Use of a molecular marker affecting thoracic circumference traits in sheep

Abstract

This invention belongs to the field of genetic breeding technology, specifically the application of a molecular marker affecting the chest circumference trait of sheep. The molecular marker is the nucleotide sequence shown in SEQ ID NO.1, where the nucleotide at the 101bp site is C or T. The application refers to either (1) or (2) below: (1) identifying the chest circumference of sheep; (2) improving the chest circumference of sheep offspring. This invention screens a molecular marker affecting the chest circumference trait of sheep. By detecting the genotype of this molecular marker, the genetic assessment of the chest circumference trait can be performed in the early stages of sheep growth and development. Furthermore, based on this key SNP site and its dominant genotype, selecting individuals carrying the dominant genotype as parents can effectively improve the average chest circumference of the offspring population. This invention provides direct technical support for the rapid breeding of new sheep breeds or populations with outstanding chest circumference traits, and helps to accelerate the process of sheep breeding improvement.

Description

Technical Field

[0001] This invention relates to the field of genetic breeding technology, specifically to the application of a molecular marker that affects the chest girth trait in sheep. Background Technology

[0002] Suffolk sheep, a large meat sheep breed, holds an important position in the livestock industry due to its excellent growth rate and superior carcass performance. Suffolk sheep were developed in 1859 through crossbreeding of the Southhill sheep with the robust, lean-meat-proportioned Norfolk black-headed horned sheep. Currently, they are mainly used for purebred breeding and as a high-quality sire source for crossbreeding and improving local sheep breeds. Their excellent production performance effectively shortens the breeding cycle, reduces feed input costs, and significantly improves overall breeding efficiency.

[0003] Chest circumference is one of the core indicators for assessing the body structure, respiratory system development, and production performance of Suffolk sheep. It directly reflects the volume of the thoracic cavity and the degree of development of the cardiopulmonary organs, and is closely related to body weight, constitution, and health status. In the breeding of meat sheep, chest circumference is not only an important morphological basis for measuring the integrity of an individual's body development and growth potential, but also indirectly indicates the basis of its meat yield and its adaptability to the environment.

[0004] With the increasing market demand for high-quality and high-yield mutton, the efficient breeding of superior meat breeds such as Suffolk sheep has become particularly crucial. However, existing breeding techniques still have significant limitations: chest girth can only be measured directly after the sheep have reached a certain stage of growth, resulting in long breeding cycles, high costs, and the inability to accurately assess genetic potential in the early stages. The domestic purebred Suffolk sheep population is limited in size, and long-term breeding has led to a decline in genetic diversity and the accumulation of inbreeding risks, resulting in slowed genetic progress or even regression. Relying solely on traditional breeding methods makes it difficult to achieve continuous breakthroughs in this trait.

[0005] Therefore, systematically discovering key molecular markers closely related to chest girth traits provides crucial tools and theoretical basis for early and precise breeding of Suffolk sheep with chest girth traits, which is of great practical significance for improving the production performance of the population and accelerating the process of breed improvement. Summary of the Invention

[0006] To address the above problems, this invention provides an application of molecular markers that influence the chest girth trait in sheep. These molecular markers can be used to identify the chest girth trait in sheep and to breed sheep with large chest girths.

[0007] This invention is achieved through the following technical solution: This invention provides an application of a molecular marker that affects the chest girth trait of sheep, wherein the molecular marker is the nucleotide sequence shown in SEQ ID NO.1, and the nucleotide at the 101 bp site is C or T; The application refers to any one of the following (1) and (2): (1) Determine the chest circumference of a sheep; (2) Increase the chest circumference of sheep offspring.

[0008] Preferably, the method for determining the chest circumference of a sheep is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the sheep at position 101bp of SEQ ID NO.1; If the genotype at 101bp of SEQ ID NO.1 is TT, then the sheep has a large chest circumference, which means a chest circumference greater than 108cm.

[0009] Preferably, the method for increasing the chest circumference of sheep offspring is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the sheep at position 101bp of SEQ ID NO.1; By selecting sheep individuals with the genotype TT at SEQ ID NO.1 at 101bp as parents for breeding, it is possible to increase the chest circumference of sheep offspring.

[0010] Preferably, the genomic DNA is derived from sheep blood.

[0011] Preferably, the genomic DNA is extracted using the phenol-chloroform method.

