Gene knu for controlling nucellar male sterility of navel orange and application thereof

Abstract

The application discloses a gene KNU for controlling navel orange male sterility and application thereof. The nucleotide sequence of the gene KNU for controlling navel orange male sterility is shown as SEQ ID NO:1. The amino acid sequence of a protein KNU for controlling navel orange male sterility encoded by the gene KNU for controlling navel orange male sterility is shown as SEQ ID NO:2. The application identifies a key gene KNU for controlling male sterility and seedlessness from navel orange and its back-mutants. The gene KNU is a gene specifically expressed in anther somatic cells, and through a Cas9 editing mode citrus material, precise breeding of male sterility and seedless citrus can be realized. The application first provides a target gene KNU for controlling citrus male sterility and seedlessness.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering, specifically to a gene KNU that controls male sterility in navel oranges and its applications. Background Technology

[0002] Seedlessness is one of the important breeding goals for selecting superior citrus varieties. Several seedless citrus varieties have been discovered, such as navel oranges, Satsuma mandarins, seedless tangerines, and seedless Wogan mandarins. Navel oranges are one of the world's major cultivated sweet orange types, originating from a bud mutation of common sweet oranges. Male sterility is the main reason why navel oranges eventually become seedless. However, due to the long juvenile stage of citrus, its complex genetic background, and the influence of polyembryonic factors, key genetic loci for effectively controlling male sterility in navel oranges have not been identified, making it difficult to truly utilize seedless resources in breeding. Summary of the Invention

[0003] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a gene KNU for controlling male sterility in navel oranges and its applications. This invention identifies the key gene KNU controlling male sterility and seedlessness in navel oranges and their reverting mutants. The KNU gene is specifically expressed in anther mother cells, and male sterility and seedless citrus breeding can be achieved through Cas9 editing of the citrus fruit, specifically the *Citrus medica*. This invention provides for the first time a target gene KNU for controlling male sterility and seedlessness in citrus.

[0004] To achieve the above objectives, the technical solution designed by the present invention is as follows: This invention provides a gene KNU for controlling male sterility in navel oranges, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0005] The present invention also provides a control protein KNU for male sterility in navel oranges encoded by the gene KNU that controls male sterility in navel oranges, the amino acid sequence of which is shown in SEQ ID NO: 2.

[0006] The present invention also provides a primer pair for obtaining the KNU sequence of the gene controlling male sterility in navel oranges, wherein the primer pair is: CsKNU-F: 5'-ATGGCAGACCCTAACATGTACA-3' (SEQ ID NO: 5); CsKNU-R: 5'-TTATAAACGGAGATTGAGATCAACT-3' (SEQ ID NO: 6).

[0007] The present invention also provides a gene editing vector for controlling the male sterility gene KNU in navel oranges, wherein the editing vector is proYAO-Cas9-NOS-sgRNA; The gene editing vector contains an sgRNA target sequence that targets the gene KNU, which controls male sterility in navel oranges, inserted into the proYAO-Cas9-NOS vector.

[0008] Furthermore, the target sequence sgRNA is either sgRNA1 or sgRNA2, and the nucleotide sequences of sgRNA1 and sgRNA2 are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

[0009] Furthermore, the primer pair FhKNUguide1-F / R targeting the target sequence sgRNA1 is: FhKNUguide1-F: 5'-ATTGCTAGGGTTCGAGCAGCTGGG-3' (SEQ ID NO: 7); FhKNUguide1-R: 5'-AAACCCCAGCTGCTCGAACCCTAG-3' (SEQ ID NO: 8); The primer pair FhKNUguide4-F / R targeting the target sequence sgRNA2 is: FhKNUguide4-F: 5'-ATTGCCAGCACCTCATCAACGGCG-3' (SEQ ID NO: 9); FhKNUguide4-R: 5'-AAACCGCCGTTGATGAGGTGCTGG-3' (SEQ ID NO: 10).

[0010] The present invention also provides a kit for controlling male sterility in citrus, the kit comprising primer pair FhKNUguide1-F / R or primer pair FhKNUguide4-F / R; The nucleotide sequence of the primer pair FhKNUguide1-F / R is as follows: FhKNUguide1-F: 5'-ATTGCTAGGGTTCGAGCAGCTGGG-3'; FhKNUguide1-R: 5'-AAACCCCAGCTGCTCGAACCCTAG-3'; The nucleotide sequence of the primer pair FhKNUguide4-F / R is as follows: FhKNUguide4-F: 5'-ATTGCCAGCACCTCATCAACGGCG-3'; FhKNUguide4-R: 5'-AAACCGCCGTTGATGAGGTGCTGG-3'.

