Ipomoea batatas tuberous root anthocyanin synthesis regulation related gene ibpk1 and application thereof
By isolating the IbPK1 gene from sweet potato and transferring it into sweet potato, the plant expression vector pCAMBIA1301-IbPK1 was constructed, which solved the problem of insufficient regulation of anthocyanin synthesis in the existing technology, and achieved a significant enhancement of anthocyanin synthesis in sweet potato storage roots, thus promoting the breeding of sweet potato varieties rich in anthocyanins.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CROP RES INST SHANDONG ACAD OF AGRI SCI
- Filing Date
- 2026-04-28
- Publication Date
- 2026-05-29
AI Technical Summary
There are no existing reports on the role of the IbPK1 gene in regulating anthocyanin synthesis in plant storage roots, and there is a lack of effective means to promote anthocyanin synthesis in sweet potato storage roots.
The IbPK1 gene was isolated from sweet potato and transferred into sweet potato using Agrobacterium tumefaciens-mediated transformation to construct the plant expression vector pCAMBIA1301-IbPK1, which promotes anthocyanin synthesis.
It significantly enhanced the anthocyanin synthesis capacity in sweet potato storage roots, which exhibited a purple phenotype, providing genetic resources for breeding new sweet potato varieties rich in anthocyanins.
Smart Images

Figure CN122104749A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology, specifically relating to a gene related to the regulation of anthocyanin synthesis in sweet potato storage roots. IbPK1 And its applications. Background Technology
[0002] The information disclosed in this background section is intended only to enhance some understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art.
[0003] Anthocyanins possess important biological functions, reducing oxidative stress-induced cell damage and delaying aging by scavenging free radicals (such as superoxide anions and hydroxyl radicals) and inhibiting lipid peroxidation. Anthocyanins in sweet potato storage roots are a major source of edible anthocyanins. Elucidating the regulatory mechanism of anthocyanin synthesis in storage roots and creating anthocyanin-rich sweet potato germplasm is of great significance.
[0004] Utilizing transgenic technology to introduce new traits into high-biomass plants and develop highly efficient transgenic plant varieties is a technology with broad application prospects. Currently, no [further details are available]. IbPK1 Reports on the role of genes in the regulation of anthocyanin synthesis in plant storage roots. Summary of the Invention
[0005] To address the shortcomings of existing technologies, this invention provides a gene related to the regulation of anthocyanin synthesis in sweet potato storage roots and its application. This invention isolates the gene from sweet potato. IbPK1 The gene was then transformed into sweet potatoes for transgenic function verification, in order to achieve research results. IbPK1 The function and mechanism of genes.
[0006] The technical solution adopted in this invention is as follows: In a first aspect, the present invention provides a gene related to the regulation of anthocyanin synthesis in sweet potato storage roots, the gene being named... IbPK1 Its cDNA nucleotide sequence is shown in SEQ ID No. 1.
[0007] Secondly, this invention provides a gene containing the anthocyanin synthesis regulation-related gene of sweet potato storage roots as described in the first aspect. IbPK1 Plant expression vectors.
[0008] Preferably, the plant expression vector is pCAMBIA1301- IbPK1 .
[0009] Furthermore, to facilitate the screening of transgenic plants, the plant expression vector may also contain a selection marker or a reporter gene. The selection marker is preferably one or more of hygromycin, kanamycin, or gentamicin. The reporter gene is preferably GUS.
[0010] Thirdly, this invention provides the gene related to the regulation of anthocyanin synthesis in sweet potato storage roots as described in the first aspect. IbPK1 Or the application of the plant expression vector described in the second aspect in promoting the synthesis of anthocyanins in plant storage roots.
[0011] Preferably, the plant is sweet potato.
[0012] Fourthly, the present invention provides the gene related to the regulation of anthocyanin synthesis in sweet potato storage roots as described in the first aspect. IbPK1 Or the application of the plant expression vector described in the second aspect in the cultivation of anthocyanin sweet potato varieties.
