Use of proteins and related biomaterials in the production of erythritol from one-carbon substrates

Abstract

The application discloses application of a protein and related biomaterials in production of erythritol by using one-carbon as a substrate and belongs to the field of microbial synthetic biology. The technical problem solved by the application is how to improve the production efficiency of erythritol by using one-carbon as a substrate. The protein disclosed by the application is a protein with an amino acid sequence of SEQ ID No. 2 or SEQ ID No. 5, and the production efficiency of erythritol can be successfully improved after the encoding gene of the protein is introduced into microbial cells and the microbial cells are cultured. The application not only improves the production efficiency of one-carbon metabolism and the chemical product erythritol, but also significantly reduces the production of pentose phosphate and derivative products.

Description

Technical Field

[0001] This invention belongs to the field of microbial synthetic biology, specifically relating to the application of proteins and related biomaterials in the production of erythritol using one-carbon substrates. Background Technology

[0002] Four-carbon phosphate sugars, including erythrose 4-phosphate (E4P), are major components of central metabolites in organisms. These phosphate sugars participate in various biosynthetic pathways, providing the raw materials required for synthetic processes. In particular, E4P plays a crucial role in the pentose phosphate pathway (PPP). The PPP pathway not only provides reducing power (NADPH) for cells but is also the main source of pentose sugars required for nucleic acid synthesis. In this pathway, E4P can interconvert with other phosphate sugars, demonstrating its multifunctionality in metabolism.

[0003] Furthermore, E4P is a precursor for the synthesis of many important compounds. For example, E4P can be converted to erythritol under the action of erythrose phosphatase and erythrose reductase. The reaction of E4P with phosphoenolpyruvate (PEP) produces 3-deoxy-D-arabino-heptulosonate-7-phosphate (DAHP), a key step in the synthesis of shikimic acid and cladonic acids. Shikimic acid is the main raw material for the synthesis of the anti-influenza drug oseltamivir, while cladonic acids are common precursors for the synthesis of aromatic amino acids (such as tryptophan, tyrosine, and phenylalanine) and their derivatives (such as hydroxycinnamic acid and resveratrol).

[0004] Methanol-producing yeasts, such as *Pichia pastoris* or *Komagataella phaffii*, *Hansenula polymorpha*, and *Candida boidinii*, are a special class of yeasts capable of growing using methanol as their sole carbon and energy source. With advancements in metabolic engineering and synthetic biology, they have become crucial substrate cells in chemical production, particularly in the production of chemicals using methanol as a feedstock.

[0005] Methanol, as an important bulk raw material, is a renewable one-carbon feedstock due to its abundant resources and low price. It has significant applications in the production of methanol fuel, methanol-to-olefins (MTO), and methanol-to-petrochemical products. Against the backdrop of climate change and resource scarcity, the synthesis of chemicals from methanol holds enormous potential.

[0006] In *Methanolacobacterium*, the synthesis of chemicals from one-carbon feedstocks primarily relies on the xylulose monophosphate pathway (XuMP). In this pathway, formaldehyde combines with xylulose 5-phosphate (Xu5P) to generate glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone (DHA), which are then converted to fructose 6-phosphate (F6P) through a series of reactions. Fructose 6-phosphate is a key intermediate in many intracellular metabolic processes, not only providing NADPH to cells but also participating in the synthesis of polysaccharides, aminopolysaccharides, and other biomolecules. Summary of the Invention

[0007] The technical problem to be solved by this invention is how to produce erythritol using one carbon as a substrate and improve its production efficiency.