[0011] Primer pairs FhKNUguide1-F and FhKNUguide1-R amplified the target sequence sgRNA1, and primer pairs FhKNUguide4-F and FhKNUguide4-R amplified the target sequence sgRNA2.

[0012] The present invention also provides a host bacterium containing the gene editing vector described above, wherein the host bacterium is Agrobacterium EHA105.

[0013] The present invention also provides an application of one of the following in controlling male sterility in citrus, wherein, (1) The KNU gene that controls male sterility in navel oranges; (2) The gene editing vector described above; (3) The kit described above; (4) The host bacteria mentioned above.

[0014] This invention also provides an application of one of the following in the breeding of seedless citrus varieties, wherein, (1) The KNU gene that controls male sterility in navel oranges; (2) The gene editing vector described above; (3) The kit described above; (4) The host bacteria mentioned above.

[0015] The beneficial effects of this invention are: Previously, the Citrus Research Group at Huazhong Agricultural University determined that navel oranges are a clone of common sweet oranges by analyzing somatic cell variations in sweet oranges. They also discovered a special navel orange, Trovita, which exhibits fertile stamens and is a seeded phenotype of common sweet oranges.

[0016] Based on the research of the aforementioned research group, this invention, by comparing the fertility of sweet oranges, navel oranges, and Trovita oranges, found that navel oranges are seedless because their mature stamens lack pollen. In contrast, common sweet oranges and Trovita oranges have abundant pollen grains in their stamens, are fertile, and produce seeds after maturity. By comparing anther gene expression data of the three materials, an anther-specific gene, KNU, was discovered. The KNU gene is specifically silenced in navel oranges but normally expressed in sweet oranges and Trovita oranges. Furthermore, in the anthers, the KNU gene exhibits a gamete-specific expression pattern.

[0017] This invention utilizes the short-juvenile model citrus fruit, *Citrus medica*, and designs two editing targets for the KNU gene. *Agrobacterium*-mediated transformation of *Citrus medica* plants yielded three homozygous edited mutants. All homozygous edited mutants exhibited male sterility after flowering, and the mature fruit was seedless, exhibiting traits consistent with navel oranges. These results demonstrate that the KNU gene is an effective target for seedless citrus, and seedless citrus fruits can be obtained through gene editing. Attached Figure Description

[0018] Figure 1 Images of mature flowers, anthers, and anther compressions of sweet orange, navel orange, and Trovita orange. In the diagram, A, B, and C are mature flowers, D, E, and F are anthers, and G, H, and I are anther tablets. Figure 2 RT-PCR gel images showing the expression of the KNU gene in multiple tissues in three materials: sweet orange, navel orange, and Trovita. Figure 3 Figure 1 shows the results of in situ expression analysis of gene KNU in the anthers of three materials. In the diagram, SWO stands for sweet orange, nao for navel orange, TRO for Trovita, SPC for sporogenous cell, PMC for pollen mother cell, and MC for meiotic cell. Figure 4 A diagram showing the location of the sgRNA designed targeting the KNU gene of *Citrus aurantiacus* and the editing types of the homozygous edited mutant *Citrus aurantiacus*. Figure 5 Comparison of stamen fertility between wild-type and knu gene-edited kumquat, and longitudinal section of fruit. In the diagram, A and E are mature flowers, B and F are anthers, C and G are anther compresses, and D and H are longitudinal sections of the fruit. Figure 6 This is a plasmid map of the vector proYAO-Cas9-NOS. Detailed Implementation

[0019] The present invention will now be described in further detail with reference to specific embodiments, so that those skilled in the art can understand it.

[0020] Example 1: Analysis of stamen fertility and longitudinal section characteristics of sweet orange, navel orange, and Trovita orange. In early April, during peak flowering season, mature flowers and anthers of sweet orange, navel orange, and Trovita orange were collected at an outdoor site. After collection, pollen shedding from the anthers of the three varieties was photographed in the laboratory using a stereomicroscope. The anthers were then examined in slides, stained with Carbopol fuchsin, and the pollen was observed. In mid-December, when the fruits were ripe, the fruits of the three varieties were collected, longitudinally sectioned, and photographed.

