Primer probe combination, kit and application of tomato brown rugose fruit virus taqman and emdea double system detection

Abstract

This invention discloses primer and probe combinations, kits, and applications for the dual-system detection of TobRFV (Tobacco Brown Fruit Virus) using TaqMan and EmDEA, belonging to the field of viral molecular diagnostics technology. Based on highly conserved and specific viral core target sequences selected through screening, this invention constructs primer and probe combinations suitable for both TaqMan qPCR and EmDEA detection systems. These combinations target two different genes of ToBRFV (p126 and MP), not only specifically detecting ToBRFV but also exhibiting no cross-reactivity with viruses of the same genus such as TMV, ToMV, and ToMMV, while broadly covering the vast majority of ToBRFV isolates. This invention effectively reduces the risk of missed detection in single-target detection and has significant practical application value for accurate quantification of this virus in the laboratory and rapid field quarantine.

Description

Technical Field

[0001] This invention relates to the field of viral molecular diagnostic technology, and more specifically, to primer and probe combinations, kits, and applications for the dual-system detection of TaqMan and EmDEA tomato brown wrinkled fruit virus. Background Technology

[0002] Tomato brown rugose fruit virus (ToBRFV) is a newly emerging virus that is causing increasing damage to tomato fruits. Infected tomatoes develop prominent brown, wrinkled patches, severely impacting their commercial value. ToBRFV belongs to the genus Tobacco Mosaic Virus (ToBRFV). Tobamovirus The virus (ToBRFV) is 6392 nt in length and has four open reading frames (ORFs). ORF1 contains 75-3425 nt and encodes the replicase p126; ORF2 contains 75-4922 nt and encodes the replicase p183 via a readthrough mechanism; ORF3 contains 4909-5709 nt and encodes the mobile protein MP; ORF4 contains 5712-6191 nt and encodes the capsid protein CP. This virus can be transmitted through various routes, including seeds, mechanical damage, agricultural operations, and human activity. Currently, ToBRFV has spread to more than 50 countries worldwide, posing a significant threat to the global tomato industry and has become a quarantine pest of international concern.

[0003] It is noteworthy that ToBRFV causes similar symptoms in the field to its relatives, tobacco mosaic virus (TMV), tomato mosaic virus (ToMV), and tomato mottle mosaic virus (ToMMV). Furthermore, the genomic sequence identity among these four viruses exceeds 80%. Designing primers that specifically recognize ToBRFV without cross-reacting with TMV, ToMV, and ToMMV presents a significant technical challenge in molecular detection. In addition, ToBRFV exists in various isolates, exhibiting genetic diversity. Therefore, ensuring that the detection target possesses both high specificity and broad coverage of most ToBRFV isolates is another challenge in molecular detection.

[0004] Currently, commonly used nucleic acid detection methods mainly include TaqMan qPCR for precise quantification in the laboratory, and enzyme-mediated duplex exponential amplification (EmDEA) technology suitable for field testing. In laboratory applications, SYBR Green qPCR utilizes dye binding to double-stranded DNA to generate a fluorescent signal, but it easily binds to non-specific amplification products or primer dimers, resulting in low specificity. TaqMan qPCR, on the other hand, uses sequence-specific fluorescent probes that rely on the exonuclease activity of DNA polymerase to hydrolyze the probes and release fluorescence, thus achieving higher specificity. Enzyme-mediated duplex exponential amplification (EmDEA) is a novel isothermal amplification technique. Its basic principle is to introduce a primer containing the T7 promoter into the reverse primer, amplifying the DNA template with the T7 promoter under the action of recombinase and polymerase, completing the first exponential amplification; subsequently, this DNA template is transcribed by T7 RNA polymerase to synthesize a large amount of RNA, initiating the second exponential amplification. However, the previously disclosed EmDEA patent technology has a flaw in the fluorescence signal release stage: it requires reverse transcription of the RNA generated by the second amplification into cDNA, and then RNase H cycling to cleave the RNA probe bound to the cDNA to release fluorescence. This step increases the complexity of the reaction system and delays the detection time.

[0005] Most of the primers and probes designed for detecting ToBRFV using the aforementioned nucleic acid detection methods have not been verified to be specific for TMV, ToMV, and ToMMV, potentially leading to false positives. Furthermore, because RNA viruses are highly prone to mutation during replication, existing patents often develop detection targets only for single genes, posing a risk of false negatives due to target mutations. Therefore, to overcome these shortcomings, it is necessary to screen for highly conserved viral core target sequences among ToBRFV isolates that are specific to other viruses, and to develop primers and probes compatible with both TaqMan qPCR and EmDEA methods. This would not only enable dual detection of different target regions of ToBRFV to avoid false negatives but also eliminate interference from viruses of the same genus and achieve broad-spectrum coverage of the vast majority of ToBRFV isolates. Developing such detection tools has extremely important practical application value for both accurate quantification of the virus in the laboratory and efficient and rapid quarantine in the field. Summary of the Invention