[0008] To solve the above-mentioned technical problems, the present invention first provides the application of protein in the production of erythritol, wherein the protein is as follows: A1), A2), or A3):

[0009] A1) The amino acid sequence is the protein of positions 1-406 of SEQ ID No. 2 or positions 1-395 of SEQ ID No. 5;

[0010] A2) A protein having the same function by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2 (positions 1-406) or SEQ ID No. 5 (positions 1-395);

[0011] A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

[0012] The protein in A2) above is a protein that shares 75% or more of the amino acid sequence identity with the protein shown in positions 1-406 of SEQ ID No. 2 or positions 1-395 of SEQ ID No. 5 and has the same function. Identity refers to the similarity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gapexistence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search for the identity of a pair of amino acid sequences, the identity value (%) can be obtained. The phrase "having 75% or more of the sameness" means having 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the sameness.

[0013] The tag described in A3) can be a polypeptide or protein fused with the target protein using in vitro DNA recombination technology, to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag, and / or SUMO tag, etc.

[0014] A3) The fusion protein may be as shown in SEQ ID No. 2 or SEQ ID No. 5.

[0015] The present invention also provides the use of biomaterials associated with the said protein in the production of erythritol, said biomaterials being any one of B1) to B4) below:

[0016] B1) The nucleic acid molecule that encodes the protein;

[0017] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0018] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0019] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3).

[0020] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0021] Those skilled in the art can readily mutate the nucleotide sequence encoding the protein of this invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that have 75% or higher identity with the nucleotide sequence of the protein of this invention, as long as they encode and have the function of the protein, are derived from and equivalent to the nucleotide sequence of this invention.

[0022] In the above applications, the nucleic acid molecule described in B1) can be as follows: b11), b12), or b13):

[0023] b11) The coding sequence is the DNA molecule whose positions are 1-1218 of SEQ ID No. 1 or 1-1185 of SEQ ID No. 4 in the sequence listing;

[0024] b12) The coding sequence is the DNA molecule shown in SEQ ID No. 1 or SEQ ID No. 4 of the sequence listing;

[0025] b13) has 75% or more identity with the nucleotide sequence defined by b11) or b12) and is a DNA molecule encoding the protein.

[0026] b11) The DNA molecule may be as shown in positions 1-1218 of SEQ ID No. 1 or positions 1-1185 of SEQ ID No. 4. b12) The DNA molecule may be as shown in SEQ ID No. 1 or SEQ ID No. 4.

[0027] As used herein, the term "identity" refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences having 75% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequence of the protein encoding the amino acid sequence shown in SEQ ID No. 2 (positions 1-406) or SEQ ID No. 5 (positions 1-395). Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0028] The aforementioned 75% or higher identity can be 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0029] In the above application, the expression cassette (the protein gene expression cassette) containing a nucleic acid molecule encoding the protein described in B2) refers to DNA capable of expressing the protein in a host cell. This DNA may include not only a promoter to initiate transcription of the protein-coding gene, but also a terminator to terminate transcription of the protein-coding gene. Furthermore, the expression cassette may also include an enhancer sequence.

[0030] Recombinant vectors containing the expression cassette can be constructed using existing expression vectors.

[0031] In the above applications, the vector can be a plasmid, a granule, a bacteriophage, or a viral vector. Specifically, the plasmid can be the pMPICZa vector.

[0032] B3) The recombinant vector may specifically be pMPICZ-HPSI or pMPICZ-bmmHPSI. pMPICZ-HPSI is shown in SEQ ID No. 3. The pMPICZ-HPSI expression vector can also be synthesized directly according to SEQ ID No. 3. pMPICZ-bmmHPSI is a recombinant expression vector obtained by replacing the HPSI gene in the pMPICZ-HPSI expression vector with the bmmHPSI fusion gene shown in SEQ ID No. 5.

[0033] The present invention also provides a method for producing erythritol, the method comprising: introducing the coding gene of the protein into a microbial cell to obtain a recombinant microorganism, culturing the recombinant microorganism, and obtaining erythritol.

[0034] The gene encoding the protein can be introduced into the microbial cell via an expression vector (such as pMPICZ-HPSI or pMPICZ-bmmHPSI).