[0021] The results are as follows Figure 1 As shown, the anthers of navel orange are pale white, and no obvious pollen grain crystals are visible in the field of view. The anther pressing results show that there are no pollen grains in the anthers of navel orange. The anthers of sweet orange and Trovita are orange-yellow, and pollen crystals can be observed in the field of view. The pressing results show that a large number of pollen grains can be observed in the field of view.

[0022] Example 2: Expression analysis of the key candidate gene KNU in sweet orange, navel orange, and Trovita. This invention utilizes multi-omics data from previous research (Wang et al, 2021 Somatic variationsled to the selection of acidic and acidless orange cultivars. Nat Plants. 2021 Jul;7(7):954-965.) to discover that the gene KNUCKLES (KNU), encoding a zinc finger protein transcription factor, mediates male sterility in navel oranges. The nucleotide sequence of the KNU gene is shown in SEQ ID NO: 1, and the amino acid sequence is shown in SEQ ID NO: 2. RNA was extracted from the stems, leaves, axillary buds, fruits, early anthers, and carpels of sweet oranges using an RNA extraction kit, and then reverse transcribed into cDNA to obtain cDNA from the stems, leaves, axillary buds, fruits, early anthers, and carpels of sweet oranges.

[0023] The cDNA of the stem, leaves, axillary buds, fruit, early anthers, and carpels of navel orange was obtained using the above method; the cDNA of the stem, leaves, axillary buds, fruit, early anthers, and carpels of Trovita was also obtained using the above method.

[0024] The KNU gene sequence of sweet orange was retrieved from the database (http: / / citrus.hzau.edu.cn / ). KNU amplification primers were designed using Primer software, with ACTIN (actin gene) as a control. The KNU gene fragment and the control gene fragment of the above cDNA were amplified by RT-PCR. The primers for amplifying the KNU gene fragment are as follows: CsKNU-F: 5'-ATGGCAGACCCTAACATGTACA-3'; CsKNU-R: 5'-TTATAAACGGAGATTGAGATCAACT-3'; The primers for amplifying the ACTIN gene fragment are as follows: CsACTIN-F: 5'-CCAAGCAGCATGAAGATCAA-3' (SEQ ID NO: 11); CsACTIN-R: 5'-ATCTGCTGGAAGGTGCTGAG-3' (SEQ ID NO: 12).

[0025] The results are as follows Figure 2As shown, the KNU gene is expressed only in the early anthers and carpels of sweet orange and Trovita, and KNU expression is not detected in general vegetative tissues; the KNU gene is silenced in all tissues of navel orange (PCR conditions: KNU-45 cycles, ACTIN-34 cycles).

[0026] This invention utilizes formaldehyde fixative to fix flower bud samples (approximately 3.5 mm in diameter) of sweet orange, navel orange, and Trovita orange, respectively. After sequential dehydration with ethanol, clearing with xylene, and paraffin embedding, in situ hybridization is used to detect the expression of the KNU gene in the anthers (flower buds are contained within the anthers) of the three materials. Probe preparation uses the full-length KNU gene controlling male sterility in navel orange as a template, and the DIG RNA Labling Kit is used to prepare RNA probes. Results are as follows: Figure 3 As shown, the gene KNU is expressed in sweet orange, Trovita anther mother cells, and cells undergoing meiosis.

[0027] Example 3: KNU gene editing vector for controlling male sterility in navel oranges This embodiment utilizes gene editing technology, employing the proYAO-Cas9-NOS vector from the proYAO-Cas9-NOS vector (Reprogramming of Stem Cell Activity to Convert Thorns into Branches. (Curr Biol)). The proYAO-Cas9-NOS vector plasmid map is shown below. Figure 6 As shown in the image, two target sites were designed for the gene KNU, which controls male sterility in navel oranges: sgRNA1 and sgRNA2. The nucleotide sequence of sgRNA1 is as follows: CTAGGGTTCGAGCAGCTGGG; The nucleotide sequence of sgRNA2 is as follows: CCAGCACCTCATCAACGGCG.