[0006] In view of the above-mentioned prior art, the purpose of this invention is to provide a primer and probe combination, kit, and application for the dual-system detection of tomato brown wrinkled fruit virus TaqMan and EmDEA.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, the present invention provides a primer-probe combination for dual-system detection of tomato brown wrinkled fruit virus (THBV) using both TaqMan and EmDEA methods, comprising: a primer-probe combination for the EmDEA detection system and a primer-probe combination for the TaqMan detection system. The primer-probe combination of the EmDEA detection system is selected from at least one of EmDEA combination 3 and EmDEA combination 11; The EmDEA combination 3 consists of the forward primer shown in SEQ ID No. 7, the reverse primer shown in SEQ ID No. 8, and the RNA probe shown in SEQ ID No. 9; The EmDEA combination 11 consists of the forward primer shown in SEQ ID No. 31, the reverse primer shown in SEQ ID No. 32, and the RNA probe shown in SEQ ID No. 33; The primer-probe combination of the TaqMan detection system is selected from at least one of TaqMan combination 3 and TaqMan combination 11; The TaqMan combo 3 consists of the forward primer shown in SEQ ID No. 7, the reverse primer shown in SEQ ID No. 48, and the DNA probe shown in SEQ ID No. 49; The TaqMan assembly 11 consists of the forward primer shown in SEQ ID No. 31, the reverse primer shown in SEQ ID No. 50, and the DNA probe shown in SEQ ID No. 51.

[0008] In practical detection applications, the same target often needs to simultaneously meet the dual requirements of accurate laboratory quantification and rapid on-site screening. Developing primers and probes that are compatible with both TaqMan and EmDEA systems can significantly reduce primer and probe synthesis costs, shorten the development cycle of detection methods, and improve the versatility and convenience of the detection process. However, due to significant differences between TaqMan and EmDEA detection technologies in terms of reaction mechanisms, temperature conditions, enzyme characteristics, and primer and probe structural requirements, the design of universal primers and probes faces numerous technical challenges. To ensure detection versatility and accuracy, primers and probes must bind to highly conserved regions of the target nucleic acid. However, the sequence length of conserved regions is limited, making it difficult to simultaneously satisfy both TaqMan and EmDEA systems, further compressing the range of effective sequences and increasing the design difficulty of dual-adaptive primers and probes.

[0009] Therefore, this invention designs a primer-probe combination for the dual-system detection of tomato brown fruit wrinkling virus (TBR) using TaqMan and EmDEA. The TBR sequences detected by the EmDEA and TaqMan detection systems are identical. The target genes of EmDEA combination 3 in the EmDEA detection system and TaqMan combination 3 in the TaqMan detection system are... P126 Genes; the forward primers of EmDEA combo 3 and TaqMan combo 3 are the same, while the reverse primer in TaqMan combo 3 has the T7 promoter sequence removed; the probe in EmDEA combo 3 is an RNA probe, while the probe in TaqMan combo 3 is a DNA probe, with the nucleotide "U" in the RNA probe replaced by the nucleotide "T".

[0010] The EmDEA combo 11 in the EmDEA detection system and the TaqMan combo 11 in the TaqMan detection system target the following genes: MP Genes; the forward primers of EmDEA combo 11 and TaqMan combo 11 are the same, while the reverse primer in TaqMan combo 11 has the T7 promoter sequence removed; the probe in EmDEA combo 11 is an RNA probe, while the probe in TaqMan combo 11 is a DNA probe. The nucleotide "U" in the RNA probe is replaced with the nucleotide "T", and the sequence length is truncated to improve the specificity of TaqMan qPCR.

[0011] Therefore, this invention achieves basic universality of primers and probes for both the EmDEA and TaqMan detection systems, with the core sequences of the primers and probes remaining consistent in both systems.

[0012] A second aspect of the present invention provides the application of the above-described primer-probe combination in (1) or (2) as follows: (1) Detection of tomato brown wrinkled fruit virus; (2) Prepare products for detecting brown wrinkled fruit virus in tomatoes.

[0013] In the above applications, the product is preferably an EmDEA kit or a TaqMan qPCR kit for detecting tomato brown wrinkled fruit virus.

[0014] A third aspect of the present invention provides a kit, said kit being an EmDEA kit, comprising at least one of EmDEA combination 3 and EmDEA combination 11.

[0015] Furthermore, the EmDEA kit also includes: reverse transcription primers.

[0016] In some preferred embodiments of the present invention, the EmDEA kit comprises: EmDEA combination 3 and 20 reverse transcription primers; The sequences of the 20 reverse transcription primers are as follows: CAGACC, ACATCC, AGATTT, ATTGCA, ATGGAC, AAGAAA, CTTAGT, AAACGG, TCGTCT, GATTAA, AAACTT, CCCCAA, TGATTT, CTGGCT, CCATAC, ATCTCA, GCCAGG, TTTCCA, GGAAAT, and TGATCG.

