Gna targeting etfqo gene and biological products and applications

Abstract

This invention relates to the field of crop breeding technology, specifically to a targeted method. ETFQO gRNAs of genes, biological products, and applications. The gRNA provided by this invention can efficiently knock out genes. ETFQO This invention has led to the creation of rice mutants that exhibit male sterility under low-nitrogen conditions but whose fertility can be restored under high-nitrogen conditions. This invention provides an effective molecular tool and germplasm resource for developing novel environmentally sensitive male-sterile lines and simplifying hybrid seed production procedures.

Description

Technical Field

[0001] This invention relates to the field of crop breeding technology, specifically to a gRNA targeting the ETFQO gene, its biological products, and their applications. Background Technology

[0002] As one of the world's most important food crops, continuously increasing rice yield is crucial for ensuring food security. Utilizing heterosis is an effective way to significantly increase rice yield, and the core of this technology lies in obtaining stable and efficient male-sterile lines and their corresponding maintainer lines. Traditional rice hybridization breeding mainly relies on the "three-line method" or "two-line method," in which the selection and maintenance of male-sterile lines are the key technologies.

[0003] Currently, the most widely used male sterile lines are cytoplasmic male sterile lines (CMS) or photothermosensitive male sterile lines (PTGMS). CMS requires a specific maintainer line to maintain its sterility, but this is often limited by issues such as a single source of cytoplasm, potential breeding risks, and a limited range of restorer lines. While PTGMS avoids the need for a maintainer line, its sterility is heavily dependent on specific photothermal conditions, resulting in temporal and spatial limitations in seed production, and posing significant challenges to stability and safety.

[0004] In recent years, the direct creation of nuclear male-sterile rice lines using modern biotechnology such as gene editing has become a research hotspot. By knocking out genes essential for pollen development, nuclear male-sterile lines with a clear genetic background can be obtained.

[0005] Nitrogen (N) is the primary limiting mineral nutrient element for plant growth and development. Plants can generally maintain basic fertility under low nitrogen conditions by prioritizing reproductive growth to fulfill their reproductive mission. However, the regulatory mechanisms by which plants meet the nitrogen requirements of floral organs to maintain fertility homeostasis under nitrogen starvation stress remain unclear. Plants have evolved complex genotype-environment nutrient interaction adaptation strategies, actively buffering fluctuations in external nitrogen supply and dynamically regulating nitrogen use efficiency (NUE) and nitrogen nutrient homeostasis to maximize the fulfillment of survival and reproductive needs. During the reproductive growth stage, developing florets are the main nitrogen reservoir tissue. Meeting the nitrogen requirements of floral organs is crucial for flowering and fruit setting, and nutrient homeostasis is a prerequisite for fertility and yield formation. Therefore, identifying nitrogen-dependent fertility regulatory genes is of great significance for rice breeding. Summary of the Invention

[0006] To overcome the limitations of existing sterility line technologies, this invention provides a gRNA targeting the ETFQO gene, a biological product thereof, and its applications. The gRNA provided by this invention can efficiently knock out... ETFQOThis invention has led to the creation of rice mutants that exhibit male sterility under low-nitrogen conditions but whose fertility can be restored under high-nitrogen conditions. This invention provides an effective molecular tool and germplasm resource for developing novel environmentally sensitive male-sterile lines and simplifying hybrid seed production procedures.

[0007] This invention provides a targeted ETFQO The gRNA of the gene, wherein the target sequence of the gRNA is selected from the nucleotide sequence shown in SEQ ID NO.28, SEQ ID NO.29 or SEQ ID NO.30.

[0008] This invention experimentally demonstrates that the gRNA knockout method can be used to... ETFQO The mutants obtained from the gene exhibited significant plasticity in fertility due to exogenous nitrogen concentration: they were completely aborted under low or normal nitrogen conditions, but their fertility was significantly restored under excessive nitrogen supply. This suggests that the ETF / ETFQO pathway is a key node regulating nitrogen nutrition homeostasis in plant floral organs.

[0009] The present invention also provides a product containing a target ETFQO Biological products containing gRNA of a gene, wherein the biological product is selected from any one of the following: (1) A CRISPR / Cas9 gene editing system containing the gRNA described above; (2) A recombinant expression vector containing the CRISPR / Cas9 gene editing system described in (1); (3) Genetically transformed recipient cells containing the recombinant expression vector described in (2).

[0010] The present invention also provides the application of the gRNA or the biological product described herein in regulating plant fertility, wherein the plant is a plant of the genus Osage.

[0011] Furthermore, the rice plant in question is rice.

[0012] Furthermore, the regulation of plant fertility is achieved by regulating the absorption and utilization of nitrogen.

[0013] Furthermore, the regulation of plant fertility is manifested in the following ways: in the plant, reducing the expression level and / or activity of the ETFQO protein reduces the fertility of the plant; under high nitrogen conditions, maintaining or increasing the expression level and / or activity of the ETFQO protein in the plant can significantly restore or improve the fertility of the plant.

[0014] The present invention also provides a method for cultivating nitrogen-dependent male-sterile lines, comprising using the aforementioned biological product on rice cells. ETFQO Genes were edited to obtain loss-of-function mutants, and plants exhibiting male sterility were screened under low-nitrogen conditions, i.e. nitrogen-dependent sterile lines.