[0013] In this invention, the gene related to the regulation of anthocyanin synthesis in sweet potato storage roots is described. IbPK1 The adenosine in sweet potato was transferred using Agrobacterium tumefaciens-mediated transformation and the transgenic function was verified to significantly promote the synthesis of anthocyanins in the stored roots of sweet potato.
[0014] Fifthly, the present invention provides a method for breeding anthocyanin-rich sweet potato varieties, comprising incorporating the anthocyanin synthesis regulation-related genes from sweet potato storage roots as described in the first aspect. IbPK1 Alternatively, the plant expression vector described in the second aspect can be introduced into sweet potato, allowing it to be expressed in the sweet potato storage roots, thereby promoting anthocyanin synthesis.
[0015] Compared with the related technologies known to the inventors, one of the technical solutions of the present invention has the following beneficial effects: This invention is the first to clone genes related to the regulation of anthocyanin synthesis in storage roots from sweet potato. IbPK1 The bacteria were then transferred into sweet potatoes using Agrobacterium tumefaciens-mediated transformation. Experimental results showed that the transfer... IbPK1 The gene significantly enhances anthocyanin synthesis in the storage roots of sweet potatoes, resulting in a purple phenotype in the storage roots. This invention provides a new genetic resource for the genetic improvement of anthocyanin content in sweet potatoes, and can be used to breed new sweet potato varieties rich in anthocyanins, thus possessing significant application value. Attached Figure Description
[0016] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.
[0017] Figure 1 : IbPK1The amplification results of the full-length cDNA sequence of the gene; where M is the DL2000 DNA Marker, with lengths of 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp respectively.
[0018] Figure 2 :sweet potato IbPK1 Genomic PCR and transgene expression level PCR detection of transgenic plants; Figure A shows the genomic PCR electrophoresis pattern, verifying... IbPK1 Integration into the sweet potato genome; Figure B shows the PCR analysis results of transgenic line expression, verifying... IbPK1 Normal expression was observed in the transgenic lines. OE1 and OE2 are two independently obtained transgenic lines; CK is a control line of sweet potato transgenic with empty pCAMBIA1301 vector; genomic PCR was used to verify the expression. IbPK1 Integrating into the sweet potato genome, genomic PCR was performed using a forward primer on the 35S promoter sequence and a reverse primer on the gene; transgene expression was detected by RT-PCR. IbPK1 It is normally expressed in transgenic lines. Genomic PCR results show that it can be amplified in transgenic lines. IbPK1 The band was observed in the control group, but no band was amplified in the control group, indicating that... IbPK1 It was integrated into the sweet potato genome. PCR results showed that transgenic expression was detectable in the transgenic lines. IbPK1 Transcripts indicate IbPK1 Expressed in sweet potatoes.
[0019] Figure 3 : Sweet potato storage root phenotype; where: CK is the control of empty vector pCAMBIA1301. Data show that, IbPK1 The storage roots of genetically modified sweet potatoes show a purple color, indicating... IbPK1 It promotes the synthesis of anthocyanins in sweet potato storage roots. Detailed Implementation
[0020] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0021] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments of the present invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, and / or combinations thereof.
[0022] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0023] Example 1 IbPK1 Cloning and expression analysis Extraction of total RNA from sweet potatoes Total RNA was extracted from the stored roots of the sweet potato variety "Ji Zishu No. 2" according to the following steps: 1. Place the sweet potato storage roots into a mortar pre-cooled with liquid nitrogen and grind them thoroughly into powder in liquid nitrogen; 2. Once the liquid nitrogen has evaporated, immediately transfer it to a 2ml centrifuge tube. Add approximately 1ml of Invitrogen's TRIzol extraction solution for every 100mg of material. After melting, repeatedly pipette and shake vigorously to mix the sample, ensuring complete lysis. Let it stand at room temperature for 5 minutes. 3. Add 0.2 ml of chloroform, shake vigorously to mix for 15 seconds, and let stand at room temperature for 10 minutes; Centrifuge at 4.4°C and 12,000 rpm for 15 minutes; 5. Carefully aspirate the upper aqueous phase with a pipette and add it to a new 1.5 ml centrifuge tube. Add 500 μl of isopropanol (1:1 volume), mix thoroughly, and incubate at -20°C for 30 min or overnight. Centrifuge at 6.4℃ and 12000rpm for 10min, and carefully discard the supernatant; 7. Wash the RNA precipitate with 1 ml of 75% ethanol; centrifuge at 8000 rpm for 10 min at 4°C to collect the precipitate; 8. Wash the RNA precipitate once more with 75% v / v ethanol; 9. Remove the supernatant, let the RNA precipitate air dry on a sterile work surface for about 10-15 minutes, add an appropriate volume (30-50 μl) of RNase-free water to dissolve it completely (it can be stored at -80℃ for a long time). 10. RNA concentration and quality were detected by ultraviolet spectrophotometer and 1% agarose gel electrophoresis.