[0012] Preferably, the sheep is a Suffolk sheep.

[0013] Preferably, the chest circumference refers to the length around the chest at the back of the sheep's shoulder blade.

[0014] Compared with the prior art, the present invention has the following beneficial effects: This invention provides an application of a molecular marker affecting the chest circumference trait in sheep. The molecular marker is the nucleotide sequence shown in SEQ ID NO.1, where the nucleotide at the 101 bp site is C or T. The application refers to either (1) or (2) below: (1) identifying the chest circumference of sheep; (2) improving the chest circumference of sheep offspring. Through genome sequencing, variant site identification, and genome-wide association analysis, this invention screened a molecular marker affecting the chest circumference trait in sheep. Compared with traditional breeding methods that rely on phenotypic measurements, genetic assessment of the chest circumference trait can be performed in the early stages of sheep growth and development by detecting the genotype of this molecular marker. Furthermore, based on this key SNP site and its dominant genotype, selecting individuals carrying the dominant genotype as parents can effectively improve the average chest circumference of the offspring population. This invention provides direct technical support for the rapid breeding of new sheep breeds or populations with outstanding chest circumference traits, and helps to accelerate the process of sheep breed improvement. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1 This is a distribution diagram of the SNPs after quality control in a 1Mb window of the chromosome. The left Y-axis represents the chromosome name, and the upper X-axis represents the window size.

[0017] Figure 2 This is the principal component analysis diagram of the present invention.

[0018] Figure 3 This is a visualization of the G matrix of the present invention.

[0019] Figure 4 The Manhattan Plots and QQ-plots of this invention show the GWAS results of the chest girth trait in Suffolk sheep; A is the Manhattan plot of the chest girth trait in Suffolk sheep, with significant SNPs across the entire genome shown in red; B is the QQ plot of the chest girth trait in Suffolk sheep. Detailed Implementation

[0020] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0021] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this invention and in the specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0022] The technical solution of the present invention will be further described below with reference to specific embodiments.

[0023] The following is a list of abbreviations related to this invention: LD: Linkage Disequilibrium; Manhattan Plot; QQ-plots / QQ graph: Quantile-Quantile Plot; SNP: Single nucleotide polymorphism; GWAS: Genome-wide association analysis.

[0024] The experimental animals and phenotypic sources used in this invention are as follows: The sheep used in this invention were all from Sinosheep Technology Co., Ltd. Chest circumference traits of adult Suffolk sheep from 2020 to 2024 were measured and phenotypes were recorded. Descriptions of chest circumference traits are shown in Table 1.

[0025] Blood samples were collected from 300 Suffolk sheep. All samples were immediately stored at -80°C after collection and transported to the laboratory on dry ice for long-term storage at -80°C.

[0026] Table 1. Description of chest circumference traits in Suffolk sheep

[0027] Example 1 The application of a molecular marker affecting the chest girth trait in sheep is as follows: 1. Genomic DNA extraction and quality control.

[0028] DNA was extracted from blood samples using the phenol-chloroform method. DNA concentration was measured using a NanoDrop2000 spectrophotometer. The absorption wavelength ratio of the highest absorption peak at 260 nm to 280 nm was calculated to measure the content of DNA, protein, and phenolic substances. The absorption wavelength ratio of the highest absorption peak at 260 nm to 230 nm was calculated to measure the content of DNA and carbohydrates. DNA quality was then assessed using 1% (w / v) agarose gel electrophoresis.

[0029] 2. Library construction and sequencing.

[0030] The qualified genomic DNA was randomly fragmented into 350bp fragments using a Covaris ultrasonic disruptor. The DNA fragments underwent end repair, poly(A) addition, sequencing adapter addition, purification, and PCR amplification to complete the library preparation. After library construction, preliminary quantification was performed using Qubit 2.0, and qPCR was used to accurately quantify the effective concentration of the library to ensure library quality. After passing quality checks, sequencing was performed using the BGI MGI-T7 sequencing platform in PE150 mode.

[0031] 3. Identification, screening, and annotation of variant sites.