[0015] Furthermore, the nitrogen-dependent sterile line is sterile under nitrogen-deficient conditions and fertile under nitrogen-abundant conditions.

[0016] This invention also provides a method for regulating plant fertility, comprising the following steps: Create nitrogen-dependent sterile lines; The fertility of the nitrogen-dependent male sterile line is regulated by controlling the nitrogen content in the culture medium. The plant in question is a member of the genus Oryza.

[0017] Furthermore, the rice plant in question is rice.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) Providing new molecular tools: designing specific targets ETFQO The gRNA of the gene provides a core editing tool for creating new rice male-sterile lines.

[0019] (2) Revealing a new mechanism: For the first time, the ETF / ETFQO pathway was identified as a "metabolic rheostat" and played a core role in regulating amino acid catabolism and optimizing nitrogen reuse to balance nitrogen allocation in floral organs, providing a new molecular mechanism explanation for plants to maintain reproductive capacity under nitrogen fluctuations.

[0020] (3) Creation of new germplasm: The etfqo mutant with nitrogen-dependent fertility phenotype was successfully created, providing new germplasm resources for the development of environmentally sensitive (especially nitrogen-sensitive) male sterile lines and "two-line hybridization" breeding.

[0021] (4) Great potential for breeding applications: This scheme does not depend on specific cytoplasm or light and temperature conditions, has strong versatility, and is expected to simplify the hybrid seed production process and improve the safety and flexibility of breeding. The ETF / ETFQO pathway dysfunctional mutants provided by this invention all exhibited sterility under low nitrogen stress, accompanied by spikelet nitrogen deficiency and significant aliphatic amino acid metabolism abnormalities; however, under high nitrogen supply conditions, the sterility phenotype of the mutants was significantly restored. Gametogenesis in the mutants showed dependence on the external nitrogen environment, and this dependence varied depending on the functional level of the corresponding proteins in the pathway. The significant nitrogen phenotypic plasticity of the mutants indicates that the ETF / ETFQO pathway can act as a "metabolic rheostat," optimizing nitrogen reuse efficiency by regulating amino acid catabolism, thereby balancing the distribution of nitrogen nutrients inside and outside the plant. In summary, the ETF / ETFQO pathway constitutes a key fault-tolerant mechanism for plants to maintain reproductive fitness and floral organ nitrogen homeostasis under nitrogen-deficient environments. This invention provides a typical example of the acquisition of plant environmental adaptability and evolutionary adaptation strategies, revealing a novel molecular regulatory mechanism for maintaining reproductive capacity in plants under fluctuating ecological conditions. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 Characterization of ETFQO protein properties; In the figure, 'a' is a schematic diagram of the ETFQO protein domain; b represents the multiple sequence alignment of rice ETFQO with homologous proteins from different species.

[0024] Figure 2 Phylogenetic tree of ETFQO protein and its orthologs in different organisms.

[0025] Figure 3 for etfqo Creation of mutants and expression analysis at the mRNA level; In the figure, a is a schematic diagram of the structure of the ETFQO gene and the three etfqo gene editing mutant alleles; the red triangles represent the deletion or insertion sites of etfqo-1, etfqo-2 and etfqo-4; b shows the mitochondrial localization of ETFQO in rice protoplasts; mitochondria are marked with red fluorescent markers, scale bar: 10 μm; c shows the expression pattern of ETFQO in wild-type (WT) anthers detected by RNA in situ hybridization; hybridization was performed using the ETFQO positive strand transcript as a probe, serving as a negative control. The abbreviations correspond to: AR (sporogen cell), E (epidermis), En (inner wall of the anther), ISPC (inner wall cell), ML (middle wall), OSPC (outer wall cell), PMC (pollen mother cell), PPC (primary wall cell), PSC (primary sporogenous cell), SC (sporogenous cell), and T (taenia). Scale bar: 5 μm;

[0026] d represents wild-type (WT) and etfqo plants grown in porous ceramics, cultured in nutrient solution, and subjected to four nitrogen gradient treatments; scale bar: 10 cm; e is a statistical graph of the seed set rate of wild type (WT) and etfqo under four nitrogen gradient treatments; the Y-axis represents the percentage of seed set rate, ns indicates no significant difference, * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001; sample size n = 20; f is a phenotypic diagram of wild-type (WT) and etfqo rice panicles; scale bar: 5 cm.

[0027] Figure 4 For three etfqo Identification of allele mutation sites; In the figure, a represents the gene structure of ETFQO and the target sequence locations of its three alleles; b represents the mutation site of etfqo-1 (a single A base insertion), sequencing peak diagram, and its abnormal protein; c represents the mutation site (single A insertion) of etfqo-2, the sequencing peak diagram, and the abnormal protein; d represents the mutation site (single T-base insertion) of etfqo-4, the sequencing peak diagram, and the abnormal protein.

