A primer-probe composition, application, and dynamic monitoring system for postoperative MRD detection of colorectal cancer based on multi-gene methylation qPCR.

Abstract

This invention discloses a primer and probe composition, application, and dynamic monitoring system for MRD detection after colorectal cancer surgery based on multi-gene methylation qPCR, relating to the fields of molecular diagnostics and precision oncology. The primer and probe composition is associated with three genes: KCNQ5, Septin9, and IKZF1. The dynamic monitoring system includes: a qPCR detection module for detecting the Ct value of the sample; a data acquisition module for automatically reading the Ct value of the qPCR instrument, calculating the P-value, and then using ROC curve analysis to determine the optimal judgment threshold; a data analysis module for determining MRD positive, MRD negative, or invalid results; and a clinical decision support module for making clinical decisions based on the results of dynamic monitoring. This invention has a sensitivity of 82% and a specificity of 95%; it is low-cost; results are available in 6-8 hours; and it covers the entire process, achieving a closed loop from risk stratification to recurrence intervention.

Description

Technical Field

[0001] This invention relates to the fields of molecular diagnostics and precision oncology, and in particular to a primer and probe composition, application, and dynamic monitoring system for postoperative MRD detection of colorectal cancer based on multi-gene methylation qPCR. Background Technology

[0002] Colorectal cancer is a highly prevalent malignant tumor in my country, and postoperative recurrence and metastasis are the main causes of treatment failure. Minimal residual disease (MRD) refers to residual tumor cells that are not visible on imaging, and its detection is crucial for prognostic stratification and treatment decisions. However, current technologies have the following limitations: (1) Imaging / CTCs: low sensitivity (imaging requires lesions > 5mm), high cost and low throughput of CTC detection; (2) NGS sequencing: Although it has high sensitivity, it is expensive (thousands to tens of thousands of yuan per case), time-consuming (3-7 days), and complex data analysis, making it difficult to promote at the grassroots level; (3) Single gene detection: Single methylation markers (such as SEPT9) have insufficient sensitivity (<70%) and are prone to false negatives; (4) Lack of dynamic monitoring system: Most technologies only perform a single test and cannot achieve full-cycle management from postoperative to adjuvant therapy to follow-up.

[0003] qPCR-based multi-gene methylation detection technology has been validated by multiple clinical studies. For example, the JAMA Oncology study at Fudan University Cancer Hospital (n=299) showed that qPCR detection of ctDNA one month post-surgery had a sensitivity of 78% and a specificity of 100%, providing early warning of recurrence up to 20 months earlier than imaging. The ESMO 2024 Protector-C study (n=342) further confirmed that the recurrence risk HR for patients with positive ctDNA four weeks post-surgery was 11.6, and the cost of the qPCR platform is only 1 / 5 to 1 / 10 of that of NGS, making it suitable for routine clinical application. However, existing qPCR detection methods still have shortcomings: ① Lack of standardized multi-gene combination and dynamic monitoring process; ② Failure to integrate closed-loop management of risk stratification, treatment decision-making, and relapse warning; ③ Failure to address the false negative problem under low ctDNA abundance. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides a primer and probe composition, application, and dynamic monitoring system for postoperative MRD detection in colorectal cancer based on multi-gene methylation qPCR. The system screens multiple highly specific methylation genes and combines them with multiplex qPCR technology to achieve highly sensitive detection of postoperative ctDNA. The system covers the entire process from sample collection to detection, dynamic monitoring, and clinical decision-making. It can accurately stratify recurrence risk one month post-surgery, providing early warning of recurrence 5-20 months earlier than imaging studies, and offering molecular evidence for the "addition and subtraction" of adjuvant chemotherapy.

