Raacrispr / cas12a detection system for intestinal flora and application thereof

Abstract

This invention discloses a RAA-CRISPR / Cas12a detection system for gut microbiota and its applications, relating to the field of biodetection technology. The RAA-CRISPR / Cas12a detection system includes FPR-crRNA1, Cbu-crRNA2, Akk-crRNA1, FPR-RAA primer pairs, Akk-RAA primer pairs, Cbu-RAA primer pairs, ssDNA, and Cas12a protein. This RAA-CRISPR / Cas12a detection system enables accurate, sensitive, and rapid detection of three core gut probiotics. Furthermore, it requires no complex temperature gradients, has low equipment requirements, is easy to operate, and significantly shortens the detection cycle. In addition, the detection system is stable, reliable, and highly reproducible, providing efficient technical support for gut health assessment, early disease diagnosis, and monitoring of intervention effects.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, and in particular to a RAA-CRISPR / Cas12a detection system for gut microbiota and its applications. Background Technology

[0002] The gut microbiota, as a core component of the human micro-ecosystem, has a structure and balance that is closely related to host health. Among them, Clostridium plasminoides (Clostridium plasminoides) Faecalibacterium prausnitzii Clostridium butyricum ( Clostridium butyricum ) and Akermansia myxophila ( Akkermansia muciniphila These are three types of probiotics with key physiological functions, considered important "biomarkers" of gut health. *Clostridium butyricum*, one of the most abundant beneficial bacteria in the colon, produces high levels of butyrate, providing a major energy source for intestinal epithelial cells. It also inhibits chronic intestinal inflammation by secreting anti-inflammatory proteins, playing a crucial role in the prevention and improvement of inflammatory bowel disease and metabolic diseases. *Clostridium butyricum*, an endophytic spore-forming bacterium, not only produces butyrate to repair the intestinal mucosal barrier but also regulates intestinal motility and inhibits the proliferation of pathogenic bacteria, showing significant intervention effects in diarrhea, constipation, and other symptoms caused by intestinal flora imbalance. *Aktermania myxophilus* regulates mucus layer thickness by metabolizing intestinal mucin, promoting tight junctions of intestinal epithelial cells, while also improving insulin resistance and regulating metabolism. Its abundance changes are closely related to metabolic diseases such as obesity and diabetes. Imbalances or absences in the abundance of these three probiotics often indicate gut microbiota dysbiosis and may even induce a series of systemic diseases. Therefore, establishing rapid, accurate, and sensitive detection methods to achieve precise quantitative analysis of these three gut probiotics is of great significance for gut health assessment, early disease diagnosis, and monitoring of intervention effects.

[0003] Currently, gut microbiota detection technology has made some progress, with traditional methods including microbial culture and biochemical identification. Microbial culture involves isolating and culturing gut microbiota, then identifying them based on colony morphology and biochemical reactions. This method is simple and low-cost, but it has significant limitations: anaerobic bacteria such as *Clostridium plasminogen lysate* require demanding anaerobic conditions and a culture period of several days, making rapid detection difficult; *Clostridium butyricum* shares similar colony morphology and biochemical characteristics with other *Clostridium* strains, leading to misidentification; furthermore, culture methods can only detect culturable strains, failing to reflect the true state of unculturable gut microbiota, and have low sensitivity, making it difficult to detect low-abundance probiotics. Biochemical identification relies on the detection of strain-specific metabolites, but its specificity is insufficient, easily affected by metabolites from other gut microbiota, resulting in poor accuracy and failing to meet the needs of precise detection.

