Multiplex amplification system and detection kit for respiratory pathogenic bacteria and drug resistance genes

Abstract

The application belongs to the technical field of molecular detection, and particularly relates to a respiratory pathogenic bacteria and drug-resistant gene detection kit based on a capillary electrophoresis detection platform and application thereof. The kit simultaneously detects pathogenic bacteria and possible drug-resistant genes of a patient infected with respiratory infection through one-tube reaction. Compared with a traditional method, the kit covers common respiratory infection pathogenic bacteria and drug-resistant genes, has more comprehensive detection sites, higher specificity, better sensitivity, stronger reliability and batch detection capacity.

Description

Technical Field

[0001] This application belongs to the field of molecular detection, specifically relating to a multiplex amplification system for respiratory pathogens and drug resistance genes, a detection kit, and their applications. Background Technology

[0002] Respiratory tract infection (RTI) is mainly caused by pathogenic microorganisms invading and multiplying in the respiratory tract. Based on the site of infection, it can be divided into upper respiratory tract infection (URI) and lower respiratory tract infection (LRI). Upper respiratory tract infections mainly include the common cold, rhinitis, pharyngitis, and laryngitis, while lower respiratory tract infections mainly include tracheitis, bronchitis, and pneumonia. Identifying the pathogen causing lower respiratory tract infection is crucial. However, because specific clinical symptoms after pathogen infection are rare, specific diagnosis still relies on laboratory testing. Traditional pathogen detection methods often employ culture and immunoassay, which are time-consuming, cumbersome, and have low sensitivity. Furthermore, most children have already received antibiotics before sampling, further reducing the positive detection rate and failing to meet the requirements for rapid diagnosis. Therefore, while awaiting pathogen test results, broad-spectrum antibiotics are often used clinically, leading to antibiotic abuse and misuse.

[0003] According to statistics from the National Antimicrobial Resistance Surveillance Network, these are the top five pathogens in terms of Gram-positive bacteria isolation rate and Gram-negative bacteria isolation rate over the past five years. Due to the widespread use of antibiotics, the global situation regarding antibiotic resistance is extremely serious. It can be said that resistance has been observed in almost all bacteria, and bacteria that are completely sensitive to antibiotics are virtually nonexistent. Therefore, clinical microbiology laboratories should promptly detect pathogens, monitor drug-resistant strains, provide experimental evidence for the rational use of antibiotics, control nosocomial infections, and reduce the emergence of drug resistance.

[0004] Besides the limitations of traditional pathogen detection methods, methods such as nucleic acid amplification and isothermal amplification gene chip detection can achieve rapid molecular diagnosis, but they have narrow pathogen coverage, high costs, and most products still cannot rapidly detect and identify drug resistance genes in multidrug-resistant pathogens. Therefore, developing a rapid, broad pathogen coverage (including drug resistance gene detection), and economical combined detection scheme for respiratory pathogens is of great clinical significance. In view of this, this application is submitted. Application content To address the shortcomings of existing technologies, this application provides an amplification system and kit for the joint detection of respiratory pathogens and their drug resistance genes, which to some extent avoids and solves the problem of antibiotic overuse in society. The kit provided in this application features simple operation, rapid response, high specificity, high sensitivity, high throughput, high reliability, and low cost.

[0005] The specific technical solution of this application is as follows: This application first provides a primer composition for the joint detection of respiratory pathogens and their drug resistance genes. The primer composition targets respiratory pathogens with high clinical infection rates and their common antibiotic resistance genes. Specific pathogens include: Pseudomonas aeruginosa, Acinetobacter baumannii, Klebsiella pneumoniae, Escherichia coli, Streptococcus pneumoniae, Staphylococcus aureus, Haemophilus influenzae, and Moraxella catarrhalis. Drug resistance genes include: carbapenem-resistant genes blaKPC, blaNDM, and blaIMP; methicillin-resistant genes mecA; vancomycin-resistant genes vanA and vanB; polymyxin-resistant genes mcr; broad-spectrum β-lactamase genes CTX-M and SHV; and AmpC β-lactamase genes DHA and CMY.

