His-tagged diversity nucleic acid aptamer and use thereof

By redesigning the functional modules of histidine-tagged nucleic acid aptamers, the problems of sequence monotony and stability risks in existing technologies have been solved, resulting in diverse nucleic acid aptamers with improved affinity and adaptability, making them suitable for various detection platforms.

CN122104717BActive Publication Date: 2026-08-04OCEAN UNIV OF CHINA
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
OCEAN UNIV OF CHINA
Filing Date
2026-04-28
Publication Date
2026-08-04

AI Technical Summary

Technical Problem

The existing histidine tag has a limited number of nucleic acid aptamer sequences, which makes it difficult to meet the diverse needs of different detection platforms. Furthermore, existing modification strategies have structural stability risks and limitations in improving only one performance aspect.

Method used

Using the HisA1-T63 aptamer as the initial strand, the molecular docking recognition module was used to relocate the aptamer to the loop region. Candidate sequences were screened under the constraints of structural stability and thermodynamic stability to construct diverse nucleic acid aptamers.

Benefits of technology

Multiple nucleic acid aptamers with homologous sequences but different configurations were obtained, which improved affinity and expanded the structural diversity of aptamers, making them suitable for different detection platforms, providing more recognition elements, and possessing high specificity and application adaptability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104717B_ABST
    Figure CN122104717B_ABST
Patent Text Reader

Abstract

This invention discloses diverse histidine-tagged nucleic acid aptamers and their applications, belonging to the field of bioprocessing technology. The nucleotide sequences of the diverse histidine-tagged nucleic acid aptamers are shown in SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, or SEQ ID NO. 6. The diverse histidine-tagged nucleic acid aptamers are used in the preparation of biosensor elements for targeted recognition of histidine-tagged proteins or peptides. They are also used in the qualitative analysis, quantitative detection, separation, and purification of histidine-tagged proteins or peptides. The diverse histidine-tagged nucleic acid aptamers of this invention are obtained by using the HisA1-T63 aptamer as the initial chain, initially modifying the aptamer through sequence truncation, and then repositioning the identified functional modules to the loop region for diversity modification, thus expanding the structural diversity of histidine-tagged nucleic acid aptamers.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to diverse nucleic acid aptamers with histidine tags and their applications, belonging to the field of bioprocessing technology. Background Technology

[0002] The information disclosed in this background section is intended only to enhance some understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art.

[0003] Histidine tags are short peptide sequences consisting of six histidine residues and are commonly used affinity tags. They are typically fused to the N-terminus or C-terminus of a target protein using genetic engineering techniques, via imidazole groups and Ni... 2+ Separation and purification are achieved through coordination binding with transition metal ions. Histidine tags are widely used for the efficient separation, purification, and detection of recombinant proteins due to their small molecular weight, simple structure, and good versatility in various expression systems.

[0004] Nucleic acid aptamers are oligonucleotide fragments obtained through in vitro screening that can specifically bind to targets. They are important molecular recognition elements in fields such as bioprocessing and synthetic biology. Nucleic acid aptamers achieve high-affinity recognition by folding themselves into a three-dimensional spatial structure. They have advantages such as controllable synthesis, small batch-to-batch variability, ease of modification, and low immunogenicity. In recent years, they have been widely used in fields such as biosensing, food safety detection, environmental monitoring, and disease diagnosis.

[0005] In the research and application of nucleic acid aptamers, the number of aptamers that can be successfully obtained and stably applied for specific targets is often quite limited. Existing research reports a small number of nucleic acid aptamers targeting histidine tags, resulting in a limited selection of available nucleic acid aptamer sequences. This, to some extent, restricts their application in synthetic biology and bioprocessing. Different detection platforms may have different requirements for the structural characteristics, conformational stability, and spatial configuration of nucleic acid aptamers; relying solely on a single or a few aptamer sequences often fails to meet the needs of diverse application scenarios.

[0006] Existing technologies attempt to obtain variants with superior performance by modifying known aptamers. For example, Chinese invention patent CN114752600A discloses a histidine-tagged nucleic acid aptamer that uses the 6H7-Original aptamer as the initial strand and inserts identified key fragments (fragment A and / or fragment B) into the original sequence through a "core region embedding synergy" strategy to improve affinity. However, this technology has the following limitations: First, its modification logic is "additive logic," meaning it directly inserts key segments into the original sequence. This blind insertion may lead to unpredictable changes in the overall structure of the aptamer. For example, in complex target recognition environments, the direct introduction of adjacent sites may create steric hindrance, affecting the structural stability of the aptamer itself. In this patented embodiment, the two aptamers, 6H7-ABA and 6H7-ABB, modified using this strategy, showed no good affinity with the target, indicating that simple sequence insertion has a high risk of failure.