[0004] With the development of molecular biology techniques, nucleic acid detection methods have gradually become the mainstream technology for gut microbiota detection due to their high specificity and sensitivity. Among them, polymerase chain reaction (PCR) and its derivative technologies are the most widely used. Conventional PCR technology amplifies target gene fragments using specific primers and performs qualitative analysis by agarose gel electrophoresis, enabling rapid screening of target strains. However, it cannot accurately quantify and has limited sensitivity, making it difficult to detect low-copy target sequences. Real-time quantitative PCR (qPCR) adds fluorescent groups to the PCR reaction system, achieving quantitative analysis of target sequences by detecting the intensity of the fluorescence signal. It has advantages such as high sensitivity, strong specificity, and accurate quantification, and has been widely used in gut microbiota detection. However, qPCR technology has high requirements for experimental equipment, requiring a dedicated quantitative PCR instrument, and the reaction process requires strict control of the temperature gradient. The detection cycle is relatively long (usually 1-2 hours), and it is susceptible to factors such as primer dimers and non-specific amplification, leading to false positive results. Digital PCR (ddPCR) technology achieves single-molecule amplification by dividing the reaction system into a large number of droplets, which further improves detection sensitivity and quantitative accuracy. However, its equipment is expensive, the operation is complicated, and the detection cycle is long, making it difficult to promote its application in primary healthcare institutions or on-site testing scenarios.

[0005] In practical applications, gut microbiota samples are complex, containing hundreds or even thousands of microorganisms. The abundance of target probiotics may be low, and they are easily interfered with by the nucleic acids of other microorganisms. This places higher demands on the specificity and sensitivity of detection technologies. Meanwhile, clinical testing, primary healthcare, and field testing scenarios require detection technologies that are easy to operate, rapid, efficient, and require minimal equipment to provide quick results and timely guidance for clinical intervention. Existing detection technologies either suffer from insufficient sensitivity and poor specificity, or rely on expensive equipment, are complex to operate, and have long testing cycles, making it difficult to simultaneously meet the comprehensive requirements of specificity, sensitivity, speed, and convenience. Therefore, developing a detection technology that can simultaneously detect Clostridium butyricum, Clostridium butyricum, and Akkermansia myxotropicum, while possessing advantages such as high specificity, high sensitivity, rapid and simple operation, and minimal equipment requirements, has become an urgent technological need in the field of gut microbiota detection. This has significant practical implications for promoting gut health assessment, disease diagnosis, and microecological intervention. Summary of the Invention

[0006] The purpose of this invention is to provide a RAA-CRISPR / Cas12a detection system for gut microbiota and its application, thereby addressing the problems existing in the prior art. This RAA-CRISPR / Cas12a detection system can achieve accurate, sensitive, and rapid detection of three core gut probiotics, thus providing efficient technical support for gut health assessment, early disease diagnosis, and monitoring of intervention effects.

[0007] To achieve the above objectives, the present invention provides the following solution: This invention provides a RAA-CRISPR / Cas12a detection system for gut microbiota, comprising FPR-crRNA1, Cbu-crRNA2, Akk-crRNA1, FPR-RAA primer pairs, Akk-RAA primer pairs, Cbu-RAA primer pairs, ssDNA, and Cas12a protein; The nucleotide sequence of the FPR-crRNA1 is shown in SEQ ID NO.3; The nucleotide sequence of the Cbu-crRNA2 is shown in SEQ ID NO.9; The nucleotide sequence of Akk-crRNA1 is shown in SEQ ID NO.13; The FPR-RAA primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.42 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.43; The Akk-RAA primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.23 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.30; The CPCu-RAA primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.31 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.37; The nucleotide sequence of the ssDNA is TTTATTT.

[0008] Furthermore, the 5' and 3' ends of the ssDNA are labeled with different fluorescent genes.

[0009] Furthermore, the ssDNA is labeled with the FAM group at the 5' end and the BHQ1 gene at the 3' end; This invention also provides the application of the above-described RAA-CRISPR / Cas12a detection system in the preparation of detection products for gut microbiota, wherein the gut microbiota includes Clostridium plasminoides (…). Faecalibacterium prausnitzii Clostridium butyricum ( Clostridium butyricum ) and Akkermansia myxophila ( Akkermansia muciniphila ).

[0010] Furthermore, the testing product is a reagent kit.

[0011] The present invention also provides a product for detecting gut microbiota, including the above-mentioned RAA-CRISPR / Cas12a detection system; The gut microbiota includes Clostridium plasminogen lysate, Clostridium butyricum, and Akkermansia myxophila.