[0024] The total RNA concentration extracted was found to be 0.679 μg / μL, and the OD... 260 / OD 280 A ratio of 1.92 indicates good RNA purity, free from protein or phenol contamination. 1% agarose gel electrophoresis results showed clear and intact 28S and 18S rRNA bands, indicating good RNA integrity, suitable for subsequent reverse transcription experiments.
[0025] Note: a) RNA yield was measured using a UV spectrophotometer, with absorbance at 260 nm (1 OD = 40 μg / ml). RNA purity was determined based on absorbance values at 260 nm and 280 nm; the OD of pure RNA was [not specified]. 260 / OD 280 The ratio should be close to 2.0 (ideally between 1.9 and 2.1).
[0026] b) Detect RNA quality and size using 1% agarose gel electrophoresis. Add 1 μl of RNA to 3 μl of RNase-free water and 1 μl of loading buffer. After electrophoresis, stain with EB. Use 6 μl of D2000 DNA Marker as a control.
[0027] 1.2 cDNA reverse transcription Reverse transcriptase: M-MLV Reverse Transcriptase (Invitrogen).
[0028] 1.12 μl reaction system Oligo(dT) 1μl Total RNA 1μg dNTP 1μl DEPC water replenished to 12μl 2. Denature at 2.65℃ for 5 minutes, then quickly insert into ice, and then add in the following order: 5×First-Strand Buffer 4μl 0.1M DTT 2μl RNaseOUT (Invitrogen) 1μl 3. Mix gently and react at 37°C for 2 minutes; 4. Add 1 μl M-MLV RT, mix well, and react at 37℃ for 50 min; 5. Incubation at 70℃ for 15 min inactivates M-MLV RT; 6. Add 1 μl RNase H (Invitrogen) and react at 37°C for 20 min; 7. Dilute with ultrapure water to a suitable concentration. Use as a PCR template.
[0029] 1.3 Cloning and Sequencing of Open Reading Frames 1. Primer sequences: Based on the sequencing results, gene primer sequences were designed. The upstream primer is IbPK1-S: GGTACCATGGCTTCCGTAGGTTTACCAC (SEQ ID No. 2), downstream primer IbPK1-A: GTCGACTCATAATCCCAGGAAGGGGC (SEQ ID No. 3), amplifying the open reading frame of the gene.
[0030] 2. PCR reaction system (20 μl): 10×Pfu buffer 2μl Template cDNA 1 μl dNTPs (2.5mM each) 0.5μl Primer1 (10μM) 1μl Primer2 (10μM) 1μl pfu (TaKaRa) 0.2μl Add ddH2O to a final volume of 20 μl.
[0031] 3. The PCR reaction program is as follows: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds, 55℃ annealing for 30 seconds, 68℃ extension for 90 seconds, for 32 cycles; 68℃ extension for 10 minutes.
[0032] 4. PCR product detection: Take 5 μl of PCR product and perform 1% agarose gel electrophoresis. The expected amplified fragment size is 1242 bp.
[0033] 5. After recovery, the amplified fragment was ligated into the pEASY-Blunt simple vector and transformed into *E. coli* DH5α. Sequencing was performed by Qingdao Qingke Company. Results are shown below. Figure 1 The amplified products were detected by agarose gel electrophoresis, and the results showed a single specific band at the expected location.
