ×1; ε for n A random error vector of ×1; λ This represents the ratio between two variance components; τ -1 The variance represents the residuals; K To estimate using GEMMA software n × n Inter-individual genomic kinship matrix; I n for n × n identity matrix; MVN This represents a multivariate normal distribution.

[0103] ②Given the assumption that the number of independent haplotype frames is substantially the same in pigs and humans, and considering that the genomic significance threshold for human-related GWAS analyses is set at 5.00 × 10⁻⁶, -8 This invention references the human genome significance threshold, which is 5.00 × 10⁻⁶. -8 The significance threshold at the chromosome level is 1.00 × 10⁻⁶. -6 .

[0104] GWAS analysis results are as follows Figure 1 As shown. From Figure 1 It was found that in the experimental pig population, there were SNP sites on chromosome 3 that significantly affected the abnormal serum ALP content in Wuzhishan pigs. The most strongly associated SNP was g.103 T / C (the T / C mutation at position 103 in SEQ ID NO.1, corresponding to the T / C mutation at position 53681151 bp on chromosome 3 in International Pig Reference Genome Version 11.1). P =7.033856×10 -8 ).

[0105] 5. Association analysis between different genotypes and abnormal serum ALP phenotypes in Wuzhishan pigs

[0106] Table 2 shows that the SNP site g.103 T / C of the molecular marker is significantly correlated with abnormal serum ALP levels. P =7.033856×10 -8 This indicates that this molecular marker significantly affects the abnormal serum ALP content in Wuzhishan pigs. The incidence of abnormal serum ALP content in this population can be reduced by assisted selection of this variant site in Wuzhishan pigs.

[0107] Additionally, according to Table 2 and Figure 2Furthermore, it was found that the TC and CC genotypes had a higher incidence of ALP abnormalities than the TT genotype, especially the TC genotype, indicating that heterozygous TC genotypes are associated with a higher risk of abnormal serum ALP levels. Therefore, during breeding, it is necessary to gradually cull TC and CC genotype breeding pigs and select TT genotype individuals to increase the frequency of the T allele at this locus generation by generation, thereby reducing the incidence of ALP abnormalities in Wuzhishan pigs.

[0108] Combined with Table 2, Figure 2 and Figure 3 The data revealed that individuals with abnormal serum ALP levels in the TC genotype exhibited a wide distribution, with some exceeding the upper limit and others falling below the lower limit. The highest proportion (47.27%) exceeded the normal reference range. Individuals with abnormal ALP levels in the CC genotype primarily occurred below the lower limit, with an ALP abnormality rate of 37.80%. In contrast, individuals with abnormal ALP levels in the TT genotype primarily occurred above the upper limit, with an ALP abnormality rate of 33.33%. These results suggest that the TC and CC genotypes may be more prone to extreme deviations in ALP levels. Therefore, gradually phasing out the TC and CC genotypes while retaining the TT genotype during breeding could help reduce the incidence of abnormal ALP levels in the population.

[0109] Table 2. Correlation between the variant sites of molecular marker g.103 T / C and abnormal ALP content in Wuzhishan pigs.

[0110]

[0111] Example 4 Heredity Analysis

[0112] To assess the genetic basis of serum ALP levels, this example uses serum ALP levels and whole-genome SNP marker information from 152 Wuzhishan pigs with both phenotypic and genotypic data from Example 2. The heritability of SNPs was estimated using the Genomic Restricted Maximum Likelihood Method (GREML) in GCTA software. A genomic relationship matrix was constructed during the analysis, and age, sex, and batch were included as fixed effects in the model.

[0113] The results (Table 3) showed that the SNP heritability of serum ALP content was 0.241 (standard error 0.130), which is considered a trait with moderate heritability. This result indicates that ALP content is subject to a certain degree of genetic control, and this trait can be improved through genetic selection.

[0114] Table 3. Heritability analysis of serum ALP content in Wuzhishan pigs

[0115]

[0116] Example 5 explains the invention process of detecting molecular markers.