[0012] Furthermore, the testing product is a reagent kit.

[0013] Furthermore, the detection method of the kit includes the following steps: Using the genomic DNA of the sample to be tested as a template, RAA amplification was performed using RAA primer pairs to obtain RAA amplification products; The RAA amplification product was used to prepare a CRISPR / Cas12a reaction solution. After the CRISPR / Cas12a reaction was performed, the fluorescence intensity was detected.

[0014] Furthermore, the RAA amplification reaction temperature is 39°C and the time is 30 min.

[0015] Furthermore, the CRISPR / Cas12a reaction is carried out at a temperature of 37°C for 1 hour.

[0016] The present invention discloses the following technical effects: This invention provides a RAA-CRISPR / Cas12a detection system for gut microbiota, enabling precise, sensitive, and rapid detection of three core gut probiotics. This system effectively avoids non-specific interference by screening for optimal specific crRNA and RAA primer pairs, combined with the targeted recognition and incidental cleavage activity of the Cas12a protein. It exhibits high specificity, with no cross-reactivity with other gut microbiota, and a detection sensitivity as high as 1 copy / μL, accurately capturing low-abundance target strains. Its performance is comparable to qPCR and ddPCR, accurately reflecting the state of the gut microbiota. Furthermore, RAA amplification is completed in 30 minutes at 39°C, and the CRISPR / Cas12a reaction yields results in 1 hour at 37°C. The entire process requires no complex temperature gradients, has low equipment requirements, and is easy to operate, significantly shortening the detection cycle. In addition, the detection system is stable, reliable, and reproducible, with intuitive interpretation via fluorescence signals. It eliminates the need for opening the container, reducing the risk of cross-contamination. It is suitable for various scenarios such as clinical testing, primary healthcare, and on-site screening, providing efficient technical support for gut health assessment, early disease diagnosis, and monitoring of intervention effects. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 The fluorescence signal detection curves for Clostridium plasmid using different crRNAs are shown; NTC represents the negative control using ddH2O as a template. Figure 2 The fluorescence signal detection curves for Clostridium butyricum using different crRNAs are shown; NTC represents the negative control using ddH2O as a template. Figure 3 The fluorescence signal detection curves for Akkermansia myxophilus using different crRNAs are shown; NTC represents the negative control using ddH2O as a template. Figure 4 Agarose gel electrophoresis images of RAA primer amplification products of three bacteria; Figure 5 The fluorescence signal curve for the sensitivity detection of Clostridium praosporum; NTC represents the negative control using ddH2O as a template; Figure 6 The fluorescence signal curve for the sensitivity detection of Clostridium butyricum; NTC represents the negative control using ddH2O as a template; Figure 7 The fluorescence signal curve for the sensitivity detection of Akkermansia myxophilus; NTC represents the negative control using ddH2O as a template; Figure 8 The fluorescence signal curve is for the specific detection of Clostridium praosporum; NTC represents the negative control using ddH2O as a template. Figure 9 The fluorescence signal curve is for the specific detection of Clostridium butyricum; NTC represents the negative control using ddH2O as a template. Figure 10 The fluorescence signal curve is for the specific detection of Akkermansia myxophilus; NTC represents the negative control using ddH2O as a template. Figure 11 The graph shows the qPCR sensitivity detection results for Clostridium perfringens; where A represents the Ct values ​​at different concentrations; B represents the standard curve; and NTC represents the negative control using ddH2O as a template. Figure 12 This is a graph showing the sensitivity detection results of ddPCR for Clostridium plasmid; from left to right, 10... 4 10 3 10 2 10 1 10 0 The test results of the negative control group; Figure 13 The graph shows the qPCR sensitivity detection results for Clostridium butyricum; where A represents the Ct values ​​at different concentrations; B represents the standard curve; and NTC represents the negative control using ddH2O as a template. Figure 14 This is a graph showing the sensitivity detection results of ddPCR for Clostridium butyricum; from left to right, 10... 4 10 3 102 10 1 10 0 The test results of the negative control group; Figure 15 The graph shows the qPCR sensitivity detection results for Akkermansia myxophilus; where A represents the Ct values ​​at different concentrations; B represents the standard curve; and NTC represents the negative control using ddH2O as a template. Figure 16 This is a graph showing the sensitivity detection results of ddPCR for Akkermansia myxophilus, from left to right: 10 4 10 3 10 2 10 1 10 0 The test results of the negative control group. Detailed Implementation