[0035] In the above method, the recombinant microorganisms can be cultured using a culture system containing a one-carbon compound.

[0036] In the above method, the one-carbon compound can be methanol.

[0037] In the above method, the microbial cell may be yeast.

[0038] In the above method, the yeast can be a methylotrophic yeast. Further, the yeast can be *Ogataea polymorpha*, *Candida boidinii*, or *Pichia pastoris* or *Komagataella phaffii*.

[0039] In one embodiment of the present invention, the yeast is dKU-2AY or dKU-2AY-dSHB-TPI.

[0040] The protein in question is also within the scope of protection of this invention.

[0041] The biological materials mentioned above are also within the scope of protection of this invention.

[0042] Experiments have demonstrated that introducing the gene encoding the protein shown in SEQ ID No. 2 or SEQ ID No. 5 into yeast can successfully produce erythritol. This invention not only improves the efficiency of one-carbon metabolism and chemical production but also significantly reduces the production of pentose phosphate and its derivatives. This invention provides a new pathway for synthesizing chemicals using methanol as a renewable one-carbon feedstock, which will help promote sustainable development in the chemical production sector, reduce dependence on fossil resources, and help alleviate environmental problems.

[0043] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description

[0044] Figure 1 The results show the erythritol yield of strain dKU-2AY-HPSI.

[0045] Figure 2 Results of erythritol and ribitol production by strain dKU-2AY-HPSI.

[0046] Figure 3 The effects of HPSI genes from different sources on erythritol production.

[0047] Figure 4 These are the results of the fermenter experiment. Detailed Implementation

[0048] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following embodiments are commercially available. All quantitative experiments in the following embodiments were performed in at least three replicates, and the results were averaged.

[0049] The following examples use SPSS 11.5 statistical software to process the data, and the experimental results are expressed as mean ± standard deviation.

[0050] Example 1: HPSI heterologous expression enhances erythritol synthesis

[0051] 1. Construction of the recombinant expression vector pMPICZ-HPSI

[0052] The HPSI gene derived from *Mycobacterium gastri* MB19 was codon-optimized using the *Pichia pastoris* system. The optimized HPSI gene sequence is shown as positions 1-1218 of SEQ ID No. 1 in the sequence listing. A DNA fragment with a peroxisome targeting signal was added to the end of the gene to obtain the HPSI fusion gene shown in SEQ ID No. 1. The HPSI fusion gene shown in SEQ ID No. 1 was synthesized and assembled into the pMPICZa vector using the Gibson assembly method to obtain the pMPICZ-HPSI expression vector. The sequence of the pMPICZ-HPSI expression vector is SEQ ID No. 3 in the sequence listing. This expression vector can express the HPSI fusion protein shown in SEQ ID No. 2.

[0053] 2. Construction of dKU-2AY-HPSI strain

[0054] The expression vector pMPICZ-HPSI was linearized using PmeI. The linearized pMPICZ-HPSI was then transformed into competent cells of strain dKU-2AY by electroporation. After screening with bleomycin-resistant plates, single clones were obtained and verified using universal 5'AOX and 3'AOX primers. The correct single clones that could amplify a 1436bp band were selected and inoculated into YPD liquid medium. After culturing for 48 hours, the culture was preserved with glycerol at a final concentration of 15% to obtain strain dKU-2AY-HPSI.

[0055] 5'AOX:GACTGGTTCCAATTGACAAGC;

[0056] 3'AOX:GCAAATGGCATTCTGACATCC.

[0057] The preparation steps for strain dKU-2AY are as follows:

[0058] The starting strain dKU used was a modified strain of the methanol-producing yeast *Pichia pastoris*, which knocked out the non-homologous end joining system, effectively improving the efficiency of homologous recombination and facilitating the integration of foreign genes. Strain dKU is ΔKU70 as described in the literature. L, Mistlberger B, Ruth C, Hajek T, Hartner FS, Glieder A. Deletion of the Pichiapastoris KU70 homologuefacilitates platform strain generation for gene expression and syntheticbiology. PLoS One. 2012;7(6):e39720.doi:10.1371 / journal.pone.0039720.