[0006] The primers used in the further detection by the kit are listed in the table below: Primers for pathogen detection: The primers for detecting drug resistance genes: Wherein, R, S, and Y are all degenerate bases, representing G / A, C / G, and C / T, respectively. In addition to the target, the amplification system also includes human internal reference gene 1, human internal reference gene 2, and universal detection primers for pathogens. The specific primer sequences are as follows: Universal upstream primer for bacterial detection: AGAGTTTGATCMTGGCTCAG (SEQ ID NO.39); Universal bacterial detection downstream primer: ATGCCTCCCGTAGGAGTYTG (SEQ ID NO.40); upstream detection primers for human internal reference gene 1: ATCAGCTACTTTCCTGCAATGAGG (SEQ ID NO.41); Downstream detection primers for human internal reference gene 1: ATTGTACCCTTGGAGTCCAGATC (SEQ ID NO.42); upstream primer for human internal reference gene 2 detection: ATGGTGGGCATGGGTCAGACG (SEQ ID NO.43); Human internal reference gene 2 downstream detection primer: ATGTCGTCCCAGTTGGTGACG (SEQ ID NO.44); Wherein, M is a degenerate base, representing C / A.

[0007] Furthermore, the pathogens and drug resistance genes are divided into two groups. The first group includes: *Pseudomonas aeruginosa*, *Acinetobacter baumannii*, *Klebsiella pneumoniae*, *Escherichia coli*, *Streptococcus pneumoniae*, *Staphylococcus aureus*, *Haemophilus influenzae*, and *Moraxella catarrhalis*. The second group includes: blaKPC, blaNDM, blaIMP, mecA, vanA, vanB, mcr, CTX-M, SHV, DHA, and CMY. Specifically, the first group is the FAM fluorescent labeling group, and the second group is the HEX fluorescent labeling group.

[0008] Further preferred, the optimal concentrations of each primer are as follows: Group 1: Internal control upstream primer: Internal control downstream primer: Pathogen-specific upstream primer: Pathogen-specific downstream primer: Universal upstream primer: Universal downstream primer = 1:1:2:2:1:1; The second group consists of: upstream primer for internal control: downstream primer for internal control: upstream primer 2 for drug resistance gene: downstream primer for drug resistance gene in a ratio of 1:1:2:2.

[0009] This application also provides a combined detection kit for respiratory pathogens and their drug resistance genes, comprising any of the primer compositions described above.

[0010] Furthermore, the kit also contains the following components: hot-start Taq DNA polymerase, UDG enzyme and 2×PCR amplification buffer, quality control and internal standard QD550nh, ​​etc.

[0011] The combined detection kit described in this application uses multiplex fluorescent PCR (MF-PCR) to amplify the target, and detects the amplification products by capillary electrophoresis to complete the detection of clinical samples.

[0012] This application also provides a method for using a combined detection kit for respiratory pathogens and their drug resistance genes, including the step of amplifying a sample using the above-mentioned primer composition; specifically including sample processing, extraction and quality inspection, PCR system preparation and PCR amplification based on the primer composition, detection of amplification products using a genetic analyzer, data analysis and interpretation of results.

[0013] The beneficial effects of this application include: This application employs MF-PCR combined with capillary electrophoresis detection technology, targeting human internal reference genes, universal pathogen detection targets, and highly conserved sequences of 8 common respiratory pathogens as target regions, combined with 11 drug resistance gene regions, and designs and optimizes a set of specific primer combinations, thereby constructing a dual-channel 22-fold detection system. This detection system has high sensitivity and strong specificity.

[0014] Compared with existing kits on the market, the kit of this application includes both detection of common pathogens and detection of common drug resistance genes, making the detection range more comprehensive. In addition, in addition to identifying common infections, the kit of this application can also determine whether there are infections caused by pathogens outside the panel, which can effectively avoid additional testing or guide further testing and avoid missed diagnoses.

[0015] Overall, this application utilizes a capillary electrophoresis detection platform for product separation and detection, featuring high detection sensitivity, high resolution, high throughput, ease of operation, automation, and professional software for result interpretation. Compared to other detection methods on the market, it significantly reduces operational intensity, delivers results within 3 hours, and substantially lowers costs. It covers a wide range of targets, providing clinicians with more information on patients' clinical infections and offering more comprehensive and rational medication references for patients with respiratory infections, thus benefiting patients and preventing drug errors and drug resistance. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the specific embodiments of this application or the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0017] Figure 1 The test results of primer mixing during pathogen screening; among which, Figure 1 Image A shows the detection results. Figure 1 B represents the peak height, and "-" indicates no peak height.