[0028] The primers for the target sgRNA1 are: FhKNUguide1-F: 5'-ATTGCTAGGGTTCGAGCAGCTGGG-3'; FhKNUguide1-R: 5'-AAACCCCAGCTGCTCGAACCCTAG-3'; The primers for the target sgRNA2 are: FhKNUguide4-F: 5'-ATTGCCAGCACCTCATCAACGGCG-3'; FhKNUguide4-R: 5'-AAACCGCCGTTGATGAGGTGCTGG-3'; The target sgRNA1 and sgRNA2 were recombined with the vector proYAO-Cas9-NOS to obtain the gene editing vectors proYAO-Cas9-NOS-sgRNA1 and proYAO-Cas9-NOS-sgRNA2.

[0029] Example 4: Kit for controlling male sterility in citrus fruits This embodiment provides a kit for controlling male sterility in citrus fruits. The kit includes primer pairs FhKNUguide1-F, FhKNUguide1-R or primer pairs FhKNUguide4-F, FhKNUguide4-R as described in Example 3.

[0030] Example 5: Gene editing of kumquats to achieve anther male sterility and seedless fruit In this embodiment, gene editing of *Citrus aurantiacus* was performed using the gene editing vector of Example 3 or the kit of Example 4 to achieve anther male sterility and seedless fruit.

[0031] 1. The gene editing vectors proYAO-Cas9-NOS-sgRNA1 and proYAO-Cas9-NOS-sgRNA2 were transformed into Agrobacterium tumefaciens EHA105, respectively, to obtain recombinant Agrobacterium tumefaciens EHA105-sgRNA1 and EHA105-sgRNA2.

[0032] 2. Positive seedlings were obtained by infecting the epicotyl of *Citrus aurantium* using Agrobacterium-mediated infection. The specific method is as follows: (1) Infection: After activating recombinant Agrobacterium EHA105-sgRNA1, an infection suspension was prepared. Meanwhile, the cut hemophilus stem segments were immersed in it, vacuumed (-0.6 MPa) for 5 min, shaken for 20 min, and then the stem ends were dried with sterile filter paper. The suspension was then cultured at 23℃ for 3 days.

[0033] (2) Screening culture: The co-cultured stem segments were transferred to MT budding medium (containing 50 mg / L kanamycin and 50 mg / L cephalosporin) and cultured in the dark for 8 days before being transferred to normal culture (16 h in light / 8 h in the dark).

[0034] (3) Grafting and transplanting: The induced buds containing GFP fluorescent markers (GFP fluorescent markers are selection markers carried by the proYAO-Cas9-NOS vector) were grafted onto the trifoliate orange peel, and transplanted into the soil after two weeks of light culture at 25℃ (16 h light / 8 h dark).

[0035] (4) Editing detection: After the material from the previous step has grown for one month, DNA is extracted from the leaves and tested for editing lineage using full-length ORF primers (i.e., CsKNU-F / CsKNU-R); after amplifying the target fragment, product sequencing and ligation are performed simultaneously. The product is ligated into the pTOPO-Blunt vector (Junuode Company, product number V6002-20), and then transformed into E. coli DH5α competent cells for single-clone strain screening. More than 10 single-clone strains are selected for Sanger sequencing verification. Figure 4 As shown, two homozygous knu gene-edited kumquat trees, Fhknu #1 and Fhknu #2, were obtained using recombinant Agrobacterium EHA105-sgRNA1.

[0036] A homozygous knu gene-edited Citrus aurantiacus Fhknu #3 was obtained using recombinant Agrobacterium EHA105-sgRNA2 via step 2.

[0037] In this embodiment, three homozygous knu gene-edited kumquat trees, Fhknu #1, Fhknu #2, and Fhknu #3, were obtained. Using trifoliate orange as rootstock, the grafted kumquat trees flowered successively within two years. Results are as follows... Figure 5 As shown, comparing the stamen fertility of wild-type and homozygous knu gene-edited kumquats, the anthers of the homozygous knu gene-edited kumquats Fhknu #1, Fhknu #2, and Fhknu #3 were pale and shriveled in full bloom, with no obvious pollen crystals detected under a stereomicroscope, and no pollen grains were observed after slide development. The homozygous knu gene-edited kumquats produced seedless fruits, similar to navel oranges. In contrast, the anthers of the wild-type were pale yellow, with obvious pollen crystal precipitation observed under a stereomicroscope, and staining results after slide development showed the presence of numerous pollen grains; the fruits produced 1-2 seeds after maturity.