[0034] Example 2: Construction of plant expression vectors Using the plant expression vector pCAMBIA1301, selected KpnI and SalI The pCAMBIA1301 vector and the pEASY-Blunt simple vector containing the target gene were double-digested with enzymes. The large fragment of the vector and the small fragment of the target gene were recovered, ligated with T4 DNA ligase, and transformed into E. coli DH5α competent cells. After identification of the recombinants, the plant expression vector carrying the target gene was obtained.
[0035] 1. Double digestion, using pCAMBIA1301 empty vector and pEASY-Blunt simple as an example. The empty vector pCAMBIA1301 and the pEASY-Blunt simple plasmid were extracted using the alkaline lysis method. 10 μg of each was digested with enzymes, and the digestion system is as follows: KpnI 1μl SalI 1μl pCAMBIA1301 vector / pEASY-Blunt simple plasmid 1~2μl 10×T Buffer 3μl 10×BSA 2μl Add ddH2O to a final volume of 20 μl. Enzyme digestion was performed at 37°C for 2 hours. KpnI was from Takara (Code No. 1068S), and SalI was from Takara (Code No. 1080S). After double digestion, the digestion products were subjected to 1% agarose gel electrophoresis using 1×TAE buffer. Under UV transilluminator conditions, a large vector fragment of approximately 12.5 kb from pCAMBIA1301 and a target gene band of approximately 1.2 kb from pEASY-Blunt simple were excised using a clean blade and the bands were recovered.
[0036] 2. The enzyme-digested pCAMBIA1301 vector fragment (approximately 12.5 kb) and the pEASY-Blunt simple double-digested fragment (approximately 1.2 kb) were ligated overnight at 16°C in a molar ratio of 1:4, with a total ligation volume of 10 μl.
[0037] 3. The ligation product was transformed into Escherichia coli DH5α competent cells using the heat shock method. The transformed bacteria were cultured at 37°C for about 16 hours on LB agar plates containing 50 μg / ml Kan.
[0038] 4. Identification of recombinants (1) PCR verification of plasmids Single colonies were picked and inoculated into 5 ml of LB liquid medium containing Kans and cultured overnight at 37°C with shaking. Plasmids were extracted by alkaline denaturation and amplified by PCR using gene-specific primers.
[0039] PCR reaction conditions: pre-denaturation at 95℃ for 5 minutes; 94℃ for 30 seconds, 55℃ for 30 seconds, 72℃ for 2 minutes, 32 cycles; extension at 72℃ for 10 minutes. PCR products were identified by 1.0% agarose gel electrophoresis.
[0040] (2) Plasmid enzyme digestion identification Plasmid extraction KpnI and SalIDouble digestion was performed using the same digestion system as above. 1% agarose gel electrophoresis was then performed to detect the presence of fragments of the expected molecular weight, verifying the correct construction of the vector.
[0041] Example 3: Preparation and transformation of Agrobacterium competent cells 3.1 Preparation of Agrobacterium LBA4404 competent cells 1. Pick a single colony of Agrobacterium tumefaciens from a YEP plate (containing 50 μg / ml rifampin) and inoculate it into YEP liquid medium (containing 50 μg / ml rifampin). Incubate overnight at 28°C and 200 rpm.
[0042] 2. Take 2 ml of overnight culture medium and inoculate it into 50 ml of YEP liquid medium containing the same antibiotic. Incubate under the same conditions until OD. 600 It reached 0.8.
[0043] 3. Incubate the bacterial culture on ice for 30 minutes, then centrifuge at 4°C and 5000 rpm for 10 minutes to collect the bacterial cells.
[0044] 4. Resuspend the bacterial cells in 10 ml of 0.15 mol / L NaCl in an ice bath, and collect the cells by centrifugation.
[0045] 5. Resuspend the bacterial culture in 1 ml of 20 mmol / L ice-cold CaCl2 solution, aliquot the bacterial culture into 1.5 ml Eppendorf tubes at 200 μl / tube, freeze in liquid nitrogen for 1 min, and store at -70°C for later use.
[0046] 3.2 Freeze-thaw transformation of Agrobacterium tumefaciens LBA4404 1. Thaw Agrobacterium competent cells at room temperature, add 1 μg of expression vector plasmid DNA, mix well, and incubate on ice for 30 min.