[0032] Raw reads were filtered into clean reads using FastP software version 0.20.0, and a genome index was built on the reference genome. The quality-controlled clean reads were aligned with the reference genome using Burrows-Wheeler Aligner software version 0.7.17. The aligned SAM files were converted to BAM files using SAMtools software version 1.8-20, and the BAM files were sorted. Duplicates were removed from the sorted BAM files using the MarkDuplicates program in Genome Analysis Toolkit version 3.8, resulting in the final BAM file. An index was built on the final BAM file, and SNP variant detection was performed using the HaplotypeCaller module in GATK software. The resulting VCF file was then filtered using the VariantFiltration module. Functional annotation of the detected gene variants was performed using the ANNOVAR software package. Based on the location of the variant sites on the reference genome and the gene location information on the reference genome, the region in which the variant sites occurred and the impact of the variants, such as synonymous or non-synonymous mutations, can be determined.

[0033] The reference genome used in this invention is Oar_v4.0, GCF_000298735.2.

[0034] 4. Data quality control and group stratification correction.

[0035] Whole-genome resequencing was performed on 300 individuals of Suffolk sheep to establish a genotype database, generating a total of 17243.32 Gb of raw reads and obtaining 47,506,993 SNPs.

[0036] The obtained genotyping data were quality controlled using Plink V1.90 software, and individuals with a genotype detection rate of less than 98%, SNPs with a detection rate of less than 98%, SNPs with a minimum allele frequency of less than 5%, and Hardy-Weinberg equilibrium test p-values ​​of less than 10 were removed. -6 SNPs. A total of 20,182,599 high-quality SNPs were identified in the Suffolk population. These loci are evenly distributed across the 26 pairs of autosomes in sheep, such as... Figure 1 As shown.

[0037] The first five principal components were calculated using the "--pca5" parameter in Plink software version 1.90. A PCA plot was then drawn using R version 3.6.0, and the results are as follows. Figure 2 As shown, the top density distribution of PC1 displays principal component 1, i.e., the distribution of all data points on PC1 and the degree of data variation along the PC1 axis. The right-hand density distribution of PC2 displays principal component 2, i.e., the distribution of all data points on PC2 and the degree of data variation along the PC2 axis. The results indicate that the experimental sample exhibits population stratification and a high degree of genetic correlation among individuals. The first five principal components need to be used as covariates to correct for the population stratification of Suffolk sheep. Genomic kinship analysis based on the G matrix was performed on this population using Plinkv1.90, and the results are as follows: Figure 3 As shown, Figure 3 Each small square in the table represents the kinship value between two samples. The smaller the value, the closer it is to light green, meaning that the two individuals are more distantly related, and vice versa. The results show that the average kinship between Suffolk sheep individuals is relatively distant.

[0038] 5. Genome-wide association analysis.

[0039] The association analysis between SNP and chest circumference traits was performed using the fastGWA-mlm model in GCTA software version V1.94.0beta. The formula is as follows: .

[0040] in y It is a phenotypic vector; X snp It is a genotype vector, and its effect is β snp ; X c This is the correlation matrix with the first five PCA variables as fixed covariates, and its corresponding coefficients are... β c ; g It is a vector of total genetic effects captured by the genetic relationship matrix derived from SNPs. g ~ N(0, ); π is a genetic relation matrix vector derived from SNP, where all off-diagonal elements are set to 0; e It is the residual vector. e ~ N(0, ).

[0041] Since using the Bonferroni correction method with a value of 0.05 / number of SNPs to determine the significance threshold of GWAS is too stringent, this invention employs linkage disequilibrium screening to remove redundancy, obtaining independent SNPs for threshold calculation. The parameters are: 200: window size, i.e., number of SNPs; 50: step length, i.e., number of SNPs; 0.2: r 2 Delete one of the SNP pairs where LD is greater than 0.2.

[0042] This invention adjusts the threshold for genome-wide significant association to P=1 / 620054, where 620054 is the number of independent SNPs screened by LD. The genome expansion factor, λ, is tested and calculated using the slope of a linear regression between observed quantiles and theoretical quantiles in R version V3.6.0. The calculated λ value for the chest circumference trait is 0.960, indicating no genome expansion.

[0043] Based on resequencing data from 300 Suffolk sheep, 39 significant SNP loci associated with chest girth were detected. These loci are located on chromosomes 1, 2, 3, and 4, as shown in Table 2. Figure 4 As shown.

[0044] Table 2 Significant SNP loci associated with chest circumference traits

[0045] 6. SNPs affecting chest circumference traits in Suffolk sheep.