[0018] Figure 2 Quality control and testing results; among which, Figure 2 A is the negative control. Figure 2 B is a quality control product.

[0019] Figure 3 Results of bacterial specificity test using the reagent kit; among which, Figure 3 A represents the CE cross-test result; Figure 3 B represents the qPCR test result.

[0020] Figure 4 Sensitivity performance test results diagram. Detailed Implementation

[0021] Those skilled in the art can refer to the content of this document to implement its application. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included within this application. The preparation methods and applications of this application have been described through preferred embodiments. Those skilled in the art can obviously modify or appropriately change and combine the preparation methods and applications described herein without departing from the content, spirit, and scope of this application to implement and apply the technology of this application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0022] The following terms or definitions are provided merely to aid in understanding this application. These definitions should not be construed as having a scope less than that understood by those skilled in the art.

[0023] Unless otherwise defined below, all technical and scientific terms used in the specific embodiments of this application are intended to have the same meaning as commonly understood by those skilled in the art. While it is believed that the following terms will be well understood by those skilled in the art, the following definitions are set forth to better explain this application.

[0024] As used herein, the terms “comprising,” “including,” “having,” “containing,” or “involving” are inclusive or open-ended and do not exclude other unlisted elements or method steps. The term “consisting of” is considered a preferred embodiment of the term “comprising.” If a group is defined below as comprising at least a certain number of embodiments, this should also be understood to disclose a group that preferably consists only of those embodiments.

[0025] When referring to a singular noun, the indefinite or definite article used, such as "a" or "a kind of," "the," includes the plural form of the noun.

[0026] The terms "approximately" and "generally" in this application refer to an accuracy range that, as would be understood by those skilled in the art, still guarantees the technical effects of the mentioned features. This term typically indicates a deviation from the indicated value of ±10%, preferably ±5%.

[0027] Terms such as "or more," "at least," and "more than," for example, "at least one," should be understood to include, but are not limited to, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000 or more of the stated values. This also includes any larger numbers or fractions in between.

[0028] Conversely, the term "not exceeding" includes every value less than the stated value. For example, "not exceeding 100 nucleotides" includes 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61, 60, 59, 58, 57, 56, 55, 5 4, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, and 0 nucleotides. Also includes any smaller numbers or fractions in between.

[0029] The terms "multiple," "at least two," "two or more," and "at least the second" should be understood to include, but are not limited to, at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, and 70. 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000 or more. Also includes any larger numbers or fractions in between.

[0030] The technical solutions of this application will now be clearly and completely described with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this application. Based on the embodiments of this application, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.

[0031] Example 1: Design and screening of detection primers The number of people suffering from respiratory infections is increasing, but most commercially available tests focus on combined viral detection, and the detection of drug resistance genes is still not comprehensive enough, especially the detection of drug resistance genes, which has largely contributed to the current drug resistance situation. Based on preliminary research and combined with the summary and statistics of clinical patient data collected from hospitals, the applicant ultimately identified eight pathogens with high clinical infection rates, including: *Pseudomonas aeruginosa*, *Acinetobacter baumannii*, *Klebsiella pneumoniae*, *Escherichia coli*, *Streptococcus pneumoniae*, *Staphylococcus aureus*, *Haemophilus influenzae*, and *Moraxella catarrhalis*; and common clinical drug resistance genes: carbapenem-resistant genes blaKPC, blaNDM, and blaIMP; methicillin-resistant genes mecA; vancomycin-resistant genes vanA and vanB; polymyxin-resistant genes mcr; broad-spectrum β-lactamases CTX-M and SHV; and AmpC β-lactamases DHA and CMY.

[0032] For the aforementioned pathogens and drug resistance genes, the applicant has established target regions and designed multiple primer systems.

[0033] 1. Selection of specific target genes To achieve highly specific and sensitive detection, the applicant carefully screened specific amplification regions for each pathogen and drug resistance gene based on the following principles: 1) Pathogen target gene selection To ensure detection accuracy, the applicant selected highly specific and conserved gene regions for each pathogen as detection targets. These genes are highly conserved within a species, while exhibiting sufficient sequence differences between species, thus enabling effective differentiation of different pathogens. The specific selections are as follows: For *Pseudomonas aeruginosa*, *Acinetobacter baumannii*, *Klebsiella pneumoniae*, and *Escherichia coli*, specific regions of their housekeeping / virulence genes are primarily selected for these Gram-negative bacteria. Housekeeping genes are relatively stable in evolution and have moderate copy numbers, while virulence genes not only identify bacterial species but are also closely related to clinical applications. Both housekeeping and virulence genes ensure detection sensitivity and possess good specificity due to sequence differences among similar bacterial species, effectively avoiding cross-reactivity.