[0059] The pPICHHis-2AY expression vector is a 16999bp circular double-stranded DNA. The nucleotide sequence of one strand, positions 1-15000, is SEQ ID No. 10, and positions 15001-16999 are SEQ ID No. 11. The expression vector pPICHHis-2AY was linearized using SspI. The linearized pPICHHis-2AY was then transformed into competent cells of strain dKU via electroporation. Hygromycin-resistant plates were used for selection. After single colonies emerged, colony PCR was performed using primers ALR-F, ALR-R, YidA-F, and YidA-R (ALR-F: AAAACAACTAATTATTCGAAATGTCTTCGACCTACACC, ALR-R: TCAATGATGATGATGATGATT). The amplified bands (CATCTTCTTGCTAGAGC, YidA-F:AAAACAACTAATTATTCGAAATGGCTATTAAACTCATTGC, YidA-R:TCAATGATGATGATGATGATTTAATTCAGCACATACTTCTC) were positive when the amplified bands were 849bp and 813bp respectively. Clones that could simultaneously amplify both ALR and YidA genes were selected and cultured in YPD liquid medium at 30℃ and 220rpm to obtain strain dKU-2AY.

[0060] 3. Evaluation of erythritol synthesis ability of strain dKU-2AY-HPSI

[0061] The recombinant bacterial strain dKU-2AY-HPSI and the control strain dKU-2AY were operated on according to the following steps: the strains were inoculated into YPD liquid culture medium and cultured at 30℃ and 200rpm for 48h; then the initial OD was used. 600 =5 were transferred to BSM medium and fermented in shake flasks at 30℃ and 200 rpm, with 250 μL of methanol added every 12 h during the culture. After 96 h of shake flask fermentation, the fermentation broth was centrifuged at 12000 rpm for 1 min, the supernatant was collected, filtered, and the yields of erythritol and the byproduct ribitol were determined by HPLC. The HPLC detection conditions were as follows: the high-performance liquid chromatography system used was an Agilent HPLC 1260, with a Bio-Rad Aminex HPX-87H column, a column temperature of 55℃, a mobile phase of 8 mM H2SO4, a flow rate of 0.6 mL / min, a refractive index detector (RID), and an injection volume of 10 μL.

[0062] The results show (see) Figure 1 , Figure 2 After 96 hours of fermentation, the erythritol yield of strain dKU-2AY-HPSI was 1.95 g / L, which was 20% higher than that of the control strain (1.62 g / L). Additionally, after 96 hours of fermentation, the ribitol byproduct yield of strain dKU-2AY-HPSI was 1.24 g / L, while that of the control strain dKU-2AY was 1.33 g / L. The proportion of ribitol byproduct in strain dKU-2AY-HPSI (i.e., the percentage of ribitol in the total ribitol and erythritol content) decreased from 45% to 38% compared to strain dKU-2AY.

[0063] 4. Effects of HPSI from different sources on erythritol yield

[0064] Peroxisome targeting signals were added to the ends of HPSI genes bmmHPSI, mbuHPSI, and mcaHPSI from different sources to obtain fusion genes with sequences shown in SEQ ID No. 4, 6, and 8 in the sequence listing. Each fusion gene was synthesized, and using homologous recombination, the HPSI fusion genes in the pMPICZ-HPSI expression vector were replaced with the bmmHPSI, mbuHPSI, and mcaHPSI fusion genes, respectively, to obtain recombinant expression vectors pMPICZ-bmmHPSI, pMPICZ-mbuHPSI, and pMPICZ-mcaHPSI. pMPICZ-bmmHPSI, pMPICZ-mbuHPSI, and pMPICZ-mcaHPSI contain the bmmHPSI, mbuHPSI, and mcaHPSI fusion genes shown in SEQ ID No. 4, 6, and 8, respectively, and can express the bmmHPSI fusion protein, mbuHPSI fusion protein, and mcaHPSI fusion protein shown in SEQ ID No. 5, 7, and 9, respectively.