[0017] In some other preferred embodiments of the present invention, the EmDEA kit comprises: EmDEA combination 11 and 20 reverse transcription primers; The sequences of the 20 reverse transcription primers are as follows: GAATCT, TATTTA, GTGTAA, AGTTGC, ATTGCG, AAAAAC, TGCTGA, GGTCGG, AATTTCT, TAAATT, AATTTAG, TTACCT, TTGGAA, CTTGTT, GTTGTT, CCGTTG, CGCTAA, TTCCAC, AGGGAC, and CAGTGA.

[0018] By adding the aforementioned reverse transcription primers, the efficiency of reverse transcription is greatly improved.

[0019] Furthermore, the EmDEA kit also includes a modified RNase III. RNase III protein requires two active sites to cleave double-stranded RNA. By mutating one of these active sites, a modified RNase III containing only one active site is obtained. This modified RNase III active site can specifically recognize and cleave fluorescently labeled probes, while the inactive site binds to the target viral RNA, avoiding degradation of the target template and thus amplifying the detection signal.

[0020] This invention eliminates the reverse transcription step in the second amplification stage by using modified RNase III, simplifying the reaction process, shortening the detection time, and providing a better solution for rapid on-site detection.

[0021] In a fourth aspect, the present invention provides a kit, the kit being a TaqMan qPCR kit, comprising at least one of TaqMan combination 3 and TaqMan combination 11.

[0022] Preferably, the TaqMan qPCR kit is a dual TaqMan qPCR kit, comprising TaqMan combination 3 and TaqMan combination 11.

[0023] The method for detecting tomato brown wrinkled fruit virus using the EmDEA kit is as follows: RNA was extracted from plant tissues and added to either EmDEA combination 3 or EmDEA combination 11, reverse transcription primers, and nucleic acid amplification enzyme systems (reverse transcriptase, T4 recombinase, single-stranded DNA binding protein, DNA polymerase, creatine kinase), and signal amplification enzyme systems (T7 RNA polymerase, modified RNase III). The mixture was reacted at 42°C for 20 minutes, and the fluorescence signal Tt value was recorded. The presence of a Tt value within 20 minutes indicated a positive ToBRFV result; the absence of a Tt value indicated a negative result.

[0024] The method for detecting tomato brown wrinkled fruit virus using the TaqMan qPCR kit is as follows: RNA was extracted from plant tissues and reverse transcribed to obtain viral cDNA. Using the viral cDNA as a template, real-time quantitative PCR was performed using the TaqMan combination 3 and TaqMan combination 11. The amplification curve and cycle threshold were used to determine whether the sample carried ToBRFV. The cycle threshold was then substituted into the standard curve equation to calculate the viral load of the sample.

[0025] The beneficial effects of this invention are: (1) Based on the ToBRFV, TMV, ToMV, and ToMMV viral sequences in the existing NCBI database, this invention obtained viral target sequences that are conserved for ToBRFV but significantly different in TMV, ToMV, and ToMMV, respectively located in P126 Genes and MP Within the gene. The detection system developed for this target sequence not only achieves broad-spectrum coverage of the vast majority of ToBRFV isolates, but also shows no cross-reactivity with similar viruses such as TMV, ToMV, and ToMMV.

[0026] (2) Based on the viral target sequences obtained through screening according to this invention, DNA primer-probe combinations suitable for TaqMan qPCR and primer-RNA probe combinations with T7 promoters suitable for EmDEA can be designed and constructed, realizing the basic universality of primers and probes for the EmDEA detection system and the TaqMan detection system. This invention effectively avoids the risk of missed detection in single-gene detection and the risk of false detection of similar viruses, providing reliable technical support for the accurate quantification of ToBRFV in the laboratory and the efficient and rapid diagnosis in the field.

[0027] (3) To address the shortcomings of existing EmDEA technology in the fluorescence signal release stage: the RNA generated by the second amplification needs to be reverse transcribed into cDNA, and then RNase H is used to cyclically cleave the RNA probe bound to the cDNA to release fluorescence. This invention optimizes the EmDEA detection technology. After generating a large amount of target RNA, it innovatively uses modified RNase III to directly and specifically cyclically cleave the RNA probe bound to the target without cleaving the viral target RNA to release fluorescence. This optimized route eliminates the reverse transcription step, simplifies the reaction process, shortens the detection time, and provides a better solution for rapid on-site detection. Attached Figure Description

[0028] Figure 1 The reaction principle diagram of TaqMan and EmDEA isothermal nucleic acid detection of the present invention.

[0029] Figure 2 The TaqMan and EmDEA dual-system detection strategy and technical advantages of this invention for ToBRFV.