[0007] Second, the sole technical objective of this technology is to improve the single performance metric of affinity, without considering the structural diversity of aptamers. Its technical instruction is "the higher the affinity, the better," rather than "obtaining variants with different configurations."

[0008] Third, the variant structures obtained by this technology are highly homogeneous, all of which are fragment multiplications based on the original sequence, making it difficult to meet the differentiated requirements of different detection platforms (such as different fixation methods, signal labeling strategies, and buffering systems) for aptamer configurations.

[0009] Therefore, structural modification of existing histidine-tagged nucleic acid aptamers to construct new aptamer variant sequences is of great significance for expanding the application range of histidine-tagged nucleic acid aptamers. By obtaining a series of sequence-homogeneous but conformationally different aptamer sequences, more optional recognition elements can be provided for different detection systems, thereby improving the versatility and applicability of aptamers in practical applications. Summary of the Invention

[0010] To address the aforementioned limitations of existing technologies, this invention provides diverse nucleic acid aptamers tagged with histidine and their applications. Using the HisA1-T63 aptamer as the initial strand, this invention initially improves the nucleic acid aptamer through sequence truncation. Then, it identifies the functional modules of the nucleic acid aptamer and, under constraints of structural and thermodynamic stability, repositions these functional modules within the nucleic acid aptamer structure, thereby obtaining several nucleic acid aptamers tagged with histidine and expanding the diversity of nucleic acid aptamers targeting histidine.

[0011] The technical solution adopted in this invention is as follows: In a first aspect, the present invention provides diverse nucleic acid aptamers with histidine tags.

[0012] The histidine-tagged diverse nucleic acid aptamers have nucleotide sequences as shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, or SEQ ID NO.6.

[0013] Secondly, the present invention provides a method for constructing histidine-tagged diverse nucleic acid aptamers.

[0014] The method includes the following steps: (1) Using HisA1-T63 aptamer as the initial chain, key structural regions involved in target binding were identified through molecular docking and defined as functional modules; (2) Remove the functional module from its original position and reposition it to the ring region of the aptamer; (3) Screening candidate sequences under structural stability constraints and thermodynamic stability constraints; The structural stability constraint refers to the fact that after the functional module is repositioned, the aptamer as a whole can still maintain its original secondary structural characteristics. The thermodynamic stability constraint refers to minimizing the overall Gibbs free energy of the candidate aptamer.

[0015] Further, the nucleotide sequence of the HisA1-T63 aptamer described in step (1) is shown in SEQ ID NO.1.

[0016] Further, the nucleotide sequence of the functional module described in step (1) is shown in SEQ ID NO.7.

[0017] Thirdly, the present invention provides the application of the above-mentioned histidine-tagged nucleic acid aptamers.

[0018] The application of the histidine-tagged nucleic acid aptamer in the preparation of biosensing elements for targeted recognition of histidine-tagged proteins or peptides.

[0019] Furthermore, the biosensing element is selected from detection probes, detection reagents, detection kits, or detection sensors.

[0020] The application of the diverse nucleic acid aptamers with histidine tags in the qualitative analysis, quantitative detection, or separation and purification of histidine-tagged proteins or peptides.

[0021] Furthermore, the separation and purification includes the specific capture of histidine-tagged fusion proteins from complex samples.

[0022] Compared with the related technologies known to the inventors, one of the technical solutions of the present invention has the following beneficial effects: The histidine-tagged diverse nucleic acid aptamers of this invention are obtained by using the HisA1-T63 aptamer as the initial strand, initially modifying the aptamer through sequence truncation, then identifying the functional modules of the nucleic acid aptamer, and repositioning these functional modules within the nucleic acid aptamer structure under structural and thermodynamic stability constraints. The key features are: by predicting the secondary structure of the HisA1-T63 aptamer, first truncating the sequence based on its structural characteristics, then using the identified target and aptamer action site regions as key functional modules, and repositioning these functional modules within the aptamer structure under structural and thermodynamic stability constraints, thereby obtaining multiple nucleic acid aptamers with homologous sequences but different configurations. This method of identifying key functional modules and then repositioning them within the nucleic acid aptamer structure under structural and thermodynamic stability constraints expands the structural diversity of histidine-tagged aptamers.