[0117] (1) The target fragment containing a mutation site that is significantly associated with abnormal ALP levels in the serum of Wuzhishan pigs is a 285 bp nucleotide sequence from chromosome 3 (SEQ ID NO.1). The upstream and downstream primers for sequence amplification are primer-F and primer-R, and their nucleic acid sequences are as follows:

[0118] Upstream primer-F: 5'-CAGGGCCAAGTGGTGTTACC-3';

[0119] Downstream primer primer-R: 5'-TGACCTCAAAAGCTCAGGTGT-3'.

[0120] (2) PCR amplification system and conditions

[0121] Prepare a 10 μL system, including 1.0 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O. The PCR reaction program is as follows: 95°C for 3 min; 94°C for 30 s, 60°C for 30 s, 72°C for 60 s, 30 cycles; 72°C for 10 min.

[0122] (3) DNA sequence sequencing identification: Sequencing was performed at BGI Genomics Co., Ltd. in Shenzhen, with two sequencing reactions for each gene fragment. The obtained sequences were compared with the NCBI genome sequence to identify the mutations at the corresponding variant sites. The sequencing results are shown below:

[0123] CAGGGCCAAGTGGTGTTACC TCTGTCACAATGCAAATGCTCCAAATGAAACAGAGAGAAGTTAATGGTAAGTAATACAGAGAAGTCTCCCAGAGTCAACCAA M(C / T) CTGTAGAAACTTGCAGGTCAAGGTCAAATCACAGCACTAATTTTAGGACAGAGATGCTGCTCTATCTCCTTTTAAGATCAAGTTCAGTCCACATGACTATACAGGCTGCTGGGGTCTGGGAGCCTGTGGCCAGGCAGGGCTCATGAACCAAGTCCATAG ACACCTGAGCTTTTGAGGTCA

[0124] Note: M marked in the sequence is the mutation site (the mutated base in parentheses is the allele mutation), and the underline at the beginning and end of the sequence indicates the primer binding position.

[0125] Example 6: Analysis of the g.103 T / C effect of variant sites of SNP molecular markers

[0126] The SNP molecular markers provided by this invention offer an efficient breeding tool for reducing the incidence of abnormal serum ALP levels in the Wuzhishan pig population. According to the data in Table 2, the frequencies of the TT, TC, and CC genotypes in the current population are approximately 9.87%, 36.18%, and 53.95%, respectively, with abnormal serum ALP levels occurring at rates of 33.33%, 47.27%, and 37.80%, respectively. After weighted calculation, the overall incidence of abnormal serum ALP levels in the current population is approximately 40.79% (62 / 152).

[0127] If a marker-assisted breeding program is implemented, for example, culling all individuals with the TC genotype (whose ALP abnormality rate is 47.27%) and retaining only TT and CC genotype individuals, the expected ALP abnormality rate in the new population can be reduced to approximately 37.11% (36 / 97, weighted according to the original ratio of TT and CC genotypes). For a Wuzhishan pig breeding farm with 1000 breeding sows, this marker-assisted selection can reduce the serum ALP abnormality rate in the core population from 40.79% to 37.11%, meaning an increase in the proportion of individuals with normal ALP levels in each batch of replacement gilts, significantly improving the quality of breeding pigs and their reliability as experimental animals. If TC and CC genotype individuals are culled and only TT genotype individuals are retained, the serum ALP abnormality rate in the core population will be even lower.

[0128] For Wuzhishan pigs, primarily used for scientific research, the stability of serum biochemical indicators is their core value. The molecular marker technology of this invention enables the efficient breeding of pig herds with stable and healthy biochemical indicators, providing higher-quality laboratory animals for biomedical research and significantly enhancing their scientific research value and market competitiveness. Therefore, this invention has broad application prospects and significant economic and social benefits.

[0129] The SNP molecular marker provided by this invention not only reveals genetic loci associated with the risk of abnormal serum ALP levels in Wuzhishan pigs, but also identifies the dominant genotype (TT) and the suboptimal genotype (TC) through genotype-phenotype association analysis. Applying this marker to marker-assisted breeding enables early and precise selection of breeding pigs, gradually optimizing the genotype frequency of the population, effectively reducing the incidence of abnormalities, and improving the overall health and production performance of the herd. This marker has significant theoretical value and broad application prospects for the preservation and innovative utilization of rare local pig breeds.