[0030] Figure 3 Screening of amplification efficiency for candidate EmDEA primer-probe combinations; In the figure, A represents the screening results of amplification efficiency for EmDEA combinations 1-7; B represents the screening results of amplification efficiency for EmDEA combinations 8-15.

[0031] Figure 4 Specificity analysis of ToBRFV detection using EmDEA combination 3, EmDEA combination 11, and TaqMan combination 3 and TaqMan combination 11; In the figure, A represents the specificity analysis results of EmDEA combination 3; B represents the specificity analysis results of EmDEA combination 11; C represents the specificity analysis results of TaqMan combination 3 single detection; D represents the specificity analysis results of TaqMan combination 11 single detection; E represents the specificity analysis results of TaqMan combination 3 (FAM) + TaqMan combination 11 (VIC) dual detection.

[0032] Figure 5 Copy number sensitivity test curves for EmDEA combination 3 and EmDEA combination 11; in the figure, A and B are the sensitivity test results of EmDEA combination 3 using a qPCR instrument; C and D are the sensitivity test results of EmDEA combination 11 using a qPCR instrument; E is the sensitivity test result of EmDEA combination 3 using a handheld fluorometer; F is the sensitivity test result of EmDEA combination 11 using a handheld fluorometer.

[0033] Figure 6The figures show the standard curves and real-time fluorescence amplification curves for single and dual TaqMan Combination 3 and TaqMan Combination 11 detection of samples with different copy numbers. In the figures, A is the real-time fluorescence amplification curve for single TaqMan Combination 3 detection; B is the standard curve for single TaqMan Combination 3 detection; C is the real-time fluorescence amplification curve for single TaqMan Combination 11 detection; D is the standard curve for single TaqMan Combination 11 detection; E is the real-time fluorescence amplification curve for dual TaqMan Combination 3 (FAM) + TaqMan Combination 11 (VIC) detection; and F is the standard curve for dual TaqMan Combination 3 (FAM) + TaqMan Combination 11 (VIC) detection.

[0034] Figure 7 Real-time fluorescence amplification curves of diseased sap samples at different dilutions detected by EmDEA combination 3 and 11 and single / dual TaqMan combination 3 and 11; In the figure, A is the real-time fluorescence amplification curve of diseased sap samples at different dilutions detected by EmDEA combination 3; B is the real-time fluorescence amplification curve of diseased sap samples at different dilutions detected by EmDEA combination 11; C is the real-time fluorescence amplification curve of diseased sap samples at different dilutions detected by TaqMan combination 3 alone; D is the real-time fluorescence amplification curve of diseased sap samples at different dilutions detected by TaqMan combination 11 alone; E is the real-time fluorescence amplification curve of diseased sap samples at different dilutions detected by TaqMan combination 3 (FAM) + TaqMan combination 11 (VIC) dual detection.

[0035] Figure 8 Real-time fluorescence amplification curves of single seed samples at different dilutions detected by EmDEA combination 3 and 11 and single / dual TaqMan combination 3 and 11; In the figure, A is the real-time fluorescence amplification curve of single seed samples at different dilutions detected by EmDEA combination 3; B is the real-time fluorescence amplification curve of single seed samples at different dilutions detected by EmDEA combination 11; C is the real-time fluorescence amplification curve of single seed samples at different dilutions detected by TaqMan combination 3 alone; D is the real-time fluorescence amplification curve of single seed samples at different dilutions detected by TaqMan combination 11 alone; E is the real-time fluorescence amplification curve of single seed samples at different dilutions detected by TaqMan combination 3 (FAM) + TaqMan combination 11 (VIC) dual detection.

[0036] Figure 9Real-time fluorescence amplification curves of field-grown tomato plant samples detected by EmDEA combination 3 and 11 and dual TaqMan combination 3 and 11; In the figure, A is the real-time fluorescence amplification curve of field-grown tomato plant samples detected by EmDEA combination 3; B is the real-time fluorescence amplification curve of field-grown tomato plant samples detected by EmDEA combination 11; C is the real-time fluorescence amplification curve of field-grown tomato plant samples detected by dual TaqMan combination 3 (FAM) + TaqMan combination 11 (VIC). Detailed Implementation

[0037] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0038] To enable those skilled in the art to more clearly understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments. If specific experimental conditions are not specified in the embodiments, they are generally based on conventional conditions or conditions recommended by the reagent company; the reagents, consumables, etc. used in the following embodiments, unless otherwise specified, can be obtained commercially. Wherein: The EmDEA detection system contains nucleic acid amplification enzyme powder (catalog number RR032-A), T7 RNA polymerase (catalog number RR032-B) in the signal amplification enzyme system, and modified RNase III (catalog number CK103) in the signal amplification enzyme system, all of which were purchased from Suzhou Jingrui Biotechnology Co., Ltd.