[0023] Compared with the variants obtained through the "core area embedded collaboration" strategy in the prior art (CN114752600A), the present invention has the following beneficial effects: First, regarding affinity, the four functional module repositioning variants (TS1-TS4) of this invention... K d The values ​​ranged from 26.3 to 53.9 nM, with TS3 and TS4 exhibiting superior affinity (28.8 nM and 26.3 nM, respectively) compared to the prior art's best variant (6H7-ABABAB). K d =0.0989 μmol / L, or 98.9 nM), the affinity is increased by about 3.4-3.8 times.

[0024] Second, regarding structural diversity, the four variants of this invention exhibit significant differences in their secondary structures (see...). Figure 4-7 While existing technologies yield variant structures with high homogeneity, this invention, through a strategy of "functional module identification-stripping-relocation + dual constraint screening," successfully obtained a set of aptamer variants with sequence homology but different configurations, providing more selectable identification elements for different detection platforms.

[0025] Third, regarding application adaptability, unlike existing technologies that focus solely on enhancing a single affinity, this invention aims to obtain a set of aptamer variants with different structural features and application potentials, providing more options for their use as recognition probes in different detection systems. The effectiveness of this technology is difficult to predict conventionally through single performance optimization modification strategies, but rather achieved through a systematic repositioning design strategy. The different conformational aptamers obtained by this invention are expected to exhibit differentiated adaptability in different application scenarios such as different immobilization methods, signal labeling strategies, or buffer systems, providing more options for their use as recognition probes. In particular, this invention verifies that the representative variant TS4 has high specificity for histidine tags (no significant binding to flag tags, KRHF, KRHW, or xylanase), possessing the application potential to specifically capture histidine-tagged fusion proteins in complex samples.

[0026] The diverse nucleic acid aptamers with histidine tags of the present invention expand the structural diversity of histidine tag aptamers, which can meet the screening and detection needs of different fusion proteins. They can be used to prepare biosensor elements for targeted recognition of histidine-tagged proteins or peptides, and can be used for qualitative analysis, quantitative detection and separation and purification of histidine-tagged proteins or peptides (especially for specific capture from complex samples). They are of great significance for the screening, detection, enrichment and purification of fusion proteins in actual bioprocessing.

[0027] The various terms and phrases used in this invention have their general meanings known to those skilled in the art. Attached Figure Description

[0028] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0029] Figure 1 Secondary structure and key sites of aptamer HisA1-T63.

[0030] Figure 2 Molecular docking simulation results of aptamer HisA1-T63 with target histidine tag.

[0031] Figure 3 Secondary structure of aptamer HisA1-T63-T.

[0032] Figure 4 Secondary structure of aptamer HisA1-T63-TS1.

[0033] Figure 5 Secondary structure of aptamer HisA1-T63-TS2.

[0034] Figure 6Secondary structure of aptamer HisA1-T63-TS3.

[0035] Figure 7 Secondary structure of aptamer HisA1-T63-TS4.

[0036] Figure 8 Affinity test results for aptamer HisA1-T63-T.

[0037] Figure 9 Affinity test results for aptamer HisA1-T63-TS1.

[0038] Figure 10 Affinity test results for aptamer HisA1-T63-TS2.

[0039] Figure 11 Affinity test results for aptamer HisA1-T63-TS3.

[0040] Figure 12 Affinity test results for aptamer HisA1-T63-TS4.

[0041] Figure 13 Results of specificity assay for aptamer HisA1-T63-TS4. Detailed Implementation

[0042] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0043] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments of the present invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, and / or combinations thereof.

[0044] The innovation of this invention does not lie in the proposal of a single design principle, but in rearranging the key structural modules for molecular docking recognition into the loop region, and constructing candidate sequence sets through structural stability constraints and free energy constraints, thereby forming a systematic and scalable aptamer repositioning design strategy to expand the diversity of aptamers for the same target.

[0045] This invention does not employ the simple 'nearest neighbor multiplication' logic found in existing technologies, because in complex target identification environments, the direct introduction of adjacent sites may generate strong spatial steric hindrance, affecting the stability of the structure itself. This invention filters candidate configurations by introducing different design constraints. This multi-dimensional filtering logic is significantly different from the single nearest neighbor stacking method in existing technologies.

[0046] The design constraints include, but are not limited to: (1) structural constraints that ensure the stability of the secondary structure of the functional unit after rearrangement; and (2) energy constraints that minimize the Gibbs free energy of the overall secondary structure of the aptamer.