[0065] Following the method in step 2, replace “pMPICZ-HPSI” with “pMPICZ-bmmHPSI”, “pMPICZ-mbuHPSI”, and “pMPICZ-mcaHPSI” respectively to obtain recombinant bacteria dKU-2AY-bmmHPSI, dKU-2AY-mbuHPSI and dKU-2AY-mcaHPSI respectively.

[0066] The recombinant strains dKU-2AY-bmmHPSI, dKU-2AY-mbuHPSI, and dKU-2AY-mcaHPSI, as well as the control strain dKU-2AY-HPSI, were cultured in YPD liquid culture medium at 30℃ and 200rpm for 48 hours; then, the initial OD was used... 600 =1 was transferred to BSM medium containing 10 g / L methanol and fermented in shake flasks at 30°C and 200 rpm for 20 mL. 400 μL of methanol was added after 24 h of fermentation. After 72 h of shake flask fermentation, the fermentation broth was centrifuged at 12000 rpm for 1 min, the supernatant was collected, filtered, and the yield of erythritol was determined by HPLC.

[0067] The results show (see) Figure 3The erythritol yield of the control strain dKU-2AY-HPSI was 1.75 g / L, while the erythritol yields of strains dKU-2AY-bmmHPSI, dKU-2AY-mbuHPSI, and dKU-2AY-mcaHPSI were 2.15 g / L, 0.20 g / L, and 0.17 g / L, respectively. The erythritol yield of strain dKU-2AY-bmmHPSI was further increased by 22.8% compared to the control strain dKU-2AY-HPSI.

[0068] 5. Evaluation of fermentation tank

[0069] After linearizing pMPICZ-bmmHPSI with PmeI, it was electroporated into strain dKU-2AY-dSHB-TPI to obtain dKU-2AY-dSHB-TPI-HPSI.

[0070] The preparation steps of dKU-2AY-dSHB-TPI are as follows:

[0071] The knockout fragment sequence of the SHB gene was synthesized, as shown in SEQ ID NO.12 of the sequence listing. This knockout fragment was electroporated into the dKU-2AY strain. After transformants were grown on Norilsk antibiotic selection plates, colony PCR was performed using VR-F (TGTCACGCTTACATTCACGC) and VR-SR (TCGGTGCCTTAACTTCCCAT) primers. The strain that was correctly verified was dKU-2AY-dSHB.

[0072] The pMPICK-TPI plasmid (plasmid sequence shown in SEQ ID NO.13 of the sequence listing) was linearized using PmeI and then electroporated into the dKU-2AY-dSHB strain. G418 resistance selection plates were used, and after transformants grew, they were verified using primers 5'AOX (GACTGGTTCCAATTGACAAGC) and TPI-R (GAACTCGACAGCGTTCTTGC). The correct clone was obtained by obtaining a 660bp band and named the dKU-2AY-dSHB-TPI strain.

[0073] Single colonies of strain dKU-2AY-dSHB-TPI-HPSI were picked, inoculated into 50 mL of YPD liquid medium, and cultured at 30℃ and 200 rpm for 48 h to serve as seed culture for fed-batch fermentation.