[0034] For Streptococcus pneumoniae and Staphylococcus aureus: For these Gram-positive bacteria, specific virulence factors or species-specific gene fragments were selected. For example, for Streptococcus pneumoniae, gene regions closely related to its capsule synthesis or virulence were chosen; for Staphylococcus aureus, highly variable regions were avoided, and stable segments in its ribosomal protein genes or nuclease genes were selected.

[0035] Haemophilus influenzae and Moraxella catarrhalis: Conserved sequences from their membrane proteins or other species-specific genes were selected. These regions are highly conserved within the bacterial species and significantly different from other common respiratory bacteria, ensuring the specificity of the detection.

[0036] 2) Selection of drug resistance gene targets Drug resistance gene detection is directly related to clinical medication guidance. In the selection of specific targets, each target gene has undergone sufficient bioinformatics analysis and comparison to ensure its high conservation and specificity in the corresponding pathogen or its core position in the drug resistance mechanism, as well as its high prevalence in clinical isolates, so that the detection results of this kit have clear clinical guidance significance.

[0037] 2. Primer design For the identified pathogens and drug resistance gene targets, the applicant first obtained the complete or partial sequences of each target gene based on public databases such as NCBI. Through homology comparison analysis, regions that are highly conserved in the target species but have sufficient sequence differences in non-target species were selected as candidate target regions.

[0038] Subsequently, for these candidate target regions, preliminary design of specific detection primers was carried out following the principles of multiplex PCR primer design and the characteristics of the detection platform used: primer length was controlled between 18-30 bp, and if necessary, modifications such as locking nucleic acids could be performed to ensure specificity and annealing efficiency; the Tm values ​​of each primer pair were as close as possible, preferably within the range of 60±2℃, to ensure that all targets could be efficiently amplified at the same annealing temperature; secondary structures such as dimers and hairpin structures were avoided as much as possible, especially the 3' end, which should avoid more than 3 consecutive complementary bases to prevent non-specific amplification; the amplicon length was controlled within the range of 100-500 bp to adapt to the high resolution and electrophoresis time of the capillary electrophoresis platform and to ensure amplification detection efficiency.

[0039] In particular, considering the potential presence of human background DNA in clinical samples and the impact of sampling or extraction quality, this application also designed two pairs of human internal reference gene primers. The internal reference gene is selected from housekeeping genes stably expressed in the human genome. Its successful amplification can verify the quality of sample DNA extraction and the normal operation of the PCR system, effectively distinguishing between the possibility of "true negative" and "sampling / extraction failure".

[0040] 3. Screening of detection primers This application is a single-tube multi-target amplification system. In order to determine the final primers, the applicant carried out primer design and adjustment several times to screen out suitable primer combinations.

[0041] For example, during the screening process, primers designed for several targets are selected for mixed amplification. The specific targets and primer sequences are shown in the table below. The primers for each target are mixed in equal proportions from top to bottom. 5 × 10⁻⁶ primers are used to detect each target at a 1:1 ratio. 3 Copy the bacterial genome template, such as Figure 1 The results show that, except for Klebsiella pneumoniae, all other target bacteria produced peaks. In addition, several non-specific peaks were observed (marked with boxes), and the ratio of the lowest peak height to the highest peak height for each target was 24.19%, with a CV value of 42.6%, indicating significant differences in the uniformity of the initially designed primer mixture test. Analysis of the test results suggests potential primer interactions, inter-species interference, or other mutual influences among the target-specific primers.

[0042] When developing primers for pathogen detection, particular attention must be paid to efficiency and specificity. However, the aforementioned experimental screening methods cannot accurately reflect the screening indicators and obtain optimal primers. Therefore, a single-target primer specificity and efficiency testing procedure is added, followed by a primer combination screening test procedure. To achieve the above objectives, this application uses cross-testing to evaluate primer specificity, target peak height, or fluorescence PCR detection CT value to evaluate amplification efficiency and the balance of primer combination amplification to assess primer combination effectiveness. In the experiments of this application, several common human infectious bacteria were selected as templates for specificity testing. The specific results of the primer specificity screening added before the specific primer combination screening can be seen in the following results table: Note: 1-18 represents the cross-test template. "√" and "√√" both indicate peaks, with "√√" indicating better peak performance.