[0047] The technical goal is to obtain a set of histidine tag aptamer variants with different structural features and application potential, providing more options for their use as recognition probes in different detection systems. For example, they can show potential advantages in application scenarios with different immobilization methods, signal labeling strategies, or system stability requirements. This effect cannot be expected by a single performance optimization.

[0048] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0049] Unless otherwise specified, the instruments, reagents, and materials used in the following embodiments are all conventional instruments, reagents, and materials already available in the prior art and can be obtained through legitimate commercial channels. Unless otherwise specified, the experimental methods and detection methods used in the following embodiments are all conventional experimental methods and detection methods already available in the prior art.

[0050] This invention utilizes a biomembrane interference molecular interaction analyzer to characterize and determine the affinity between nucleic acid aptamers and targets. The biomembrane interference molecular interaction analyzer is a label-free molecular interaction analysis instrument based on the principle of optical interference. This instrument employs biomembrane interference technology to monitor the binding and dissociation processes between molecules in real time by detecting changes in the thickness of the biomembrane. The specific measurement method involves anchoring biotin-labeled nucleic acid aptamers onto the sensor surface based on a biotin-streptavidin interaction immobilization strategy. During the experiment, reaction buffer, different concentrations of biotinylated nucleic acid aptamers, and different concentrations of target molecules were added to 96-well plates for detection. The instrument's programmed sequence was: sensor equilibration 60 s, nucleic acid aptamer immobilization 480 s, sensor equilibration 180 s, target binding 240 s, target dissociation 300 s, and temperature 25°C. The obtained binding-dissociation curves were fitted to obtain the affinity constant. K d value.

[0051] Example 1: Modification of HisA1-T63 aptamer The HisA1-T63 aptamer has the following nucleotide sequence: 5'-ACTGTGTGACTCCTGCAAAGGGGACTGCTCGGGATTGCGCATATTTGATTAGGGAGGGGCAGC-3', as shown in SEQ ID NO.1.

[0052] To broaden the diversity of histidine-tagged nucleic acid aptamers, the HisA1-T63 aptamer was modified: the secondary structure of the HisA1-T63 aptamer was predicted using the online analysis tool "Mfold". The secondary structure of the HisA1-T63 aptamer is as follows: Figure 1 As shown; combining the Autodock Vina molecular docking simulation software to predict the binding mode between the aptamer and the target, the key structural regions involved in target recognition were identified and defined as functional modules of the aptamer (denoted by S, where S is 5'-ACTGCTGGCAGC-3', as shown in SEQ ID NO.7). The molecular docking results are as follows. Figure 2 As shown in the figure. Based on the secondary structure and molecular docking simulation results, the HisA1-T63 aptamer was truncated, retaining the key stem-loop to obtain HisA1-T63-T, whose nucleotide sequence is shown in SEQ ID NO.2. The secondary structure of the HisA1-T63-T aptamer is shown in the figure. Figure 3 As shown. The ring region structure of the aptamer typically possesses high conformational freedom and can accommodate structural adjustments without disrupting the overall structural framework. Therefore, in this invention, the ring region of the aptamer is defined as the candidate relocation region for the functional module, and the spatial position of the functional module within the aptamer structure is relocated, thereby constructing multiple candidate aptamer sequences. The constructed candidate aptamer sequences are then screened, subject to two types of design constraints: one is structural stability constraints. Secondary structure prediction is performed on the candidate aptamer sequences, and sequences that can roughly maintain their original secondary structure characteristics after functional module relocation are selected. The other is energy constraints. By calculating the overall Gibbs free energy of the candidate aptamers, structural configurations with lower free energy are preferentially selected.

[0053] Based on the above steps, a total of one truncated intermediate (named HisA1-T63-T, its nucleotide sequence is shown in SEQ ID NO.2) and four functional module repositioning modified aptamers were obtained. Specifically, based on the principles of structure preservation and minimum free energy, two modified aptamers with no significant change in secondary structure were selected (named HisA1-T63-TS1 and HisA1-T63-TS2, their nucleotide sequences are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively, and their secondary structure diagrams are shown below). Figure 4 and Figure 5(as shown in SEQ ID NO. 5) and the two modified aptamers with the lowest free energy (named HisA1-T63-TS3 and HisA1-T63-TS4, whose nucleotide sequences are shown in SEQ ID NO. 5 and SEQ ID NO. 6, respectively, and whose secondary structure diagrams are shown in SEQ ID NO. 6, respectively). Figure 6 and Figure 7 (As shown).