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0021] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0022] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0023] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0024] Example 1 1. crRNA design and synthesis The crRNA of Cas12a (also known as Cpf1) contains a direct repeat sequence and a spacer sequence. The direct repeat sequence is fixed, specifically: uaauuucuacuaaguguagau (SEQ ID NO.1). The spacer sequence is a specific recognition sequence for the crRNA and should be complementary to a region of the amplification product. It can target any region of the target fragment, but should avoid overlapping with the primer. Furthermore, the PAM (polyacrylamide ssDNA) is crucial for the recognition of crRNA primers and target sequences, as Cas12a protein recognition of dsDNA targets begins with the recognition of the PAM sequence, thereby promoting the unfolding of the dsDNA target. The PAM sequence for Cas12a is TTTV (V=A / C / G). The fluorescent reporter ssDNA is 5'-FAM-TTTATTT-BHQ1-3'. The designed crRNA was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0025] ① Clostridium plasminoides ( Faecalibacterium prausnitzii, F. prausnitzii crRNA design and synthesis We selected the hypervariable region V3-V4 of the Clostridium praosporum 16S rRNA gene (SEQ ID NO.2) as the target and designed a specific crRNA sequence to ensure that its spacer region is completely complementary to the conserved region of the genus and does not cross-react with other intestinal commensal bacteria. After verifying the specificity by BLAST comparison, the sequence was synthesized and purified by Sangon Biotech (Shanghai) Co., Ltd. and stored at -80℃ in the dark for later use.

[0026] SEQ ID NO.2: GGAAACCCTGATGCAGCGACGCCGTGGAGGAAGAAGGTCTTCGGATTGTAAACTCCTGTTGTTGAGGAAGATAATGACGGTACTCAACAAGGAAGTGACGGCTAACTACGTGCCAGCAGCCGCGGTAAAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAA GTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGGTGTAGCGGTGGAATGCGTAGATATCGGGAGGAACACCAGTGGCGAAGGCGGCCTACTGGGCACCAACTGACGCTGAGGCTCGAAAGTGTGGGTAGCAAACAGGATTAGATACCCTGGTAG.

[0027] The crRNA sequence is as follows: FPR-crRNA1: 5'-uaauuucuacuaaguguagauUUGAGUAGUGCAGAGGUAGGC-3' (SEQ IDNO.3); FPR-crRNA2: 5'-uaauuucuacuaaguguagauCCGCGGCUGCUGGCACGUAGU-3' (SEQ IDNO.4); FPR-crRNA3: 5'-uaauuucuacuaaguguagauCACCCAGUAAUUCCGGACAAC-3' (SEQ IDNO.5); FPR-crRNA4: 5'-uaauuucuacuaaguguagauGAGCCUCAGCGUCAGUUGGUG-3' (SEQ ID NO. 6).

[0028] ② Clostridium butyricum ( Clostridium butyricum, C. butyricum crRNA design and synthesis The sequence used for designing *Clostridium butyricum* crRNA was obtained by referencing publicly reported *Clostridium butyricum*-related sequences and screening them according to the target detection requirements. After specificity was verified by BLAST alignment, the sequence was synthesized and purified by Sangon Biotech (Shanghai) Co., Ltd., and stored at -80℃ protected from light for later use. The nucleotide sequence of the region used for crRNA design is shown in SEQ ID NO.7.