[0043] The cross-test results show that *Escherichia coli*, *Klebsiella pneumoniae*, *Haemophilus influenzae*, and *Pseudomonas aeruginosa* showed peaks in the cross-template test, indicating nonspecific amplification and requiring primer design modification. *Acinetobacter baumannii*, *Streptococcus pneumoniae*, *Staphylococcus aureus*, and *Moraxella catarrhalis* showed relatively high specificity in the cross-test, making it unclear whether the primers used in this test should be used. To further confirm whether the screening primers can achieve good efficiency, specificity, and balance, the results of the combined test and cross-test were used to identify which specific primer pairs(s) for each target had problems such as low efficiency, poor specificity, or no amplification peaks.

[0044] In addition, as mentioned above, considering that the detection results of this application are affected not only by whether there is a real infection, but also by the sampling, the applicant has added a specific human internal reference gene as a control of the system to determine whether a sample has been obtained. Therefore, considering the stability and specificity of the detection, this application selects a human housekeeping gene as an internal control. The specific primer sequence of the internal reference gene is as follows: The primer determination in this application not only relies on basic homology and specificity design, but also requires targeted screening tests and repeated adjustments and modifications to efficiency, size, and specificity. Based on the above experiments, the final primer sequences for each detection target determined in this application are as follows: R, S, Y, and M are all degenerate bases, representing G / A, C / G, C / T, and C / A, respectively.

[0045] After adjusting and selecting the primers, the applicant also tested the concentration of each primer in the primer combination according to the efficiency test results to establish the optimal primer concentration ratio. Specifically, in the first group, the best effect was achieved when the ratio of internal control upstream primer: internal control downstream primer: pathogen-specific upstream primer: pathogen-specific downstream primer: universal upstream primer: universal downstream primer was 1:1:2:2:1:1; in the second group, the best effect was achieved when the ratio of internal control upstream primer: internal control downstream primer: drug resistance gene upstream primer 2: drug resistance gene downstream primer 2 was 1:1:2:2.

[0046] Example 2: Preparation and application of a respiratory pathogen and drug resistance detection kit This embodiment describes the preparation of a respiratory pathogen and drug resistance gene detection kit. The kit includes primer mixture, PCR amplification buffer, enzyme mixture, quality control, molecular weight internal standard QD550nh, ​​and nuclease-free purified water. Specifically: The primer combination included in the kit is as determined in Example 1. The primers were synthesized at Sangon Biotech (Shanghai) Co., Ltd., and all primers were mixed in proportions determined by experiment to prepare a primer mixture.

[0047] The kit also includes an enzyme mixture containing hot-start Taq DNA polymerase and UDG enzyme. The former is used for amplification of PCR products, and the latter is used to prevent the amplification system from being contaminated by dUTP fragments in the environment or to prevent products from escaping into the environment and causing contamination to subsequent PCR amplification.

[0048] In particular, the kit also includes a molecular weight internal standard QD550nh, ​​which, compared to conventional internal standards, incorporates an exogenous fragment to indicate the interpretation of results.

[0049] In addition, the PCR amplification buffer contained in the kit contains dATP, dTTP, dCTP, dGTP, dUTP, and Mg. 2+ wait.

[0050] The specific operating procedures for using the reagent kit are as follows: I. Sample Preparation: DNA was extracted from pretreated respiratory patient clinical samples (sputum, nasopharyngeal swabs, bronchoalveolar lavage fluid) using the Kangwei Century Pathogenic Microorganism Genomic DNA Extraction Kit. The concentration and purity of the DNA were determined using NanoDrop2000 (Thermo), and the DNA was diluted to the appropriate concentration and stored at 4°C or -20°C for later use.

[0051] II. Testing Steps Step 1: Preparation / dispensing of PCR amplification system (completed in the reagent preparation area) Prepare the PCR amplification system according to the components in the table below. After vortexing and mixing, dispense 19 μL into each tube according to the number of samples.