[0046] Further investigation of SNPs that reached genome-wide significance revealed that the C→T mutation at position 4461089 on chromosome 4 of the Suffolk sheep genome can significantly affect the chest girth trait of Suffolk sheep.

[0047] Association analysis was performed on the SNP locus at position 4461089 on chromosome 4 of the Suffolk sheep genome with chest girth trait. The results are shown in Table 3.

[0048] Table 3. Polymorphism at position 4461089 on chromosome 4 of the Suffolk sheep genome.

[0049] Note: In the chest circumference column of Table 3, different lowercase letters indicate significant differences. P <0.05; the same letter indicates no significant difference. P >0.05.

[0050] As shown in Table 3, individuals with the TT genotype have the largest chest circumference, while individuals with the CC genotype have the smallest chest circumference.

[0051] In the genome-wide association analysis, the SNP molecular marker at position 4461089 on chromosome 4 of the Suffolk sheep genome reached a genome-wide significance level, indicating that this molecular marker is significantly associated with the chest circumference trait of Suffolk sheep. Furthermore, when the base of this molecular marker is T, it is beneficial for Suffolk sheep to have a larger chest circumference, which is greater than 108 cm.

[0052] The frequency of the SNP gene and genotype at position 4461089 on chromosome 4 of the Suffolk sheep genome were then calculated, as shown in Table 4.

[0053] Table 4. SNP gene frequency and genotype frequency at position 4461089 on chromosome 4.

[0054] The nucleotide sequence of the molecular marker containing the C→T mutation site at position 4461089 on chromosome 4 is shown in SEQ ID NO.1 and SEQ ID NO.2.

[0055] SEQ ID NO.1: GAGCTGTGTGGTCCCCACACATGGAGGGCAGCATCCTTGCGCAGAGATGCAGGGAGCGGGTGTGACAGTAGCTGAACGATCTGTAGGACCCGTCAGAGCACACAGGACCCATCTCATCCAGGGTACAGAGTCACGCATGGGGCCATCTTCCCACACAAGGCCTGTGGAAGCCCCTAGAGGGATGTTAGTGGGGGCCACACG.

[0056] SEQ ID NO.2: GAGCTGTGTGGTCCCCACACATGGAGGGCAGCATCCTTGCGCAGAGATGCAGGGAGCGGGTGTGACAGTAGCTGAACGATCTGTAGGACCCGTCAGAGCATACAGGACCCATCTCATCCAGGGTACAGAGTCACGCATGGGGCCATCTTCCCACACAAGGCCTGTGGAAGCCCCTAGAGGGATGTTAGTGGGGGCCACACG.

[0057] Based on the above results, we can see that: The Suffolk sheep breed is bred by selecting individuals with the TT genotype and using them as the father or mother to increase the chest circumference of the offspring. The C→T mutation at position 4461089 on chromosome 4 of the Suffolk sheep genome is used to breed Suffolk sheep with a large chest circumference.

[0058] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.

[0059] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0060] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention should be determined by the appended claims.

Claims

1. The application of a molecular marker affecting the chest girth trait in sheep, characterized in that, The molecular marker is the nucleotide sequence shown in SEQ ID NO.1, where the nucleotide at position 101 of the nucleotide sequence shown in SEQ ID NO.1 is C or T; when the genotype at position 101 of the molecular marker is TT, the sheep have a large chest circumference. The application refers to any one of the following (1) and (2): (1) Determine the chest circumference of sheep; (2) Increase the chest circumference of sheep offspring; The methods to increase the chest circumference of sheep offspring are as follows: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the sheep at position 101bp of SEQ ID NO.1; By selecting sheep individuals with the genotype TT at 101bp of SEQ ID NO.1 as parents for breeding, it is possible to increase the chest circumference of sheep offspring. The sheep in question are Suffolk sheep.

2. The application as described in claim 1, characterized in that, The method for determining a sheep's chest circumference is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the sheep at position 101bp of SEQ ID NO.1; If the genotype at 101bp of SEQ ID NO.1 is TT, then the sheep has a large chest.

3. The application as described in claim 1, characterized in that, The genomic DNA was derived from sheep blood.

4. The application as described in claim 1, characterized in that, The genomic DNA was extracted using the phenol-chloroform method.

5. The application as described in claim 1, characterized in that, The chest circumference refers to: The length measured around the chest at the back of the sheep's shoulder blade.

Images