[0028] Figure 5 The effect of exogenous nitrogen supply on gametogenesis in etfqo mutants; In the figure, a represents mature ovules of wild-type (WT) and etfqo mutants under three different nitrogen concentration treatments: etfqo(0N), etfqo(1N), and etfqo(3N); white arrows point to normal ovules, and white triangular arrows point to ovules without embryo sacs. Scale bar: 50 µm. b represents the ratio of normal embryo sacs to non-embryo ovules in the wild-type [WT(0N)] and etfqo mutants [etfqo(0N), etfqo(1N), etfqo(2N), etfqo(3N)] under four nitrogen concentration treatments; the Y-axis represents the corresponding ratio, and the sample size n≥30; c represents the phenotype of a single anther of etfqo(3N) at the same spikelet development stage. The left image shows a fresh anther, and the right image shows an I2-KI stained slide. The black arrows point to pollen grains in the anther, and the black triangular arrows point to traces of apoptosis. Scale bar: 0.5 mm. d represents the phenotype of a single anther of etfqo(0N) at the same spikelet development stage. The left image shows a fresh anther, and the right image shows an I2-KI stained slide. The black arrows point to pollen grains in the anther, and the black triangular arrows point to traces of apoptosis. Scale bar: 0.5 mm. e represents the in vitro germination of wild-type [WT(0N)] and etfqo(3N) pollen, scale bar: 10 µm; f represents the in vivo germination and pollen tube elongation of wild-type [WT(0N)] and etfqo(3N) pollen, scale bar: 50µm.

[0029] Figure 6 This refers to the regulatory effect of exogenous nitrogen on the initiation of meiosis in the etfqo mutant; In the figure, a is a cross section of etfqo(3N) anthers at the same developmental stage (stained with TBO); the black triangular arrow points to the abnormal apoptosis traces in the center of the anther chamber; the abbreviations correspond to: SCL (spore-forming cells) and SCLP (spore-forming cell progeny); scale bar: 5 µm; b is a cross section of etfqo(0N) anthers at the same developmental stage (stained with TBO); the black triangular arrow points to abnormal apoptosis traces in the center of the anther chamber; the abbreviations correspond to: SCL (spore-forming cells), SCLP (spore-forming cell progeny), scale bar: 5 µm; c is RBR In situ expression analysis of gene 1 in etfqo(3N) and etfqo(0N) anthers; hybridization was performed using the positive strand transcripts of RBR1 and MEL1 as probes, with negative controls. Scale bar: 5 µm. d is MEL1 In situ expression analysis of genes in etfqo(3N) and etfqo(0N) anthers; hybridization was performed using the positive strand transcripts of RBR1 and MEL1 as probes, with negative controls. Scale bar: 5 µm. e represents the protein level of RBR1 in the young spikelets of etfqo(3N) and etfqo(0N); the error bars represent the standard deviation (SD) of three independent biological replicates, **p<0.01, ***p<0.001; f represents the protein level of MEL1 in the young spikelets of etfqo(3N) and etfqo(0N); the error bar represents the standard deviation (SD) of three independent biological replicates, **p<0.01, ***p<0.001. Detailed Implementation

[0030] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0031] Example 1: gRNA design, mutant creation and phenotypic analysis targeting the ETFQO gene.

[0032] I. Experimental Materials and Methods 1. Experimental Materials This invention uses the indica rice variety 'Zhongxian 3037' as both a wild-type control and a genetic transformation recipient. The plants were hydroponically grown using a soilless nutrient solution irrigation system. 'Zhongxian 3037' was cultured in an artificial climate chamber under the following conditions: temperature 35℃, photoperiod of 10h light / 14h darkness, relative humidity approximately 70%, and photon density approximately 200 μmol·m⁻²·s⁻¹.

[0033] The indica rice variety Zhongxian 3037 is described in the article “Wang, K., Tang, D., Hong, L., Xu, W., Huang, J., Li, M., Gu, M., Xue, Y. and Cheng, Z. (2010) DEP and AFO Regulate Reproductive Habit in Rice. Plos Genetics, 6” as “Zhongxian 3037”, and is available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences.

[0034] 2. Hydroponic conditions and nitrogen gradient settings The seedlings were planted in porous ceramic (Profile, PROFILE Products LLC) and cultured using Kimura B nutrient solution, which was changed every 3 days. Kimura B nutrient solution contained macroelements [0.37 mmol / L (NH4)2SO4, 0.18 mmol / L KNO3, 0.37 mmol / L Ca(NO3)2, 0.18 mmol / L KH2PO4, 0.09 mmol / L K2SO4, 0.55 mmol / L MgSO4∙7H2O, 1.6 mmol / L Na2SiO3∙9H2O] and microelements [46.2 μmol / L H3BO3, 0.32 μmol / L CuSO4∙5H2O, 9.14 μmol / L MnCl∙4H2O, 0.08 μmol / L (NH4)6Mo7O] 24 ∙4H2O, 0.76 μmol / LZnSO4∙7H2O, 40 μmol / L Fe (II)-EDTA], pH 5.75.

[0035] To establish a nitrogen concentration gradient, (NH4)2SO4 and KNO3 were replaced with NH4NO3, and Ca(NO3)2 was replaced with CaCl2∙2H2O, while keeping the concentrations of other elements constant. The total nitrogen concentration of the standard Kimura B nutrient solution is approximately 1.64 mmol / L (0.73 mmol / L NH4⁺ and 0.909 mmol / L NO3⁻). In this invention, a nutrient solution containing 0.9 mmol / L NH4NO3 is defined as 1N (normal nitrogen), a nutrient solution containing 1.8 mmol / L NH4NO3 is defined as 2N (high nitrogen), and a nutrient solution containing 2.7 mmol / L NH4NO3 is defined as 3N (excess nitrogen). After 50 days of vegetative growth, the plants were treated with different nitrogen concentrations [0 mmol / L NH4NO3 (0N, nitrogen starvation), 0.9 mmol / L NH4NO3 (1N, normal, positive control), 1.8 mmol / L NH4NO3 (2N, high nitrogen), 2.7 mmol / L NH4NO3 (3N, excess nitrogen)]. Figure 3 (d). The hydroponic nitrogen gradient of this invention is set as 0 mmol / L NH4NO3 (0N), 0.9 mmol / L NH4NO3 (1N), 1.8 mmol / L NH4NO3 (2N) and 2.7 mmol / L NH4NO3 (3N).