[0052] Step 2: Add the template (completed in the specimen preparation area or fume hood) Add 1 μL of each prepared clinical DNA sample to the corresponding PCR reaction tube. At the same time, set up quality control controls (quality control: 1 μL quality control product, negative control: 1 μL nucleic acid-free pure water).

[0053] Step 3: PCR amplification (completed in the amplification region) Place each reaction tube into the reaction chamber of the PCR amplification instrument and set the reaction volume to 20 μL.

[0054] Follow the reaction procedure below to set up and amplify PCR: Step 4: Detection of amplified products (completed in the product detection laboratory) Prepare the loading mixture of molecular weight internal standard and deionized formamide: (0.2 μL molecular weight internal standard + 8.8 μL formamide) × number of samples to be tested. Vortex to mix for 10-15 seconds. Use a pipette to dispense 9 μL of the deionized formamide and internal standard mixture into each test well. Add 1 μL of the amplification product (stock solution) to the deionized formamide and internal standard mixture, and cover with the sealing tape. Perform the test according to the steps in the genetic analyzer user manual.

[0055] Step 5: Data Analysis After the genetic analyzer completes the test, GeneMapper software is used to analyze the raw data (.fsa file) from the test.

[0056] Step 6: Interpretation of Results To interpret the test results, it is necessary to first interpret the results of each control sample to determine whether there is any contamination or abnormality in the quality control materials (see quality control test results). Figure 2 The negative control should only show an indicator peak, and the quality control should show the corresponding target peak within each detection panel and bin, in addition to a normal indicator peak. Then, each test result should be checked to determine whether any product peaks exceed the instrument's detection peak height threshold. If such a situation occurs, contamination investigation, reagent quality investigation, and product re-dilution and retesting should be carried out accordingly.

[0057] Once the experimental quality control checks are completed and the results meet the standards, the clinical samples can be interpreted. If no peak is observed for the human internal reference target, it indicates an abnormality in the sampling. The corresponding results should not be interpreted, and the sample should be resampled.

[0058] The presence of a peak at the target of the human internal reference indicates successful sampling. Based on this, the status of pathogen infection and drug resistance genes in the sample can be determined.

[0059] Interpretation of pathogens: 1) If a product peak appears within the range of the general bacterial detection panel and the product peak is within the bin range, it indicates that there may be an infection by a pathogen within the detection range of this kit, and then a specific infection interpretation can be performed. a) If the peak height of the detected target is greater than the peak height of the corresponding IntFC2 indicator peak, it indicates the presence of a corresponding bacterial infection; b) If the peak height of the detected target is greater than the peak height of the corresponding IntFC1 indicator peak but less than the peak height of the corresponding IntFC2 indicator peak, it can only be determined that there may be a corresponding bacterial infection. Sample enrichment is required for further detection and determination, or the sampling time can be delayed before detection and determination. c) If the peak height of the detection target is lower than the peak height of the corresponding IntFC1 indicator peak, it can be determined that no corresponding bacterial infection was found within the detection range, and further investigation is needed to determine whether there are other pathogen infections outside the detection range.

[0060] 2) If a product peak appears in the panel range of the bacterial universal detection but not in the corresponding bin range, it can be determined that there is infection by other pathogens within the non-specific target detection range, and other methods can be used to further identify the corresponding pathogens.

[0061] 3) If no product peak is detected within the panel range for bacterial testing, it can be determined that no pathogen infection was found in this sample.

[0062] Interpretation of drug resistance genes: 1) If the peak height in the drug resistance gene detection target range is greater than the peak height of the corresponding IntHC2 indicator peak, it indicates that there is an infection containing the corresponding drug-resistant pathogen. 2) If a peak height is greater than the corresponding IntHC1 indicator peak height but less than the corresponding IntHC2 indicator peak height within the target range of drug resistance gene detection, it can only be determined that there may be a pathogen infection containing the corresponding drug resistance gene. Sample enrichment is required for further detection and determination, or the sampling time can be delayed before detection and determination. 3) If the peak height in the drug resistance gene detection target range is lower than the corresponding IntHC1 indicator peak height, it can be determined that no pathogen infection containing the corresponding drug resistance gene was found in the detection range, and further investigation is needed to check whether there are other drug-resistant pathogen infections outside the detection range.