[0029] SEQ ID NO.7: TCCATTATAAGCTGGTGCATAACTTGTATTTCCATAGCTATCTACATAAACTCTATTATTAGGAGTTAACATTCTAAAAAGCATATAGTTGCTCAATAAATTACTCCATCTGCTCCCACTATTATAATAATAATTATTACTTACAGAACGAGATGCATAACTATCAGGAATTGAACCATTAAAATTTTTACTTGATGAGCTAGTTGTTCCTGAGCTTGATTTAGGTGAACTGCTGCTTGATGAACTAGATGTTTTACTACTACTACTTGAGCTTGATGACTTACTACTATTGCTTGAACTACTAGAACTACTTGATTTAGTTGAACTTGGTGATGTGTTGCTACTATTTTTTGTACTTGTACTGCCACTGGATGGTTTGCTAGAACTTGAACTTCCAGATGATTTACTGCTACTTGGTGAAGAACTGCTTTTTGAGCCACTAGAACGGCTACTTGAGTGACTGCTGCTACGACTAGATGATGACTTTG。

[0030] The crRNA sequences are as follows: Cbu-crRNA1: 5'-uaauuucuacuaaguguagauAUGGUUCAAUUCCUGAUAGUU-3' (SEQ ID NO.8); Cbu-crRNA2: 5'-uaauuucuacuaaguguagauCUACUACUACUUGAGCUUGAU-3' (SEQ ID NO.9); [[ID=​​​​​​​​The target gene sequence of the Ackermansia muciniphila Amuc_1100 was selected, and a specific region sequence (SEQ ID NO.12) was screened to obtain the target detection requirements for crRNA design. The crRNA was synthesized and purified by Sangon Biotech (Shanghai) Co., Ltd., and stored at -80℃ in the dark for later use.

[0032] The nucleotide sequence of the region used for crRNA design is shown in SEQ ID NO.12.

[0033] SEQ ID NO.12: CTCTGTTCAGGCGGCCTCCACGCTGGTTTTGAATTGAAAGCCATCAACAGCCTGGTCAACAAACTGGCGGAATGCGGCCTGTCCAAATTCATCAAGGTGTACCGCCCCCAGCTCCCCATTGAAACCCTGGCGAACAATCCGGAAGAATCGGACGAAGCCGACCAGGCTCCATGGACTCCCATGCCTCTGGAAATAGCCTTCCAGGGCGACCGGG AAAGTGTATTGAAAGCCATGAACGCCATAACCGGCATGCAGGACTATCTGTTCACGGTCAACTCCATCCGTATCCGTAACGAACGGATGATGCCCCCTCCCATCGCCAATCCGGCAGCCGCCAAACCTGCCGCTGCCCAACCCGCCACGGGTGCGGCTTCCCTGACTCCGGCGGATGAGGCGGCTGCACCTGCAGCCCCGGCCATCCAGCAAGTC.

[0034] The crRNA sequence is as follows: Akk-crRNA1: 5'-uaauuucuacuaaguguagauCAGAGGCAUGGGAGUCCAUGG-3' (SEQ IDNO. 13); Akk-crRNA2: 5'-uaauuucuacuaaguguagauAAUGGGGAGCUGGGGCGGUA-3' (SEQ IDNO. 14); Akk-crRNA3: 5'-uaauuucuacuaaguguagauGCGGCCGCCCGGAUUGGCGAUG-3' (SEQ IDNO. 15); Akk-crRNA4: 5'-uaauuucuacuaaguguagauAAUACACUUUCCCGGUCGCCC-3' (SEQ ID NO. 16).

[0035] 2. crRNA screening Based on the aforementioned region sequence used for crRNA design, Beijing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the target fragment and construct the plasmid. Using pUC57 as the cloning vector, three recombinant plasmids were prepared by inserting the target fragment into the vector. Based on the synthesized plasmid sequence information, PCR primers for the target fragment were designed using Primer5 software. Specific primer information is as follows: FPR-PCR-F: 5'-CAGGGTTTCCCAGTCACGA-3' (SEQ ID NO. 17); FPR-PCR-R: 5'-CACTCATTAGGCACCCCAGG-3' (SEQ ID NO. 18); Akk-PCR-F: 5'-CCAGGGTTTTCCCAGTCA-3' (SEQ ID NO. 19); Akk-PCR-R: 5'-TAGGCACCCCAGGCTTTA-3' (SEQ ID NO. 20); Cbu-PCR-F: 5'-CCATTATAAGCTGGTGCATAAC-3' (SEQ ID NO. 21); Cbu-PCR-R: 5'-CAAAGTCATCATCTAGTCGTAG-3' (SEQ ID NO. 22).