[0036] 3. Creating mutants through CRISPR-Cas9 gene editing (1) Construction of gRNA expression cassette for ETFQO gene To knock out the ETFQO gene, editing was performed using the CRISPR-Cas9 system. First, three highly specific target sites with low potential off-target effects were screened in the coding region of the ETFQO gene using an online design platform (TargetDesign). The target sequences are as follows:

[0037] T1:ACCTCTCCGTCTGCGTCCTC (SEQ ID NO.28); T2:CTCGAGAAGGGCTCCGAAGT (SEQ ID NO. 29); T4:CCCCTTTACCTTAAAGCAC (SEQ ID NO. 30).

[0038] For each target sequence, a pair of complementary DNA oligonucleotide primers were designed and synthesized (see Table 1). After annealing, they were cloned into the BsaI-digested gRNA intermediate vector pSK-gRNA (Thermo Fisher, GeneArt™ CRISPR Nuclease Vector with OFP Reporter Kit, A21174). The target sequence was placed downstream of the U6 promoter to form a complete gRNA transcription unit. The correctness of the inserted sequence was verified by colony PCR and sequencing, and the recombinant vectors pSK-gRNA-etfqo-T1, pSK-gRNA-etfqo-T2, and pSK-gRNA-etfqo-T4 were constructed. Then, the gRNA expression cassette was constructed into the binary vector pCAMBIA1300 using Gateway (Thermo Fisher, pENTR / SD / D-TOPO cloning kit, K242020).

[0039] The recombinant vector was electroporated into Agrobacterium EHA105 strain, and callus induced by mature embryos of Zhongxian 3037 was transformed using Agrobacterium-mediated transformation. Transgenic plants were obtained through hygromycin selection, differentiation, and rooting. DNA was extracted, and the target region was amplified by PCR and sequenced to identify editing events. Three homozygous mutant lines were finally obtained: etfqo-1, etfqo-2, and etfqo-4. Primers for genotyping are shown in Table 1.

[0040] Table 1. CRISPR-Cas9 target sequences and corresponding genotype identification primers. Note: The lowercase bases (ggca / aaac) are adhesive linkers that are complementary to the ends of the linearized vector, and the uppercase parts are the target sequence and its reverse complementary sequence, respectively.

[0041] 4. Fruit setting rate statistics and phenotypic identification At maturity, 10 rice panicles were randomly selected, and the total number of grains and the number of filled grains in each panicle were counted to calculate the seed setting rate: Seed setting rate = number of filled grains / total number of grains. Student's t-test was used to statistically analyze the differences between WT and mutant.

[0042] Anther development observation: Young spikelets were fixed with Carnoy's fixative (ethanol: glacial acetic acid = 3:1), embedded in paraffin, sectioned, stained with toluidine blue O (TBO), and observed under an optical microscope. Pollen viability was observed using the I2-KI staining method. Specifically: Fresh young spikelets were fixed with Carnoy's fixative (ethanol: glacial acetic acid = 3:1), anthers were stained with I2-KI solution, and spikelets were dehydrated with graded ethanol and embedded in Technovit 7100 resin (Hereaus Kulzer, Wilhelm, Germany). Sample sections were prepared using a Leica microtome, stained with 0.25% toluidine blue O (TBO, Sigma-Aldrich, St. Louis, USA), and observed under an Olympus BX51 microscope.

[0043] Ovule development observation: Mature ovules were fixed with FAA fixative, dehydrated with ethanol, stained with eosin B, and cleared with methyl salicylate. The development of the embryonic sac was observed under a laser confocal microscope. The specific steps were as follows: Mature ovules were fixed with FAA fixative (ethanol:water:glacial acetic acid:formaldehyde = 4.75:3.75:0.5:1) for 10 h, washed sequentially with 70%, 50%, and 30% ethanol, and finally rinsed with distilled water; the fixed ovules were treated with 2% potassium aluminum sulfate solution for 20 min, and then stained with 10 mg / L eosin B (dissolved in 4% sucrose solution) for 10 h; after dehydration with ethanol, the ovules were transferred to an ethanol-methyl salicylate mixture (1:1) for 1 h, and then cleared overnight with pure methyl salicylate; images were acquired under a Leica TCS SP5 confocal laser scanning microscope (excitation wavelength 405 nm).

[0044] 5. Subcellular localization Using cDNA from 'Zhongxian 3037' as a template, amplification was performed using primers ETFQO-GFP-F / R (Table 1). ETFQO CDS (without a stop codon) was cloned upstream of the GFP gene in the pJIT163-GFP vector to construct a 35S::ETFQO-GFP fusion expression vector. Rice protoplasts were transformed using the PEG method and cultured in the dark at 28℃ for 20 h. The colocalization of green fluorescence and mitochondrial red fluorescent probes (such as MitoTracker Red) was observed under a laser confocal microscope.