[0063] Comprehensive interpretation: 1) If the pathogen panel does not confirm infection (pathogen interpretation 3), and if the drug resistance gene is positive or weakly positive (drug resistance gene interpretation 1) and 2), it is necessary to further determine whether there is contamination or infection by other pathogens containing the corresponding drug resistance gene outside the panel; if the drug resistance gene is not positive (drug resistance gene interpretation 3), it can be determined that the sample does not have infection by pathogens containing the corresponding drug resistance gene within the panel range. 2) If the pathogen panel confirms the presence or suspected presence of infection (indication of pathogen 1) and 2), and if the resistance gene is positive or weakly positive (indication of resistance gene 1) and 2), then the sample can be judged to be infected with pathogens containing the corresponding resistance gene within the panel range; if the resistance gene is not positive (indication of resistance gene 3), then the sample can be judged to be infected with pathogens that do not contain the corresponding resistance gene within the panel range.

[0064] Example 3: Evaluation of the reagent kit's detection performance Compared to commercially available kits, a significant advantage of this application is that it can simultaneously detect one or more pathogens causing human respiratory infections, as well as potential drug resistance genes, in a single tube.

[0065] To further demonstrate the performance of this reagent kit, this embodiment will describe it from three aspects: accuracy, specificity, and sensitivity, as detailed below: 1. Accuracy testing To verify the accuracy of the kit, this embodiment describes the positive and negative concordance rates. This experiment uses the kit and detection procedure prepared in Example 2 to test 15 clinical nasopharyngeal swab samples or plasmid mixture samples whose results had been confirmed by other kits or methodologies. The amplification results of the kit are shown in the table below: As can be seen from the test results table, the results of the three replicates using the above-mentioned kit were consistent and in line with known results. The positive and negative concordance rates were both 100%, indicating that the kit described in this application has good accuracy and can accurately detect samples.

[0066] 2. Specific detection The kit described in this application targets pathogens and drug resistance genes. To ensure specificity, the CE method was used for cross-testing during the screening process, and the results were compared with the dye method (KAPA SYBR® FAST qPCR Master Mix Kit, purchased from Roche). This dual testing verified the effectiveness of each detection primer in detecting other targets. The pathogens used in the experiment included Escherichia coli, Staphylococcus aureus, Acinetobacter baumannii, Pseudomonas aeruginosa, Streptococcus pneumoniae, Klebsiella pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Bordetella pertussis, Legionella pneumophila, Serratia marcescens, Streptococcus agalactiae, Enterobacter cloacae, Streptococcus pyogenes, Klebsiella pneumoniae, Klebsiella pneumoniae, Stenotrophomonas maltophilia, Bordetella parapertussis, Proteus vulgaris, Proteus mirabilis, Citrobacter freundii, Citrobacter kirilowii, and other respiratory pathogens that may cause infection (each strain came from ATCC, Beina Biotechnology, the Microbial Strains Center of the Institute of Microbiology, Chinese Academy of Sciences, and clinical isolates from hospitals).

[0067] For detailed results, please see [link / details]. Figure 3 Also showing some CE markings ( Figure 3 -A) and qPCR results ( Figure 3 -B), the results analysis showed that the test kit of this application can accurately distinguish between pathogens and drug resistance gene targets within the detection range of the kit, but there is no non-specific amplification for pathogens outside the detection range of the kit. In the cross-detection of drug resistance genes, no non-specific amplification was found either. Therefore, the kit of this application has high specificity.

[0068] 3. Sensitivity Testing To test the detection sensitivity of the kit described in this application, the approximate range of the limit of detection was determined based on previous experiments. Based on this, DNA or plasmids from each positive bacterium were selected for this experiment, and the samples were analyzed at a ratio of 5 × 10⁻⁶. 1 Copy / ul, 7.5×10 1 Copy / ul, 1×10 2 Copy / ul, 2.5×10 2 Copy / ul, 5×10 2 Copy / ul, 1×10 3 The samples were diluted using a copy / ul concentration gradient and mixed with 10 ng of human genomic DNA. The kit was used to amplify each concentration gradient sample five times and then detected.

[0069] Based on the test results, the average peak heights of each detection peak at different concentrations were analyzed. Some test results are shown below. Figure 4 .from Figure 4 It can be seen that when the template sample size is 10 2At copy numbers and above, the average peak height of each target is above the corresponding indicator peaks IntFC2 (1000 rfu) or IntHC2 (1500 rfu), enabling a relatively clear interpretation of pathogen detection. Therefore, the system described in this application can stably detect various pathogens and drug resistance genes with template amounts of 100 copies, and can also provide indication for pathogens with copies as low as 75, demonstrating good sensitivity.