[0036] The PCR amplification reaction system is shown in Table 1. The reaction program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min, and storage at 4℃.

[0037] Table 1 PCR amplification reaction system

[0038] After the PCR reaction was completed, the reaction products were temporarily stored at 4°C. Then, the CRISPR / Cas12a detection system was used for crRNA screening. The specific reaction system is shown in Table 2.

[0039] Table 2 CRISPR / Cas12a detection system

[0040] After the detection system was configured, the fluorescence signal was detected using the Roche Light Cycler 480 program at 37°C, with one detection every 2 minutes, and the reaction lasted for 1 hour.

[0041] The fluorescence signal detection curves of Clostridium butyricum, Clostridium butyricum, and Akkermansia myxophilus are shown in the figure. Figures 1-3 As shown in the figure. Based on the test results, FPR-crRNA1, Cbu-crRNA2, and Akk-crRNA1 were selected as the optimal crRNAs.

[0042] 3. RAA primer design and synthesis RAA amplification primers were designed based on conserved region sequences and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The specific RAA primer sequence information is as follows: Akk-RAA-F1: 5'-CTGGCGGAATGCGGCCTGTCCAAATTCATC-3' (SEQ ID NO. 23); Akk-RAA-F2: 5'-CAACAGCCTGGTCAACAAACTGGCGGAATGCGGC-3' (SEQ ID NO. 24); Akk-RAA-F3: 5'-TCATCAAGGTGTACCGCCCCCAGCTCCCCATTGA-3' (SEQ ID NO. 25); Akk-RAA-F4: 5'-ATTGAAACCCTGGCGAACAATCCGGAAGAATCGG-3' (SEQ ID NO. 26); Akk-RAA-R1: 5'-GCCTCATCCGCCGGAGTCAGGGAAGCCGCA-3' (SEQ ID NO. 27); Akk-RAA-R2: 5'-AGTTGACCGTGAACAGATAGTCCTGCATGCCGGT-3' (SEQ ID NO. 28); Akk-RAA-R3: 5'-CGATGGGAGGGGGCATCATCCGTTCGTTACGGAT-3' (SEQ ID NO. 29); Akk-RAA-R4: 5'-GGCGGCTGCCGGATTGGCGATGGGAGGGGGCATC-3' (SEQ ID NO. 30); CBu-RAA-F1: 5'-TACTTACAGAACGAGATGCATAACTATCAG-3' (SEQ ID NO. 31); CBu-RAA-F2:5′-GCATAACTATCAGGAATTGAACCATTAAAA-3′(SEQ ID NO.32)? CBu-RAA-F3:5'-TACTTGATGAGCTAGTTGTTCCTGAGCTTG-3'(SEQ ID NO.33)? CBu-RAA-F4:5'-GCTAGTTGTTCCTGAGCTTGATTTAGGTGA-3'(SEQ ID NO.34)? CBu-RAA-R1:5′-ACATCACCAAGTTCAACTAAATCAAGTAGT-3′(SEQ ID NO.35)? CBu-RAA-R2:5'-ACAAAAAATAGTAGCAACACATCACCAAGT-3' (SEQ ID NO.36)! CBu-RAA-R3:5'-AAACCATCCAGTGGCAGTACAAGTACAAAA-3'(SEQ ID NO.37)? CBu-RAA-R4:5′-TAGCAAACCATCCAGTGGCAGTACAAGTAC-3′(SEQ ID NO.38)? FPR-RAA-F1:5′-TGCCAGCAGCCCGGTAAAACGTAGGTCAC-3′(SEQ ID NO.39)? FPR-RAA-F2:5′-CAGCCGGGTAAAACGTAGGTCACAAGCGT-3′(SEQ ID NO.40)? FPR-RAA-F3:5'-CCAGCAGCCGCGGTAAAACGTAGGTCACAA-3'(SEQ ID NO.41)! FPR-RAA-F4:5′-GCTAACTACTGCGTGCCAGCAGCCGCGGTAAAA-3′(SEQ ID NO.42)? FPR-RAA-R1:5′-CACTGGTGTTCCTCCCGATATCTACGCATT-3′(SEQ ID NO.43)? FPR-RAA-R2:5'-CGCCTTCGCCACTGGTGTTCCTCCCGATAT-3'(SEQ ID NO.44)? FPR-RAA-R3: 5'-GATATCTACGCATTCCACCGCTACACCGGG-3' (SEQ ID NO. 45); FPR-RAA-R4: 5'-CCACACTTTCGAGCCTCAGCGTCAGTTGGT-3' (SEQ ID NO. 46).