[0039] Example 1: Design and screening of primer-probe combinations for specific detection of ToBRFV 1. Design of primer-probe combinations for screening ToBRFV based on EmDEA The whole genome sequences of 377 ToBRFV, 111 TMV, 101 ToMV, and 29 ToMMV viruses were downloaded from the NCBI database. The sequences of these four viruses were then aligned using the MAFFT online platform, and the aligned FASTA files were obtained. Sequence analysis was performed using MEGA12. Based on the differences in the genome sequences of each virus, regions that were conserved for the 377 ToBRFV genome sequences but differed for the 111 TMV, 101 ToMV, and 29 ToMMV genome sequences were selected as candidate primers. These primers were then paired to select primer pairs capable of amplifying specific fragments within 200 bp, resulting in 15 primer pairs (Table 1). Further RNA probes specifically binding to ToBRFV were designed within the amplification regions of these 15 primer pairs (Table 1), yielding 15 EmDEA combinations.

[0040] Table 1: Primer and probe sequences in the EmDEA combo Note: The underlined sequence is the sequence of the T7 promoter; the 5' end of the ToBRFV-RNA probe is labeled with the reporter group FAM, and the 3' end is labeled with the quencher group BHQ1; according to WIPO ST.26, uracil "U" in the RNA probe is represented by "T".

[0041] The amplification effect of the 15 EmDEA combinations in Table 1 was examined using the following method: 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 1 μL of RNA probe (1 μM), and 1 μL of plasmid template containing the full-length ToBRFV sequence (1×10⁻⁶ mcg) were added. 3 Add 1 μL of dNTP (10 mM) and buffer to a mixture containing T7 RNA polymerase in the nucleic acid amplification enzyme system, modified RNase III in the signal amplification enzyme system, mix, and then add to a uReader 1600 handheld fluorescence detector. Set the temperature to 42℃ and react for 20 min.

[0042] The results showed that among the 15 candidate combinations, EmDEA combination 3 and EmDEA combination 11 exhibited the best amplification efficiency and fluorescence peak time. The Tt values ​​(peak time) of EmDEA combination 3 and EmDEA combination 11 were 9.4 and 10.3, respectively, and ToBRFV could be detected within 15 minutes. Figure 3 ).

[0043] 2. Specificity verification of primer-probe combination for EmDEA detection of ToBRFV To clarify that the two highly sensitive combinations (EmDEA combination 3 and EmDEA combination 11) can specifically detect ToBRFV, we used these two combinations to detect actual samples infected with ToBRFV, TMV, ToMV, or ToMMV, respectively.

[0044] Construction of the testing system: For each of the two groups, combinations containing 20 reverse transcription DNA primers were designed for their respective amplification target regions (Table 2). Each reverse transcription primer was diluted to 400 μM and then mixed in equal proportions (the final mixture contained 20 μM of each primer).

[0045] 1 μL of the above reverse transcription primer mixture, 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 1 μL of RNA probe (1 μM), 1 μL of dNTP (10 mM), buffer, and a mixture containing nucleic acid amplification enzymes, T7 RNA polymerase from the signal amplification enzyme system, and modified RNase III from the signal amplification enzyme system were mixed together. For rapid on-site application, the above mixed reaction system was optimized and prepared into lyophilized microspheres for later use.

[0046] Table 2: Reverse transcription primer sequences for EmDEA combinations 3 and 11 The operation steps are as follows: ① Sample treatment: Take about 0.2 g of diseased leaf tissues of ToBRFV (MT018320), TMV (MH595921.1), ToMV (MZ388458.1) and ToMMV (MW373515) and add 200 μL of lysis buffer (containing 100 mM Tris-HCl, pH 8.0, 150 mM NaCl, 2 mM EDTA, 0.5% SDS, 1.5% PVP-40 and serine protease) for pretreatment by mixing.

[0047] ② Nucleic acid release: The crushed sample was then treated at 95°C for 5 minutes to rapidly release viral RNA, and then left to stand at room temperature for 2 minutes.

[0048] ③ Amplification detection: Subsequently, 50 μL of dilution solutions with different dilution factors were added to the lyophilized microspheres and reacted at 42℃ for 20 minutes. The fluorescence signal Tt value was recorded using a handheld fluorescence detector (uReader 1600) as the basis for the detection results.

[0049] ④ Result Interpretation and Analysis: A Tt value appearing within 20 minutes indicates a positive ToBRFV result; if no Tt value appears, the result is negative.

[0050] The results showed that EmDEA combination 3 and EmDEA combination 11 could specifically detect ToBRFV, but did not react with TMV, ToMV, or ToMMV. Figure 4 (A and B in the middle).

[0051] Therefore, either EmDEA combination 3 or EmDEA combination 11 from Table 1 are selected to construct an EmDEA detection system for specific detection of ToBRFV.