[0130] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of a product for detecting SNP molecular markers located on chromosome 3 that are associated with abnormal levels of alkaline phosphatase in porcine serum, characterized in that... The application includes at least one of the following (1)-(4): (1) To determine the incidence of abnormal levels of alkaline phosphatase in porcine serum; (2) Prepare a product for identifying the incidence of abnormal levels of alkaline phosphatase in porcine serum; (3) Screening pigs with a low incidence of abnormal serum alkaline phosphatase levels; (4) Prepare products from pigs with low incidence of abnormal serum alkaline phosphatase levels; The SNP molecular markers mentioned above correspond to the T / C mutation at 53681151 bp on chromosome 3 of the International Pig Reference Genome Version 11.

1. The polymorphism of the base at this site affects the incidence of abnormal serum alkaline phosphatase levels in pigs. Among them, the incidence of abnormal serum alkaline phosphatase levels in pigs with TC and CC genotypes is higher than that in pigs with TT genotypes. The pig mentioned is a Wuzhishan pig; The application described is for purposes other than disease treatment or diagnosis.

2. The application according to claim 1, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.

1.

3. The application according to claim 1, characterized in that: The product described includes reagents or kits.

4. The application according to claim 3, characterized in that: The reagents described contain primer pairs or probes.

5. The application according to claim 4, characterized in that: The primer pair comprises primers primer-F and primer-R, and their nucleic acid sequences are as follows: Upstream primer-F: 5'-CAGGGCCAAGTGGTGTTACC-3'; Downstream primer primer-R: 5'-TGACCTCAAAAGCTCAGGTGT-3'.

6. A method for detecting a high or low incidence of abnormal alkaline phosphatase levels in porcine serum, characterized in that... It includes the following steps: The SNP sites of the SNP molecular markers described in claim 1 on pig chromosome 3 are detected, and the incidence of abnormal serum alkaline phosphatase content in pigs is determined to be high or low based on whether the single nucleotide of the SNP site is T or C; among them, the incidence of abnormal serum alkaline phosphatase content in pigs with TC and CC genotypes is higher than that in pigs with TT genotypes. The pig mentioned is a Wuzhishan pig; The method described is not for disease treatment or diagnosis purposes.

7. A method for screening pigs with a low incidence of abnormal serum alkaline phosphatase levels, characterized in that... It includes the following steps: The SNP sites of the SNP molecular markers as described in claim 1 on chromosome 3 of pigs were detected, and individuals with the TT genotype were selected as breeding pigs, while individuals with the TC and CC genotypes were culled; among them, the incidence of abnormal serum alkaline phosphatase levels in pigs with the TC and CC genotypes was higher than that in pigs with the TT genotype. The pig mentioned is a Wuzhishan pig; The method described is not for disease treatment or diagnosis purposes.

8. The method according to claim 7, characterized in that: The detection process includes the following steps: (1) Extract genomic DNA from the pigs to be tested; (2) Using primer pairs as amplification primers, and using the genomic DNA of the pig to be tested obtained in step (1) as template DNA, PCR amplification was performed to obtain PCR amplification products; (3) Sequencing the PCR amplification products to obtain sequencing results; (4) Determine the genotype based on the sequencing results; The primer pair comprises primers primer-F and primer-R, and their nucleic acid sequences are as follows: Upstream primer-F: 5'-CAGGGCCAAGTGGTGTTACC-3'; Downstream primer primer-R: 5'-TGACCTCAAAAGCTCAGGTGT-3'.

Citation Information

Patent Citations

  • SNP marker for identifying pig backfat thickness, and application method of SNP marker

    CN113355430A

  • SNP (Single Nucleotide Polymorphism) molecular marker located on chromosome 2 and related to abnormal delivery traits of sows and application of SNP molecular marker

    CN119351580A