[0043] 4. RAA primer screening Based on the optimal crRNA obtained from the above screening, RAA primers were screened. Four forward primers and four reverse primers were designed for each bacterium, resulting in 16 primer pairs for each bacterium. All 16 primer pairs were subjected to RAA reactions. The specific RAA reaction system is shown in Table 3. The nucleic acid amplification kit used was a basic nucleic acid amplification reagent (RAA method) (Zhongce Bio, S001ZC).

[0044] Table 3 RAA Reaction System

[0045] React at 39℃ for 30 minutes, and then store the reaction product in a refrigerator at 4℃.

[0046] RAA amplification products were detected by 1.5% agarose gel electrophoresis: 1.5 g of agarose was dissolved in 100 mL of 10×TAE buffer (Beijing Solarbio Science & Technology Co., Ltd., T1051) diluted 20 times, heated until completely dissolved, cooled, and nucleic acid dye was added. The mixture was stirred at a ratio of 7 μL / 100 mL agarose solution, poured into a gel, and allowed to solidify. The gel was placed in an electrophoresis tank, and diluted 10×TAE electrophoresis buffer was added to cover the gel surface. RAA amplification products were loaded by adding 1 μL of 6× loading buffer (Baori Biotechnology Co., Ltd., 9156) to 5 μL of sample, stirring well, and adding 2000+ DNA Markers (Bomaide brand, MD102-01). Electrophoresis was performed at 155 V for 20 min. After electrophoresis, the results were observed and recorded using a gel imaging system.

[0047] Agarose gel electrophoresis images of RAA amplification products of the three bacteria are shown below. Figure 4 Through screening, the optimal RAA primers for Clostridium praosporum were F4+R1, the optimal RAA primer combination for Akkermansia myxophilus was F1 and R4, and the optimal primer combination for Clostridium butyricum was F1 and R3.

[0048] Example 2 Performance evaluation of the RAA-CRISPR / Cas12a detection system: Sensitivity detection experiment: The RAA-CRISPR / Cas12a method established in Example 1 was used to detect recombinant plasmids containing the target sequence at different gradient dilutions of pathogens / probiotics as templates, and the limit of detection (LOD) was evaluated. The experiment was repeated 3 times. The optimal combination of crRNA and RAA primers selected in Example 1 was used.

[0049] Specificity experiments: The RAA-CRISPR / Cas12a method established in Example 1 was used to detect the genomic DNA of each pathogen / probiotic and other bacterial control strains. A negative control using ddH2O as a template was also included. Each experiment was performed in triplicate. Fluorescence values ​​at the end of the CRISPR / Cas12a detection were compared; values ​​showing a statistically significant difference compared to the negative control were considered positive. The optimal combination of crRNA and RAA primers selected in Example 1 was also used.

[0050] Sensitivity test results are shown below Figures 5-7 Specific detection results are shown in Figures 8-10 The results showed that the sensitivity reached 1 copy / μL, and there was no cross-reactivity with other bacteria.