[0070] Example 4: Clinical Sample Testing This embodiment uses the kit of this application to amplify and detect clinical samples. The detection of pathogens within the kit panel is compared with NGS / Sanger sequencing results and clinical culture results. The detection of drug resistance genes within the kit panel is compared with drug susceptibility and NGS / Sanger sequencing results. This demonstrates the actual use and detection performance of the kit, and further evaluates the effectiveness, specificity, and accuracy of the re-amplification system and kit of this application.

[0071] Following the clinical sample collection, transportation, and storage guidelines, specimens with positive clinical diagnoses of respiratory tract infection, positive drug resistance (detected by other methods), or suspected respiratory tract infection (negative for both respiratory infection detection kits and clinical culture, but exhibiting clinical symptoms of respiratory infection) were collected. DNA was extracted from the processed clinical samples using the Kangwei Century Pathogenic Microorganism Genomic DNA Extraction Kit, following the kit's instructions. The prepared DNA samples were then analyzed for quality and concentration using a NanoDrop2000 (Thermo) and stored at 4°C for later use.

[0072] The extracted clinical samples were amplified and tested according to Example 2, and the test results are compared as follows: Note: "+" indicates a peak or a positive result, "-" indicates no peak or a negative result. This kit has been tested on clinical samples and compared with different methods, demonstrating that it has high sensitivity and accuracy. It can not only accurately detect clinical samples, but also indicate the presence of other pathogens outside the detection range.

[0073] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of this application, and are not intended to limit it. Although this application has been described in detail with reference to the foregoing embodiments, it should be understood in the art that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of this application.

Claims

1. A primer composition for amplifying respiratory pathogens and drug resistance genes based on capillary electrophoresis, characterized in that, The primer composition targets respiratory pathogens and drug resistance genes; The respiratory pathogens include Pseudomonas aeruginosa, Acinetobacter baumannii, Klebsiella pneumoniae, Escherichia coli, Streptococcus pneumoniae, Staphylococcus aureus, Haemophilus influenzae, and Moraxella catarrhalis; the drug resistance genes include blaKPC gene, blaNDM gene, blaIMP gene, mecA gene, vanA gene, vanB gene, mcr gene, CTX-M gene, SHV gene, DHA gene, and CMY gene; The primer sequences are as follows: Wherein, R, S, and Y are degenerate bases, representing G / A, C / G, and C / T, respectively; The primer composition further includes universal detection primers with the following sequences: Universal upstream detection primer for bacteria: AGAGTTTGATCMTGGCTCAG (SEQ ID NO.39); Universal downstream detection primers for bacteria: ATGCCTCCCGTAGGAGTYTG (SEQ ID NO.40); Wherein, M is a degenerate base, representing C / A; The primer composition further includes internal control primers with the following sequence: upstream primer for human internal reference gene 1 detection: ATCAGCTACTTTCCTGCAATGAGG (SEQ ID NO.41); Downstream detection primers for human internal reference gene 1: ATTGTACCCTTGGAGTCCAGATC (SEQ ID NO.42); upstream primer for human internal reference gene 2 detection: ATGGTGGGCATGGGTCAGACG (SEQ ID NO.43); Human internal reference gene 2 downstream detection primer: ATGTCGTCCCAGTTGGTGACG (SEQ ID NO.44).

2. The primer composition according to claim 1, characterized in that, The primers are labeled with two fluorescent markers: FAM fluorescent group labeled with FAM fluorescein and HEX fluorescent group labeled with HEX fluorescein. The FAM fluorescent group includes primers for human internal reference gene 1, bacterial detection primers, and universal detection primers; The HEX fluorescent group includes primers for human internal reference gene 2 and primers for detecting drug resistance genes.

3. A multiplex amplification detection kit for common respiratory pathogens and drug resistance genes, characterized in that, Includes the primer composition according to any one of claims 1-2.

4. The reagent kit according to claim 3, characterized in that, The kit further includes: hot-start Taq DNA polymerase, UDG enzyme and 2×PCR amplification buffer, quality control, nuclease-free purified water and internal standard QD550nh.

5. The use of the primer composition according to any one of claims 1-2 in the preparation of a respiratory pathogen and drug resistance gene detection kit.

Images