[0045] 6. Phylogenetic tree construction and multiple sequence alignment Using the amino acid sequence of the ETF domain as the query sequence, homologous sequences were searched using PSI-BLAST and SMART (http: / / smart.embl-heidelberg.de / index2.cgi). After downloading the target sequence, a phylogenetic tree was constructed using the neighbor-joining method with MEGA5 software. Multiple sequence alignment was performed using the online tool MAFFT (https: / / toolkit.tuebingen.mpg.de / mafft), and the alignment results were visualized using ESPRIPT3 (http: / / espript.ibcp.fr / ESPript / ESPript / ).

[0046] 7. RNA in situ hybridization Fresh young spikelets were fixed with FAA fixative, dehydrated in a gradient manner, embedded in paraffin, and sectioned. Digoxin-labeled spikelets were then analyzed. ETFQO , RBR1 , MEL1 Gene-specific antisense RNA probes (primers for probe preparation are shown in Table 1) were hybridized to the slides. The signal was detected by alkaline phosphatase-conjugated anti-digoxigenin antibody, followed by NBT / BCIP staining, microscopic observation, and photographing. The specific steps are as follows:

[0047] Fresh young spikelets still encased in flag leaves were peeled from the plant and fixed in formaldehyde-acetic acid-ethanol fixative (50% v / v ethanol, 5% v / v glacial acetic acid, 3.7% v / v formaldehyde) at 4°C for 16 h. After dehydration with a gradient of ethanol (50%-60%-75%-80%-95%-100%-100%), the spikelets were treated with a series of xylene-ethanol solutions and finally embedded in paraffin (Sigma-Aldrich, St. Louis, USA). The paraffin was replaced six times to ensure adequate embedding. The paraffin blocks were cut into 8 μm sections using a Leica RM2235 rotary microtome and attached to Poly-Prep slides (Sigma-Aldrich, St. Louis, USA). The sections were hybridized with the sense or antisense probes of ETFQO, RBR1, and MEL1, respectively. The cDNA fragment lengths of the ETFQO, RBR1, and MEL1 probes were 237 bp, 213 bp, and 209 bp, respectively (counted from the transcription start codon, corresponding to nucleotide positions 554-790, 3002-3124, and 1863-2071 bp). Gene-specific fragments were obtained by PCR amplification of young spikelet cDNA. Primers containing T7 polymerase binding sites (primer sequences are shown in Table 1). The amplified fragments were cloned into the pEASY-Blunt simple vector (TransGen Biotech Ltd., Beijing). Following the kit instructions, positive and negative probes were synthesized using T7 RNA polymerase (Roche Diagnostics, Mannheim, Germany) and a digoxigenin RNA labeling kit (catalog number 11175041910, Roche Diagnostics, Mannheim, Germany). The procedures for tissue fixation, paraffin embedding, and in situ hybridization were performed according to https: / / www.its.caltech.edu / ~plantlab / protocols / insitu.html; images were acquired using CellSens Standard software under an Olympus BX51 microscope.

[0048] 8. Observation of pollen in vitro germination and pollen tube growth Fresh pollen from wild-type and etfβ mutants under different nitrogen gradient treatments (3 biological replicates) was collected and transferred to liquid germination medium [20% (w / v) sucrose, 10% (v / v) polyethylene glycol 4000, 3 mmol / L Ca(NO3)2∙4H2O, 40 mg / L H3BO3, 3 mg / L vitamin B1], and cultured at room temperature (30℃) under humid conditions for 15 min to obtain synchronously germinating rice pollen; three independent experiments were conducted. Reproductive organ observation and pollen viability testing were performed using standard methods, and images were acquired under an Olympus BX microscope.

[0049] 9. Aniline blue staining inside pollen tubes Preparation of decolorized aniline blue solution: Prepare 0.1% (w / v) aniline blue solution (Acros Organics), add 1 mol / L NaOH dropwise, and incubate overnight at 48°C until the solution turns transparent yellow. After in vivo pollination, mature florets of wild-type and etfβ mutants were pollinated with pollen from wild-type and etfβ mutants, respectively. At 10, 20, and 30 min after pollination, the pollinated pistils were removed and fixed in ethanol:glacial acetic acid (3:1) fixative at room temperature for 2 h. The fixed pistils were washed three times with distilled water (5 min each time) and then treated overnight with 1 mol / L NaOH softening solution. The pistils were then stained in decolorized aniline blue solution for 12-24 h, and slides were prepared and observed under a fluorescence microscope (excitation wavelength 405 nm / emission wavelength 440-480 nm). Images were acquired using a Zeiss 780 two-photon laser scanning confocal microscope (CLSM; Carl Zeiss).

[0050] 10. Quantitative proteomics and metabolomics analysis Both proteomics and metabolomics analyses require three independent biological replicates, with each replicate requiring 200 mg and 600 mg of fresh sample, respectively. A 9 cm long young spikelet weighs approximately 100 mg; therefore, 9 ± 1 cm long young spikelets from three different plants were collected as three independent biological replicates for wild-type, etfβ, etfqo, and etfqo etfβ double mutants under four nitrogen treatments. After grinding in liquid nitrogen, the samples were sent to Wuhan Metware Metabolomics Biotechnology Co., Ltd. (https: / / www.metware.cn / ) for sample preparation, proteomics, and metabolomics analysis.