[0051] Example 3 To evaluate the sensitivity of the RAA-CRISPR / Cas12a detection method established in this invention, recombinant plasmids containing the target sequence were used as templates and serially diluted to create test samples with different copy concentrations. Parallel detection of samples at the same concentration gradient was performed using qPCR, ddPCR, and the RAA-CRISPR / Cas12a detection system established in Example 1 (crRNA and RAA primers were the optimal combination screened in Example 1). The limits of detection of the three methods were compared to evaluate the sensitivity of the method of this invention.

[0052] qPCR primers were designed using the Primer3Plus website. After verifying the specificity of the primer sequences, they were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The specific sequences are as follows: FPR-qPCR-F: 5'-GCGTGGAGGAAGAAGGTCTT-3' (SEQ ID NO. 47); FPR-qPCR-R: 5'-TGCTACCCACACTTTCGAGC-3' (SEQ ID NO. 48); FPR-Probe: 5'-VIC-GCGCAGGCGGGAAGACAAGT-BHQ1-3' (SEQ ID NO. 49); Cbu-qPCR-F: 5'-AGAACGAGATGCATAACTATCAGGA-3' (SEQ ID NO. 50); Cbu-qPCR-R: 5'-CCATCCAGTGGCAGTACAAGT-3' (SEQ ID NO. 51); Cbu-Probe: 5′-6-FAM-TGAGCTTGATTTAGGTGAACTGCTGC-BHQ1-3′ (SEQ ID NO. 52); Akk-qPCR-F: 5′-CCTCCACGCTGGGTTTTGAA-3′ (SEQ ID NO. 53); Akk-qPCR-R: 5′-GACTTGCTGGATGGCCGG-3′ (SEQ ID NO. 54); Akk-Probe: 5′-CY5-AAGGGTTAACCGCCCCCAGCT-BHQ3-3′ (SEQ ID NO. 55).

[0053] The results of qPCR and ddPCR detection are shown below. Figures 11-16 As can be seen from the comparison (Table 4), the method established in this invention has high sensitivity, comparable to or better than qPCR and ddPCR in detection sensitivity, and can significantly shorten the detection time and reduce equipment requirements while maintaining high sensitivity.

[0054] Table 4 Detection limits of different detection methods

[0055] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A RAA-CRISPR / Cas12a detection reagent for gut microbiota, characterized in that, Including FPR-crRNA1, Cbu-crRNA2, Akk-crRNA1, FPR-RAA primer pair, Akk-RAA primer pair, CBu-RAA primer pair, ssDNA and Cas12a protein; The nucleotide sequence of the FPR-crRNA1 is shown in SEQ ID NO.3; The nucleotide sequence of the Cbu-crRNA2 is shown in SEQ ID NO.9; The nucleotide sequence of Akk-crRNA1 is shown in SEQ ID NO.13; The FPR-RAA primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.42 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.43; The Akk-RAA primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.23 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.30; The CPCu-RAA primer pair includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.31 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.37; The nucleotide sequence of the ssDNA is TTTATTT.

2. The RAA-CRISPR / Cas12a detection reagent of claim 1, characterized in that, The 5' and 3' ends of the ssDNA are labeled with different fluorescent genes.

3. The RAA-CRISPR / Cas12a detection reagent of claim 2, characterized in that, The ssDNA is labeled with the FAM group at the 5' end and the BHQ1 gene at the 3' end.

4. Use of the RAA-CRISPR / Cas12a detection reagent according to any one of claims 1-3 for the preparation of a product for the detection of enteric flora, characterized in that, The gut microbiota includes Clostridium plasminoides (… Faecalibacterium prausnitzii Clostridium butyricum ( Clostridium butyricum ) and Akkermansia myxophila ( Akkermansia muciniphila ).

5. Use according to claim 4, characterized in that, The testing product is a reagent kit.

6. A product for detecting intestinal flora, characterized by, Includes the RAA-CRISPR / Cas12a detection reagent as described in any one of claims 1-3; The gut microbiota includes Clostridium plasminogen lysate, Clostridium butyricum, and Akkermansia myxophila.

7. The test product of claim 6, wherein, The testing product is a reagent kit.

Images