[0054] The results of the biomembrane interference molecular interaction assays for the above five nucleic acid aptamers (i.e., the truncated intermediate HisA1-T63-T and the four functional module repositioning modified aptamers TS1-TS4) are shown in Table 1. The affinity determination results are as follows: Figure 8 , Figure 9 , Figure 10 , Figure 11 and Figure 12 As shown, the results indicate that the five modified nucleic acid aptamers HisA1-T63-T, HisA1-T63-TS1, HisA1-T63-TS2, HisA1-T63-TS3, and HisA1-T63-TS4 all exhibited the required affinity for the target histidine tag, and their binding constants ( K on Compared to the original aptamer ( K on =7.62×10 3 Ms -1 The improved performance indicates that the aptamer binds to the target molecule faster and the response is more rapid.

[0055] Compared with the optimal affinity variant (6H7-ABABAB) obtained through the "core region embedded collaboration" strategy in the prior art (CN114752600A), K d Compared to 0.0989 μM (i.e., 98.9 nM), the four functional module relocation improved aptamers (TS1-TS4) of this invention have... K d The values ​​range from 26.3 to 53.9 nM, with TS3 and TS4 exhibiting superior affinities (28.8 nM and 26.3 nM, respectively) compared to the best prior art variant. More importantly, the four improved aptamers of this invention show significant differences in their secondary structures (see...). Figure 4-7 The variant structures obtained by existing technologies are highly homogeneous. This indicates that the present invention, through a strategy of "functional module identification-stripping-relocation + dual constraint screening," successfully expands the structural diversity of histidine tag aptamers while maintaining or even improving affinity, providing more optional recognition elements for different detection platforms.

[0056] Table 1 HisA1-T63-T ACTGCTCGGGATTGCGCATATTTGATTAGGGAGGGGCAGC 53.1 <![CDATA[1.79×10 4 ]]> <![CDATA[9.50×10 -4 ]]> HisA1-T63-TS1 <![CDATA[ACTGCTCGGGATTGC ACTGCTGGCAGC GCATATTTGATTAGGGAGGGGCAGC]]> 41.8 <![CDATA[1.11×10 4 ]]> <![CDATA[4.64×10 -4 ]]> HisA1-T63-TS2 <![CDATA[ACTGCTCGGGATTGCGCATA ACTGCTGGCAGC TTTGATTAGGGAGGGGCAGC]]> 53.9 <![CDATA[1.65×10 4 ]]> <![CDATA[8.91×10 -4 ]]> HisA1-T63-TS3 <![CDATA[ACTGCTCGGGATTGCGCATATTTGATTAGGGAG ACTGCTGGCAGC GGGCAGC]]> 28.8 <![CDATA[1.68×10 4 ]]> <![CDATA[4.83×10 -4 ]]> HisA1-T63-TS4 <![CDATA[ACTGCTCGGGATTGCGCATATTTGATTAGGGAGG ACTGCTGGCAGC GGCAGC]]> 26.3 <![CDATA[1.74×10 4 ]]> <![CDATA[4.57×10 -4 ]]> Note: The position of functional module S (SEQ ID NO.7) in each aptamer is shown by the underline.

[0057] Example 2: Specificity determination of HisA1-T63-TS4 aptamer The affinity of the modified HisA1-T63-TS4 aptamer, which exhibits the highest affinity, for other affinity tags, short peptides, and proteases (flag tags, KRHF, KRHW, xylanase) that may be present in the detection environment was determined. Specificity results are as follows: Figure 13 As shown, the aptamer HisA1-T63-TS4 did not exhibit significant binding to the flag tag, KRHF, KRHW, or xylanase. This indicates that the aptamer HisA1-T63-TS4 possesses high specificity for histidine tags, exhibits no cross-reactivity, and has the potential for application in the specific recognition of histidine-tagged fusion proteins in complex samples (such as cell lysates containing multiple tag proteins).

[0058] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A histidine-tagged diversity nucleic acid aptamer, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5 or SEQ ID NO.

6.

2. The application of the histidine-tagged diverse nucleic acid aptamers according to claim 1 in the preparation of biosensing elements for targeted recognition of histidine-tagged proteins or peptides.

3. Use according to claim 2, characterized in that, The biosensing element is selected from detection probes, detection reagents, detection kits, or detection sensors.

4. The application of the histidine-tagged diverse nucleic acid aptamers according to claim 1 in the qualitative analysis, quantitative detection, or separation and purification of histidine-tagged proteins or peptides.

5. Use according to claim 4, characterized in that, The separation and purification process involves the specific capture of histidine-tagged fusion proteins from complex samples.