[0047] 2. Quickly freeze in liquid nitrogen for 1 minute, then quickly transfer to 37°C and keep warm for 3 minutes.
[0048] 3. Add 800 μl of antibiotic-free YEP and incubate at 28°C with shaking for 3 hours.
[0049] 4. Centrifuge at 7000 rpm for 30 seconds to collect bacterial cells, spread them on YEP plates containing 50 μg / ml rifampicin and 50 μg / ml Kan, and incubate in the dark at 28°C for 2-3 days.
[0050] 3.3 Bacterial cell PCR identification Single colonies from sample 3.2 μg were transferred to the PCR system described above (without DNA template) and amplified by PCR using gene-specific primers. PCR reaction conditions: pre-denaturation at 95°C for 5 min; 32 cycles of 94°C for 30 sec, 55°C for 30 sec, and 72°C for 2 min; extension at 72°C for 10 min. PCR products were identified by 1.0% agarose gel electrophoresis.
[0051] Example 4: Verification of transgenic function – Sweet potato transformation screening 4.1 Preparation of sweet potato embryogenic callus 1. Select healthy, virus-free test-tube seedlings and cut stem points.
[0052] 2. Rinse 5 times with sterile water.
[0053] Soak in 3.75% ethanol for 2 minutes.
[0054] 4. Soak in 0.4% sodium hypochlorite solution for 15 minutes.
[0055] 5. Rinse five times with sterile water.
[0056] 6. Under a dissecting microscope, the stem points were peeled off and placed on 2,4-D solid medium (2,4-D 2ml / L, MS 4.41g / L, sucrose 30g / L, gellan gum 3.6g / L) and cultured in the dark for 4 weeks to induce embryogenic callus.
[0057] 4.2 Sweet potato conversion 1. Select plasmids containing pCAMBIA1301- IbPK1 A single clone of Agrobacterium LBA4404 was placed in YEP medium containing 50 mg / L rifampicin and 100 mg / L kanamycin and cultured overnight at 28°C with shaking at 180 rpm.
[0058] 2. Transfer 1 ml of the above bacterial culture to fresh YEP culture medium containing 50 mg / L rifampin and 100 mg / L kanamycin, and incubate at 28°C with shaking at 180 rpm until OD reaches zero. 600 = 0.8-1.0. Centrifuge the bacterial culture at 6000 rpm and 4°C for 10 minutes, then resuspend the cells in 2,4-D liquid medium containing 100 μM AS (2,4-D 2 ml / L, MS 4.41 g / L, sucrose 30 g / L) until OD500 is reached. 600 = 0.8-1.0.
[0059] 4. Transfer 4 ml of embryogenic callus tissue to a centrifuge tube containing 10 ml of bacterial solution, and sonicate for 10 seconds.
[0060] 5. Shake at room temperature for 40-50 rpm for 1 hour.
[0061] 6. Use a pipette to remove excess bacterial solution, inoculate the callus onto filter paper with a diameter of 9 cm, blot dry, and transfer the embryogenic callus tissue to a solid MS1D culture dish containing 100 μM AS. Incubate at 25°C in the dark for 2 days.
[0062] 7. After co-culture, wash the infected embryonic callus 3-5 times with sterile water containing 400 mg / L cephalosporin.
[0063] 8. Transfer the washed embryogenic callus to selective medium containing 400 mg / L cephalosporin and 100 mg / L hygromycin (2,4-D 2 ml / L, MS 4.41 g / L, sucrose 30 g / L, gellan gum 3.6 g / L), and change the medium every 2 weeks.
[0064] 9.2-3 months later, the positive seedlings on the selective medium were transferred to regeneration medium containing 400 mg / L cephalosporin and 100 mg / L hygromycin (sucrose 30 g / L, MS 4.41 g / L, ABA 1 ml / L, gellan gum 3.6 g / L).
[0065] 4.3 Screening of positive sweet potato lines A total of 5 regenerated seedlings were obtained, and 2 positive lines were identified by PCR.