[0052] The nucleotide sequence of the amplified region of the primer pair in EmDEA combination 3 is shown in SEQ ID No. 46, as follows: 1196 AGTTCCTCTATTCGACATATCTCTCGAC1223 ACCAGTAAAAGGACCCGCAAAGAAGTCTTAGTGTCAAAGGATTTTGTATTCACAGTTTTA 1284 AATCACATTCGCACTTATCAAGCCAAGG 1311 CACTTACATACTCCAATGTTTTATCCTTTGTCGAATCAATTCGTTC 1358 AAGGGTAATTATCAACGGAGTGACTGCC 1385 .

[0053] The nucleotide sequence of the amplified region of the primer pair in EmDEA combination 11 is shown in SEQ ID No. 47, as follows: 5576 ATAATAGTGGTAATAATAGGCCGAAACC 5603 AAACAAAAACCAAAGGAAGGAA 5626 AAGGGTTTAA AAGTTAGGGTTGAGAAGG 5653 ATAATTTAATTG 5695 ATAATGAATTGGAGACTTACGTCGCCGATT 5695 .

[0054] 3. Construction and specificity validation of a TaqMan qPCR detection system based on core target sequences: (1) Construction of TaqMan qPCR detection system: The T7 promoter sequence was removed from the reverse primers in EmDEA combination 3 and EmDEA combination 11, respectively, and the RNA probe was replaced with a DNA probe (that is, the nucleotide "U" in the RNA probe was replaced with the nucleotide "T"). At the same time, the sequence length was truncated to improve the specificity of TaqMan qPCR. Thus, the primer and probe combinations TaqMan combination 3 and TaqMan combination 11 for TaqMan qPCR detection system were constructed.

[0055] When constructing a dual TaqMan qPCR assay, it is necessary to further replace the fluorescent group FAM in TaqMan Combination 11 with VIC.

[0056] The specifics are shown in Table 3.

[0057] Table 3: Sequences of different primer pairs and probes detected by TaqMan (2) Specificity verification: TaqMan qPCR specificity detection was performed using a qPCR instrument (LightCycle 96). The mixture was prepared in qPCR tubes according to Table 4. 1 μL of cDNA containing reverse-transcribed from actual samples of ToBRFV, TMV, ToMV, or ToMMV was added to the above reaction system. The qPCR reaction was performed according to the conditions in Table 5, and single and double specificity detections were performed for TaqMan combination 3 and TaqMan combination 11, respectively.

[0058] Table 4: TaqMan qPCR Detection System Table 5: TaqMan qPCR Detection Procedure Single and double TaqMan qPCR results showed that typical S-shaped amplification curves appeared in reaction tubes containing only ToBRFV cDNA templates, while no amplification signals were observed in reaction tubes using TMV, ToMV, or ToMMV cDNA as templates, or in the blank control group. These results indicate that the adjusted combinations 3 and 11 are also specific in the TaqMan qPCR detection system. Figure 4 (C, D, and E in the middle).

[0059] Example 2: Sensitivity Assessment 1. Copy number sensitivity test: (1) Sensitivity test of the EmDEA detection system 1 μL of the full-length ToBRFV sequence plasmid (3 × 10⁻⁶) 9 (Copy / μL) was serially diluted with ultrapure water to obtain 3×10⁻⁶ copies / μL. 5 3×10 4 3×10 3 3×10 2 Diluents of 3×10⁻³ and 3 copies were prepared. Different concentrations of the above diluents were added to the lyophilized microspheres and mixed thoroughly. To verify compatibility across different application scenarios, amplification was performed using both a qPCR instrument and a uReader 1600 handheld fluorescence detector. Reaction conditions were set at 42℃. The qPCR instrument collected fluorescence signals every 30 seconds for 30 minutes; the handheld fluorescence detector collected fluorescence signals every minute for 20 minutes.

[0060] The results showed that, using qPCR instruments, the detection limits of EmDEA combination 3 and EmDEA combination 11 reached 3 copies / μL; using a handheld fluorescence detector, the detection limits of both EmDEA combination 3 and EmDEA combination 11 reached 30 copies / μL. Figure 5 (and Table 6).

[0061] Table 6: Results of sensitivity tests for 3 and 11 copy numbers of EmDEA primer pairs (Note: ND indicates Not Detected; " / " indicates that no detection was performed at this concentration.) (2) Sensitivity testing of single and dual TaqMan qPCR detection systems Simultaneously, qPCR detection was performed using TaqMan combined 3-FAM and TaqMan combined 11-VIC plasmids, with 1 μL of the full-length ToBRFV sequence (3 × 10⁻⁶). 9 (Copy / μL) was serially diluted with ultrapure water to obtain 3×10⁻⁶ copies / μL. 8 Prepare serial dilutions of 3 copies each in qPCR tubes according to Table 4, and add different copy numbers of dilutions for detection.

[0062] The results showed that the limit of detection for single-channel TaqMan qPCR with FAM or VIC fluorescence acquisition, as well as dual-channel TaqMan qPCR with dual acquisition, could reach 3 copies / μL. This study used serially diluted standards (3×10⁻⁶) 8 A standard curve was constructed at 3 × 10 copies / μL. Figure 6 (and Table 7), which can be used for precise quantification of ToBRFV.