[0051] 11. Determination of total nitrogen content Fresh young spikelets were collected and placed in glass petri dishes lined with two layers of qualitative filter paper. They were then dried in an oven at 80°C for 72 hours to fix the samples. To ensure sample homogeneity and meet the requirements for nitrogen content determination, the samples were placed in round-bottom centrifuge tubes containing steel balls and ground at a rate of 23 times / second for 50-60 minutes. The centrifuge tube size was adjusted according to the sample volume. During the grinding process, there was a 3-minute interval between every 3 minutes of grinding to avoid heat generation from sample friction. After homogenization, the nitrogen content was determined using an elemental analyzer (IsoPrime100; Elementar). All experiments were performed in triplicate.

[0052] II. Experimental Results 1. Characterization of the ETFQO gene Electron transfer flavoprotein-ubiquinone oxidoreductase (ETFQO) is a nuclear-encoded mitochondrial protein encoded by the LOC_Os10g37210 gene (abbreviated as...). ETFQO Genes encode. For example... Figure 1 As shown in a, ETFQO contains an NAD-binding domain (amino acids 46-119) and an NAD oxidase domain (amino acids 471-573). Figure 1 As shown in b, amino acid sequence alignment of rice ETFQO with homologous proteins from Arabidopsis thaliana to humans shows high overall similarity, and the two domains are highly conserved across different species. Phylogenetic analysis is as follows: Figure 2 As shown, ETFQO is an evolutionarily conserved protein across different taxa, and the numbers on the branches represent bootstrap values ​​(1,000 replicates). The figure shows rice ETFQO and its orthologs in bacteria, fungi, higher plants, and animals. The numbers between 0 and 1 below the phylogenetic tree branches (those less than 0.01 are not displayed) represent evolutionary distances, typically measured by calculating genetic variation between sequences. Shorter branches indicate smaller sequence differences, higher similarity, and closer evolutionary distances. The numbers between 1 and 100 on the branches indicate the percentage confidence level of each branch calculated using the Bootstrap method. Generally, a bootstrap value greater than 70% is considered reliable.

[0053] Figure 3 Figure b shows that ETFQO, after fusion with green fluorescent protein (GFP), is transiently expressed in rice protoplasts, indicating its localization in mitochondria. To further elucidate the spatiotemporal expression pattern of ETFQO during early panicle development, this invention performed RNA in situ hybridization analysis on spikelet cross sections. The results showed that ETFQO was significantly expressed in the four central locations of the anther locules in young anthers (ARs). As the ARs differentiated into primary sporogenous cells (PSCs) and primary wall cells (PPCs), ETFQO mRNA significantly accumulated in the primary sporogenous cells. When the anthers formed four somatic cell layers, ETFQO expression reached its peak, preferentially expressed in pollen mother cells (PMCs), with a weaker signal detected in the tapetum. Figure 3 (b-c). Subsequently, as meiosis proceeds, ETFQO expression significantly decreases. The expression pattern of ETFQO is highly consistent with that of ETFβ. Given that ETFQO is downstream of ETFβ in the ETF / ETFQO metabolic system, and that the role of ETFβ in nitrogen-dependent meiosis initiation has been confirmed, this invention hypothesizes that ETFQO, and even the entire ETF / ETFQO pathway, may play a crucial role in the early stages of meiosis and in the response of fertility to fluctuations in nitrogen nutrition.

[0054] ETFQOThe nucleotide sequence of the gene is shown in SEQ ID NO.1, its CDS sequence is shown in SEQ ID NO.2, and its encoded amino acid sequence is shown in SEQ ID NO.3.

[0055] SEQ ID NO.1:

[0056] SEQ ID NO.2:

[0057] SEQ ID NO.3: .

[0058] 2. Nitrogen phenotypic plasticity of seed setting rate in etfqo mutants To elucidate the functional association between fertility and nitrogen nutrition conditions mediated by the ETF / ETFQO system, this invention utilizes CRISPR-Cas9 technology to create three loss-of-function ETFQO allelic mutants in the 'Zhongxian 3037' background: etfqo-1, etfqo-2, and etfqo-4 (e.g., Figure 3 a and Figure 4 As shown). etfqo-1 inserts one adenine (A) in exon 1, resulting in a frameshift mutation starting from amino acid 71. The region marked by the black grid in the etfqo-1 protein structure diagram (amino acids 71-98) undergoes a frameshift. Figure 4b). etfqo-2 inserts one adenine (A) in exon 1, resulting in a frameshift mutation starting at amino acid 82. The region marked by the black grid in the protein structure diagram (amino acids 82-98) is shifted ( Figure 4 c). etfqo-4 inserts a thymine (T) in exon 16, resulting in a frameshift starting from amino acid 446. The region marked by the black grid in the protein structure diagram (amino acids 446-450) is affected by this frameshift (e.g. Figure 4 (d). All allelic mutants produce premature stop codons within or upstream of the conserved NAD oxidase domain.