[0074] 800 mL of BSM fed-batch fermentation medium (prepared as follows: K₂SO₄ 18.2 g / L, MgSO₄·7H₂O 14.9 g / L, KOH 4.13 g / L, CaSO₄ 0.93 g / L, 85% H₃PO₄ 26.7 mL / L, balance water) was added to a 1 L fermenter. After autoclaving at 121 °C for 15 min and cooling, 0.4% (v / v) of a sterile PTM1 microsalt solution was added (FeSO₄·7H₂O 65 g / L, ZnCl₂ 20 g / L, CuSO₄·5H₂O 6 g / L, MnSO₄·H₂O 3 g / L, CoCl₂ 0.5 g / L, MoNa₂O₄·2H₂O 0.2 g / L, KI 0.09 g / L, H₃BO₃). 0.02 g / L of Biotin, 0.2 g / L of H2SO4, and the remainder being water were added, and glycerol was added to a final concentration of 20 g / L. After high-temperature sterilization, the pH was adjusted to 6.0 using ammonia water, and the dissolved oxygen level was controlled at 20%. Once the parameters reached the set values, the seed culture was inoculated into the fermenter at a rate of 5%. The fermenter temperature was controlled at 30℃, and the pH at 6.0. After approximately 16 hours of cell growth, the carbon source was depleted, and dissolved oxygen rebounded. After 2 hours of dissolved oxygen rebound, 3 mL of methanol was added for induction, and a methanol electrode and methanol feed controller were connected. The methanol balance in the fermentation broth was monitored online, and feed was added as needed, maintaining the methanol concentration in the fermentation broth at 3.0 g / L. During the methanol induction phase, the fermentation broth was sampled every 12 hours, and the OD of the fermentation broth was measured. 600 Then, centrifuge at 12000 rpm for 1 min, collect the supernatant, filter, and determine the amount of erythritol produced by HPLC. The HPLC detection conditions are as follows: the high-performance liquid chromatography system used is an Agilent HPLC 1260, with a Bio-Rad Aminex HPX-87H column, a column temperature of 55℃, a mobile phase of 8 mM H2SO4, a flow rate of 0.6 mL / min, a refractive index detector (RID), and an injection volume of 10 μL.

[0075] Fermentation results are shown in Figure 4 After 300 hours of fermentation, the yield of erythritol in the supernatant of the fermentation broth of strain dKU-2AY-dSHB-TPI-HPSI was 31.76 g / L, indicating that bmmHPSI can be used to prepare erythritol.

[0076] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. The application of protein in the production of erythritol, wherein the protein is A1), A2), or A3): A1) The amino acid sequence is the protein of positions 1-406 of SEQ ID No. 2 or positions 1-395 of SEQ ID No. 5; A2) A protein having the same function by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2 (positions 1-406) or SEQ ID No. 5 (positions 1-395); A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A2).

2. The use of a biomaterial related to the protein of claim 1 in the production of erythritol, wherein the biomaterial is any one of B1) to B4) below: B1) The nucleic acid molecule that encodes the protein; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3).

3. The application according to claim 2, characterized in that: B1) The nucleic acid molecule described is as follows: (b11) or (b12) or (b13) b11) The coding sequence is the DNA molecule whose positions are 1-1218 of SEQ ID No. 1 or 1-1185 of SEQ ID No. 4 in the sequence listing; b12) The coding sequence is the DNA molecule shown in SEQ ID No. 1 or SEQ ID No. 4 of the sequence listing; b13) has 75% or more identity with the nucleotide sequence defined by b11) or b12) and is a DNA molecule encoding the protein.

4. Methods for producing erythritol, including: The gene encoding the protein described in claim 1 is introduced into a microbial cell to obtain a recombinant microorganism, and the recombinant microorganism is cultured to obtain erythritol.

5. The method according to claim 4, characterized in that: The recombinant microorganisms were cultured using a culture system containing a one-carbon compound.

6. The method according to claim 4 or 5, characterized in that: The one-carbon compound is methanol.

7. The method according to any one of claims 4-6, characterized in that: The microbial cells are yeast.

8. The method according to claim 7, characterized in that: The yeast is a methanol-nutritive yeast; further, the yeast is *Hansenula polymorpha*, *Candida botrytis*, or *Pichia pastoris*.

9. The protein as described in claim 1.

10. The biomaterial as described in claim 2 or 3.

Images