[0063] Table 7: Results of copy number sensitivity assays for single and double TaqMan qPCR (Note: ND indicates Not Detected) 2. Sensitivity test of diseased sap (1) Sensitivity of EmDEA system for detecting diseased sap Procedure: Take approximately 0.2 g of ToBRFV diseased leaf tissue and add 200 μL of lysis buffer (containing 100 mM Tris-HCl, pH 8.0, 150 mM NaCl, 2 mM EDTA, 0.5% SDS, 1.5% PVP-40, and serine protease) for homogenization. Then, incubate the homogenized sample at 95°C for 5 minutes to rapidly release viral RNA, and allow it to stand at room temperature for 2 minutes. Serially dilute the treated lysis buffer with ultrapure water to obtain 10... 4 10 5 10 6 10 7 The diluent.

[0064] Take 50 μL of dilution solutions with different dilution ratios, add them to lyophilized microspheres, react at 42℃ for 20 minutes, and record the fluorescence signal Tt value using a handheld fluorescence detector (uReader 1600).

[0065] Result interpretation: A Tt value appearing within 20 minutes is considered a positive ToBRFV result; the absence of a Tt value indicates a negative result. Results showed that both EmDEA combination 3 and EmDEA combination 11 could detect a 10% dilution. 6 The diseased sap sample (times) Figure 7 (and Table 8).

[0066] (2) Sensitivity of TaqMan qPCR system for detecting diseased sap Procedure: Take approximately 0.2 g of ToBRFV diseased leaf tissue, add 200 μL of the above lysis buffer, and homogenize. Incubate at 95℃ for 5 minutes, then let stand at room temperature for 2 minutes to extract viral RNA. Reverse transcription is performed using HiScriptII Q RTSuperMix for qPCR (Vazyme, R222) with random primers (reaction system contains 2 μL reverse transcriptase and 8 μL viral RNA). The reverse transcription program is completed in a PCR instrument (50℃ for 15 minutes, followed by 85℃ for 5 seconds) to obtain viral cDNA. Subsequently, the viral cDNA is serially diluted with ultrapure water to obtain 10... 2 Up to 10 8 A serial dilution of 1:1 was performed. Single and double TaqMan qPCR detection was conducted using a qPCR instrument with TaqMan 3-FAM and TaqMan 11-VIC respectively.

[0067] Result determination: The result shows ( Figure 7 Whether performing singlet qPCR or dualt qPCR with both probes in the same reaction tube, both TaqMan 3-FAM and TaqMan 11-VIC can detect dilutions of 10⁻⁶. 7 The diseased sap samples were doubled (Table 8).

[0068] Table 8: Sensitivity test results of different systems and combinations on diluted samples of diseased sap. (Note: ND indicates Not Detected; " / " indicates that no detection was performed at this concentration.) 3. Detection sensitivity of single seed samples: Tomato brown wrinkled fruit virus is highly contagious through seeds, therefore, early detection of individual seeds has significant quarantine value.

[0069] (1) Seed detection sensitivity of the EmDEA system Procedure: One tomato seed carrying ToBRFV virus was added to 50 μL of lysis buffer (containing 100 mM Tris-HCl, pH 8.0, 150 mM NaCl, 2 mM EDTA, 0.5% SDS, 1.5% PVP-40, and serine protease) and pretreated with shaking. The treated sample was then incubated at 95°C for 5 minutes to rapidly release viral NA, and allowed to stand at room temperature for 2 minutes. Subsequently, the supernatant was serially diluted 10-fold with ultrapure water to obtain dilution 10. 4 Up to 10 times 7 Samples. Take 50 μL of dilution solution and add it to the lyophilized microspheres containing the EmDEA reaction system. React at 42℃ for 20 minutes and record the fluorescence signal Tt value using a handheld fluorescence detector (uReader 1600).

[0070] Result determination: The test results show that EmDEA combination 3 and combination 11 are diluted at 10... 4 Up to 10 times 6 Positive amplification signals were detected in all seed samples diluted 10 times (Table 9). The detection time (Tt) gradually increased with increasing dilution factor. This indicates that the detection system can effectively detect single seeds carrying ToBRFV and can detect seeds diluted 10 times. 6 Seed samples are suitable for rapid detection and screening of samples with low viral content in the field.

[0071] (2) Sensitivity of seed detection in TaqMan qPCR system Procedure: As above, one seed carrying ToBRFV virus was treated with lysis buffer and RNA was released at 95℃. Reverse transcription was then performed using HiScript II QRT SuperMix for qPCR reverse transcriptase according to the standard procedure to obtain viral cDNA. The viral cDNA was then serially diluted with ultrapure water to obtain dilutions of 10-fold to 10-fold. 8 Gradient samples were analyzed using two sets of probes, with single and double TaqMan qPCR detection performed using a qPCR instrument.