[0059] Plants were grown in porous ceramic containers from the seedling stage and hydroponically cultured using Kimura B nutrient solution. During the vegetative growth stage, the three mutants showed no significant phenotypic differences from the wild type (WT). Figure 3 Given that the fertility of the etfβ mutant is sensitive to nitrogen, this invention hypothesizes that the phenotype of the etfqo mutant may be closely related to nitrogen nutrition. Normal 1× Kimura B nutrient solution contains 0.73 mmol / L NH4⁺ and 0.909 mmol / L NO3⁻; therefore, this invention defines exogenous nutrient solution containing 0.9 mmol / L NH4NO3 as 1N (normal nitrogen, positive control) and 1.8 mmol / L as 2N (high nitrogen). After 50 days of vegetative growth, the etfqo mutant was treated with different nitrogen concentrations [0N (no nitrogen), 1N, 2N] (…). Figure 3 Unlike the etfβ mutant, whose fertility was significantly restored under 2N conditions, the seed setting rate of the etfqo mutant under 2N conditions [etfqo(2N)] remained at a very low level (0.3%), with no significant difference from etfqo(0N) (0%) and etfqo(1N) (0.1%), and did not increase significantly with increasing nitrogen gradient. Figure 3 e and Figure 3 f).

[0060] Considering that ETFQO is located downstream of ETFβ in the ETF / ETFQO metabolic system and has a more important functional role than ETFβ, this invention hypothesizes that the etfqo mutant phenotype may be more severe. To verify this hypothesis, the etfqo mutant was treated with 3N (excess nitrogen, 2.7 mmol / L NH4NO3). As expected, the seed set rate of the etfqo mutant under 3N conditions increased sharply to 67% ( Figure 3 d~ Figure 3The results (f) indicate a strong positive correlation between seed setting rate and exogenous nitrogen supply, and 3N is the threshold concentration for phenotypic recovery. This further confirms that the reproductive defects of the etfqo mutant are more severe than those of etfβ, highlighting the core role of ETFQO in the pathway. The three allelic mutants showed consistent phenotypic responses to different nitrogen conditions; therefore, etfqo-1 (hereinafter referred to as etfqo) was used as the primary genetic material for subsequent studies. The consistent phenotypes of the three allelic mutants indicate that this phenotype is indeed caused by... ETFQO Caused by functional deficiency.

[0061] 3. High nitrogen dependence of gameteogenesis in etfqo mutants Given the plasticity of etfqo mutant fertility in response to nitrogen, this invention examined the viability of male and female gametes of etfqo mutants under different nitrogen gradients. Ovule development in wild-type and etfqo mutants under different nitrogen conditions was analyzed using the embryo sac clearing observation method, with a focus on extreme nitrogen treatments (0N and 3N). Results are as follows: Figure 5 As shown, over 95% of megasporocytes in etfqo(3N) developed normally into functional megasporocytes and mature embryo sacs, a proportion comparable to that of the wild-type [WT(0N)] under 0N conditions. In contrast, normal embryo sacs were almost undetectable in etfqo(0N) and etfqo(1N), and the proportion of normal embryo sacs in etfqo(2N) was less than 10%. The proportion of normal embryo sacs in the etfqo mutant increased significantly with increasing exogenous nitrogen concentration.

[0062] Furthermore, this invention compared and analyzed the anther phenotypes of etfqo mutants treated with 3N and 0N using stereomicroscopy and I2-KI staining and squashing. The anthers of etfqo (3N) were normal golden yellow, with all four locules filled with plump pollen grains. Figure 5 c); while etfqo(0N) has shrunken anthers, smaller size, and obviously no pollen ( Figure 5 (d). To further verify the pollen viability of etfqo(3N), in vitro and in vivo pollen germination experiments were conducted. The results showed that the in vitro pollen germination rate of etfqo(3N) was comparable to that of WT(0N). Figure 5 The pollen of etfqo(3N) can successfully germinate on the stigma of self-pollination and WT(0N), and the results of reciprocal crosses are consistent. Figure 5 These results collectively confirm that high nitrogen supply can completely rescue the gametogenesis defects in the etfqo mutant, highlighting its nitrogen dependence on gametogenesis. These results demonstrate that high nitrogen supply can completely rescue... etfqo The mutant has defects in its male and female gametes.

[0063] 4. High levels of exogenous nitrogen are a necessary prerequisite for the initiation of meiosis in the etfqo mutant. To investigate how exogenous nitrogen rescues gametogenesis in the etfqo mutant and to clarify the gametogenesis defect in etfqo(0N), this invention observed and compared the developmental trajectory of the etfqo mutant under two extreme nitrogen conditions (3N and 0N) using transverse sections of anthers. Results Figure 6 As shown, during the mononuclear stage, the central macronucleus of the sporogenous cells (ARs) is surrounded by a single layer of somatic cells; subsequently, it enters the binuclear stage, where the sporogenous cells differentiate into sporogenous cells (SCs) and primary wall cells (PPCs); the primary wall cells undergo one periclinal division to produce two layers of wall cells (SPCs), namely inner layer wall cells (ISPCs) and outer layer wall cells (OSPCs), entering the trinuclear stage (…). Figure 6 (a) The inner layer of parietal cells undergoes another periclinal division to produce the median (ML) and tapetum (T), completing the differentiation of the four outer somatic cells of the anther. Simultaneously, the sporogenous cells in the center of the anther chamber differentiate into pollen mother cells (PMCs), entering the tetranuclear stage. The transition from the trinuclear to the tetranuclear stage is crucial for meiosis, as this process determines whether the pollen mother cell will acquire meiotic fate. Pollen mother cells have a larger nucleus and denser cytoplasm than the outer somatic cells, and undergo the stages of leptotene, zygotene, pachytene, didit, and tetrad, ultimately forming microspores.