[0066] 1. Genomic DNA was extracted from leaves of seedlings grown on regeneration medium. PCR amplification was performed using forward primers on the 35S promoter and reverse primers on the gene, with an expected amplified fragment size of approximately 1242 bp. Untransformed sweet potato plants were used as negative controls to identify positive lines. Results are as follows: Figure 2 A.
[0067] 2. RNA was extracted from leaves of seedlings grown on the regeneration medium, and reverse transcribed to form cDNA. IbPK1 Gene-specific primers were used for PCR amplification, with untransformed sweet potato plants serving as a negative control, to identify transgene expression. The results are as follows: Figure 2 B.
[0068] Example 5: Verification of Transgenic Function – Phenotypic Analysis 1. Select seedlings that are about 20 cm long and of uniform thickness from the seedbed.
[0069] Two independent transgenic lines were selected, with 10 plants of each line planted, and empty vector plants were used as controls.
[0070] 2. Planting was carried out in the transgenic experimental field, with ridges 30 cm high, ridges 80 cm wide, and plant spacing of 20 cm.
[0071] Field management follows conventional sweet potato cultivation methods. During the growth period, the temperature range is 20-30℃, with natural sunlight, timely irrigation according to soil moisture, and conventional fertilization and pest and disease control.
[0072] 3. Harvest 120 days after planting. Three plants from each line were randomly selected as biological replicates. One root sample was taken from each plant for anthocyanin content determination. The phenotype of the stored roots was observed and photographed.
[0073] 4. Take the harvested storage root samples and determine the total anthocyanin content using the pH differential method. The specific steps are as follows: Weigh 1.0 g of fresh storage root sample, add 5 ml of 1% HCl-methanol solution, extract by shaking in the dark for 2 hours, filter, and dilute the filtrate with buffer solutions of pH 1.0 and pH 4.5 respectively. Measure the absorbance at wavelengths of 510 nm and 700 nm. The total anthocyanin content is expressed as milligrams of anthocyanins per 100 g fresh weight sample (mg / 100g FW).
[0074] The results showed that the anthocyanin content of the transgenic lines was 3.2±0.57 mg / 100g FW and 3.6±0.79 mg / 100g FW, while the anthocyanin content of the control plants transgenic with empty vector was not detected.
[0075] 5. Statistical Analysis Data are expressed as mean ± standard deviation (mean ± SD). Student's t-test was used to analyze the significance of differences between transgenic lines and controls, with P < 0.05 considered statistically significant.
[0076] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. A gene related to the regulation of anthocyanin synthesis in sweet potato storage roots, characterized in that, The gene is named IbPK1 Its cDNA nucleotide sequence is shown in SEQ ID No.
1.
2. A gene containing the anthocyanin synthesis regulation-related gene of sweet potato storage root as described in claim 1. IbPK1 Plant expression vectors.
3. The plant expression vector according to claim 2, characterized in that, The plant expression vector is pCAMBIA1301- IbPK1 .
4. The plant expression vector according to claim 2 or 3, characterized in that, The plant expression vector also contains a selection marker or reporter gene.
5. The plant expression vector according to claim 4, characterized in that, The reporter gene is GUS.
6. The plant expression vector according to claim 4, characterized in that, The selection marker is one or more of hygromycin, kanamycin, or gentamicin.
7. The gene related to the regulation of anthocyanin synthesis in sweet potato storage roots as described in claim 1 IbPK1 Or the application of the plant expression vector as described in claim 2 or 3 in promoting the synthesis of anthocyanins in sweet potato storage roots.
8. The gene related to the regulation of anthocyanin synthesis in sweet potato storage roots as described in claim 1 IbPK1 Or the application of the plant expression vector as described in claim 2 or 3 in the cultivation of anthocyanin sweet potato varieties.
9. A method for cultivating anthocyanin-rich sweet potato varieties, characterized in that, Includes the gene related to the regulation of anthocyanin synthesis in sweet potato storage roots as described in claim 1. IbPK1 Alternatively, the plant expression vector described in claim 2 or 3 may be introduced into sweet potato to express it in the storage roots of sweet potato, thereby promoting the synthesis of anthocyanins.