[0072] Result determination: The test results show ( Figure 8 Whether using single or double TaqMan qPCR, TaqMan combination 3 and combination 11 consistently detected up to 10% of a single infected tomato seed diluted with 10. 7 The number of samples was 10 times (Table 9).

[0073] Table 9: Sensitivity test results of different systems and combinations on single seed dilution samples (Note: ND indicates Not Detected) Example 3: Field sample testing: To verify the field application of the system of the present invention, 10 tomato plant samples confirmed to be infected with ToBRFV were randomly collected in the field and detected using EmDEA and TaqMan dual qPCR systems, respectively.

[0074] Procedure: Add 100 μL of the aforementioned lysis buffer to 10 field plant samples, vortex and homogenize, heat at 95°C to release RNA and let stand at room temperature.

[0075] EmDEA detection: Add 50 μL of diluent to microspheres containing EmDEA combination 3 or EmDEA combination 11, and detect at 42℃ for 20 minutes using a handheld fluorescence spectrometer.

[0076] TaqMan Dual qPCR Detection: The extracted RNA was reverse transcribed to obtain cDNA, which was then added to a reaction tube containing TaqMan 3-FAM and TaqMan 11-VIC probes and detected using a qPCR instrument.

[0077] Result determination: The test results show ( Figure 9 (See Table 10). All 10 samples tested using the EmDEA system and the TaqMan dual qPCR system were positive.

[0078] Table 10: Results of EmDEA and Dual TaqMan qPCR detection of diseased tomato plants in the field (Note: ND indicates Not Detected) The above results indicate that both the EmDEA system and the TaqMan dual qPCR system of this invention can effectively detect ToBRFV, and the detection results are accurate and reliable.

[0079] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. The application of the TaqMan and EmDEA dual-system detection reagent for tomato brown fruit wrinkling virus in the preparation of a kit for detecting tomato brown fruit wrinkling virus, characterized in that, The reagents include primer-probe combinations and modified RNase III; The primer-probe combination is the primer-probe combination of the EmDEA detection system and the primer-probe combination of the TaqMan detection system; The primer-probe combination of the EmDEA detection system is EmDEA combination 3 and EmDEA combination 11; The EmDEA combination 3 consists of the forward primer shown in SEQ ID No. 7, the reverse primer shown in SEQ ID No. 8, and the RNA probe shown in SEQ ID No. 9; The EmDEA combination 11 consists of the forward primer shown in SEQ ID No. 31, the reverse primer shown in SEQ ID No. 32, and the RNA probe shown in SEQ ID No. 33; The primer-probe combination of the TaqMan detection system is TaqMan combination 3 and TaqMan combination 11; The TaqMan combo 3 consists of the forward primer shown in SEQ ID No. 7, the reverse primer shown in SEQ ID No. 48, and the DNA probe shown in SEQ ID No. 49; The TaqMan combo 11 consists of the forward primer shown in SEQ ID No. 31, the reverse primer shown in SEQ ID No. 50, and the DNA probe shown in SEQ ID No. 51; The modified RNase III was purchased from Suzhou Jingrui Biotechnology Co., Ltd., product number CK103.

2. An EmDEA reagent kit, characterized in that, The EmDEA kit contains: EmDEA combo 3, 20 reverse transcription primers, and a modified RNase III; The EmDEA combination 3 consists of the forward primer shown in SEQ ID No. 7, the reverse primer shown in SEQ ID No. 8, and the RNA probe shown in SEQ ID No. 9; The sequences of the 20 reverse transcription primers are as follows: CAGACC, ACATCC, AGATTT, ATTGCA, ATGGAC, AAGAAA, CTTAGT, AAACGG, TCGTCT, GATTAA, AAACTT, CCCCAA, TGATTT, CTGGCT, CCATAC, ATCTCA, GCCAGG, TTTCCA, GGAAAT, and TGATCG; The modified RNase III was purchased from Suzhou Jingrui Biotechnology Co., Ltd., product number CK103.

3. An EmDEA reagent kit, characterized in that, The EmDEA kit contains: EmDEA combo 11, 20 reverse transcription primers, and a modified RNase III; The EmDEA combination 11 consists of the forward primer shown in SEQ ID No. 31, the reverse primer shown in SEQ ID No. 32, and the RNA probe shown in SEQ ID No. 33; The sequences of the 20 reverse transcription primers are as follows: GAATCT, TATTTA, GTGTAA, AGTTGC, ATTGCG, AAAAAC, TGCTGA, GGTCGG, AATTTCT, TAAATT, AATTTAG, TTACCT, TTGGAA, CTTGTT, GTTGTT, CCGTTG, CGCTAA, TTCCAC, AGGGAC, and CAGTGA; The modified RNase III was purchased from Suzhou Jingrui Biotechnology Co., Ltd., product number CK103.

Images