[0064] The observation results showed that etfqo(0N) and etfqo(3N) had no obvious abnormalities from the uninucleate to binucleate stage (Figure 6); however, when the anthers of etfqo(0N) entered the trinucleate stage, developmental abnormalities began to appear and gradually intensified with spikelet development. Figure 6 (a and b). During the trinuclear stage, although the outer three layers of somatic cells are normally arranged, the sporogenous cells (SCLs) in the center of the etfqo(ON) anther chamber are smaller, lack the typical dense cytoplasm, and stain lighter than the sporogenous cells of etfqo(3N). Subsequently, the sporogenous cells of etfqo(ON) divide to produce daughter cells with smaller nuclei, extremely thin cytoplasm, and nucleocytoplasmic separation, called sporogenous cell progeny (SCLPs). In addition, the outer four layers of cells of the etfqo(ON) anther lose their orderly arrangement and fail to form a distinct middle and tapetal layer. Later, the sporogenous cell progeny and the outer undifferentiated cells undergo apoptosis and gradually degenerate, eventually leaving only a narrow cavity surrounded by epidermal cells in the anther chamber. These results indicate that the cytological abnormalities of etfqo(ON) first appear during the trinuclear stage.

[0065] Given the excessive dependence of the anther from the trinuclear to the tetranuclear stage on the initiation of meiosis, combined with the results of anther sectioning ( Figure 6Based on (a) and (b), this invention hypothesizes that etfqo(ON) has a meiosis initiation defect. This invention uses RNA in situ hybridization to detect the expression of the meiosis marker genes RETINOBLASTOMA RELATED 1 (RBR1)² and MEIOSIS ARRESTED ATLEPTOTENE 1 (MEL1)² in etfqo(ON) and etfqo(3N). RBR1, as the "gatekeeper" of meiosis initiation, is responsible for sporogenous cell proliferation and mitosis-meiosis transition; its mRNA expression peaks during the trinuclear phase. MEL1 exhibits germ cell-specific expression, with the highest expression level during the leptotene phase, and is a reliable marker gene for pollen mother cells.

[0066] This invention compares the peak expression of RBR1 and MEL1 in etfqo(0N) and etfqo(3N). In etfqo(3N) anthers, strong RBR1 mRNA signaling was detected in trinuclear sporogenous cells, with expression patterns and intensities consistent with the wild type; while in etfqo(0N), the RBR1 mRNA signal was extremely weak and atypical, making reliable detection difficult. Figure 6 (c). Furthermore, compared to etfqo(3N), almost no MEL1 mRNA signaling above background levels was detected in the sporogenous progeny of etfqo(0N). Figure 6 (d). Simultaneously, 9 cm long etfqo(0N) and etfqo(3N) spikelets were collected for proteomics analysis. The results showed that ETFQO protein was not detected in either, confirming complete loss of ETFQO function (Figure 6); and the protein levels of RBR1 and MEL1 in etfqo(0N) were significantly lower than those in etfqo(3N). Figure 6 (e and f). These results consistently confirm, at both the mRNA and protein levels, that there is a defect in the expression of the meiosis initiation marker gene etfqo(0N).

[0067] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.

[0068] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A targeted ETFQO The gRNA of a gene is characterized by, The target sequence of the gRNA is selected from the nucleotide sequence shown in SEQ ID NO.28, SEQ ID NO.29 or SEQ ID NO.

30.

2. A type containing a targeted ETFQO Biological products containing gRNA of genes, characterized in that, The biological product is selected from any one of the following: (1) A CRISPR / Cas9 gene editing system containing the gRNA of claim 1; (2) A recombinant expression vector containing the CRISPR / Cas9 gene editing system described in (1); (3) Genetically transformed recipient cells containing the recombinant expression vector described in (2).

3. The application of the gRNA of claim 1 or the biological product of claim 2 in regulating plant fertility, characterized in that, The plant in question is a member of the genus Oryza.

4. The application according to claim 3, characterized in that, The rice species mentioned are rice plants.

5. The application according to claim 3, characterized in that, The regulation of plant fertility is achieved by regulating the absorption and utilization of nitrogen.

6. The application according to claim 5, characterized in that, The regulation of plant fertility is manifested in the following ways: in the plant, reducing the expression level and / or activity of the ETFQO protein reduces the fertility of the plant; under high nitrogen conditions, the fertility of the plant can be significantly restored or improved.

7. A method for cultivating nitrogen-dependent sterile lines, characterized in that, Including the use of the biological product of claim 2 on rice cells ETFQO Genes were edited to obtain loss-of-function mutants, and plants exhibiting male sterility were screened under low-nitrogen conditions, i.e. nitrogen-dependent sterile lines.

8. The method for cultivating nitrogen-dependent sterile lines according to claim 7, characterized in that, The nitrogen-dependent sterile line is characterized by being sterile under nitrogen-deficient conditions and fertile under nitrogen-abundant conditions.

9. A method for regulating plant fertility, characterized in that, Includes the following steps: Nitrogen-dependent sterile lines were created according to the method of any one of claims 7 to 8; The fertility of the nitrogen-dependent male sterile line is regulated by controlling the nitrogen content in the culture medium. The plant in question is a member of the genus Oryza.

10. The method for regulating plant fertility according to claim 9, characterized in that, The rice species mentioned are rice plants.

Images