[0038] In summary, the KNU gene controlling stamen fertility in citrus was identified through multi-omics data screening. Experimental results indicate that KNU is a gene specifically expressed in stamen germ cells. Male sterility in navel oranges is caused by KNU gene silencing. Editing the KNU gene in the model citrus fruit *Citrus aurantium* resulted in mutants exhibiting pollenlessness after flowering, typical of male sterility, and seedless fruit upon ripening.

[0039] All other parts not described in detail are existing technologies. Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. The application of any one of the following in controlling male sterility in citrus, characterized in that: in, (1) A gene editing vector for controlling the male sterility gene KNU in navel orange, wherein the gene editing vector is proYAO-Cas9-NOS-sgRNA; the gene editing vector has a target nucleotide sequence sgRNA, as shown in SEQ ID NO: 1, inserted into the proYAO-Cas9-NOS backbone vector; The target sequence sgRNA is either sgRNA1 or sgRNA2, and the nucleotide sequences of sgRNA1 and sgRNA2 are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively. (2) A kit for controlling male sterility in citrus, the kit comprising primer pair FhKNUguide1-F / R or primer pair FhKNUguide4-F / R; The primer pair FhKNUguide1-F / R targeting the target sequence sgRNA1 is: FhKNUguide1-F: 5'-ATTGCTAGGGTTCGAGCAGCTGGG-3'; FhKNUguide1-R: 5'-AAACCCCAGCTGCTCGAACCCTAG-3'; The primer pair FhKNUguide4-F / R targeting the target sequence sgRNA2 is: FhKNUguide4-F: 5'-ATTGCCAGCACCTCATCAACGGCG-3'; FhKNUguide4-R: 5'-AAACCGCCGTTGATGAGGTGCTGG-3'; (3) A host bacterium containing a gene editing vector for controlling the male sterility gene KNU in navel orange, wherein the host bacterium is Agrobacterium EHA105; the gene editing vector is proYAO-Cas9-NOS-sgRNA; the gene editing vector inserts a target nucleotide sequence, such as the target sequence sgRNA for controlling the male sterility gene KNU in navel orange as shown in SEQ ID NO: 1, into the proYAO-Cas9-NOS backbone vector; The target sequence sgRNA is either sgRNA1 or sgRNA2, and the nucleotide sequences of sgRNA1 and sgRNA2 are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively. The citrus variety mentioned is the kumquat.

2. The application of any one of the following in the cultivation of seedless citrus varieties, characterized in that: in, (1) A gene editing vector for controlling the male sterility gene KNU in navel orange, wherein the gene editing vector is proYAO-Cas9-NOS-sgRNA; the gene editing vector has a target nucleotide sequence sgRNA, as shown in SEQ ID NO: 1, inserted into the proYAO-Cas9-NOS backbone vector; The target sequence sgRNA is either sgRNA1 or sgRNA2, and the nucleotide sequences of sgRNA1 and sgRNA2 are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively. (2) A kit for controlling male sterility in citrus, the kit comprising primer pair FhKNUguide1-F / R or primer pair FhKNUguide4-F / R; The primer pair FhKNUguide1-F / R targeting the target sequence sgRNA1 is: FhKNUguide1-F: 5'-ATTGCTAGGGTTCGAGCAGCTGGG-3'; FhKNUguide1-R: 5'-AAACCCCAGCTGCTCGAACCCTAG-3'; The primer pair FhKNUguide4-F / R targeting the target sequence sgRNA2 is: FhKNUguide4-F: 5'-ATTGCCAGCACCTCATCAACGGCG-3'; FhKNUguide4-R: 5'-AAACCGCCGTTGATGAGGTGCTGG-3'; (3) A host bacterium containing a gene editing vector for controlling the male sterility gene KNU in navel orange, wherein the host bacterium is Agrobacterium EHA105; the gene editing vector is proYAO-Cas9-NOS-sgRNA; the gene editing vector inserts a target nucleotide sequence, such as the target sequence sgRNA for controlling the male sterility gene KNU in navel orange as shown in SEQ ID NO: 1, into the proYAO-Cas9-NOS backbone vector; The target sequence sgRNA is either sgRNA1 or sgRNA2, and the nucleotide sequences of sgRNA1 and sgRNA2 are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively. The citrus variety mentioned is the kumquat.

Images