[0005] In order to achieve the objective of this invention, the following solution is proposed: Firstly, a primer-probe composition is provided for postoperative MRD detection of colorectal cancer based on multi-gene methylation qPCR, which is associated with three genes: KCNQ5, Septin9, and IKZF1, with ACTB as an internal reference gene. The primer-probe composition includes: KCNQ5-F: GATGCCTGGTCCTTGCC (SEQ ID NO: 1); KCNQ5-R: CTGAGGACTCGCCCGTGT (SEQ ID NO: 2); KCNQ5-P: CTCGCGGACTTGGCAGCCGCG (SEQ ID NO: 3); Septin9-F: GCTGAGCCAGGGGGCCTAGGG (SEQ ID NO: 4); Septin9-R:CCCGCGGTCAACGCGCAGCT (SEQ ID NO:5); Septin9-P: GGCCGGGGAGGGGCCGGCGCCCGC (SEQ ID NO: 6); IKZF1-F: GCGCCATCCTAACTTCTGCC (SEQ ID NO:7); IKZF1-R:GAGGATCAACTTTTCCCCACCC (SEQ ID NO:8); IKZF1-P: TTGTGTGCACCCAGGCCAACATGGAA (SEQ ID NO: 9); ACTB-F1: GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 10); ACTB-R: CCAAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 11); ACTB-P: ACCACCACCCAACACACAATAACAAACACA (SEQ ID NO: 12).

[0006] Furthermore, KCNQ5, Septin9, IKZF1, and ACTB were labeled with FAM, VIC, CY5, and ROX fluorescent groups, respectively.

[0007] Secondly, the application of the primer-probe composition is provided, specifically its use in the preparation of a kit for detecting MRD after colorectal cancer surgery.

[0008] Thirdly, a dynamic monitoring method for postoperative MRD detection in colorectal cancer based on multi-gene methylation qPCR is provided, comprising the following steps: S1. Detect the Ct values ​​of KCNQ5, Septin9, IKZF1, and ACTB in the sample; S2. Automated reading of Ct values ​​from the qPCR instrument, calculation of P values ​​using binary logistic regression, the calculation formula is Lg(P / 1-P)=55.652-0.577*Ct(Septin9)-0.479*Ct(KCNQ5)-0.303*Ct(IKZF1), and then analysis of the optimal decision threshold using ROC curve; S3. Determine if the result is MRD positive, MRD negative, or invalid; if P ≥ 0.54, the result is MRD positive; if P < 0.54, the result is MRD negative; if the internal reference gene has no amplification curve or Ct value > 34, the result is invalid. S4. Set up a dynamic monitoring process and make clinical decisions based on the results of dynamic monitoring; if the postoperative MRD is negative, the clinical decision is: low risk, adjuvant chemotherapy can be exempted or reduced; if the postoperative MRD is positive, the clinical decision is: high risk, and intensive adjuvant therapy + intensive monitoring every 3 months is recommended; if the MRD turns positive during the follow-up period, the clinical decision is: indicating the risk of recurrence, and enhanced CT / MRI examination is recommended within 1 month.

[0009] Fourthly, a dynamic monitoring system for postoperative MRD detection of colorectal cancer based on multi-gene methylation qPCR is provided to implement the aforementioned dynamic monitoring method. The dynamic monitoring system includes a qPCR detection module, a data acquisition module, a data analysis module, and a clinical decision support module.

[0010] The qPCR detection module is used to detect the Ct values ​​of KCNQ5, Septin9, IKZF1, and ACTB in the sample; The data acquisition module is used to automatically read the Ct values of the qPCR instrument, calculate the P value using binary logistic regression, and the calculation formula is Lg(P / 1 - P) = 55.652 - 0.577 * Ct(Septin9) - 0.479 * Ct(KCNQ5) - 0.303 * Ct(IKZF1). Then, the ROC curve is used to analyze the optimal determination threshold; The data analysis module is used to determine MRD positive, MRD negative or the result is invalid; if P ≥ 0.54, it is determined as MRD positive; if P < 0.54, it is determined as MRD negative; if there is no amplification curve for the internal reference gene or the Ct value > 34, the result is invalid.

[0011] The clinical decision support module is used to make clinical decisions in combination with the results of dynamic monitoring; the decision rule of the clinical decision support module is: if the postoperative MRD is negative, the clinical decision is: low risk, exemption or reduction of adjuvant chemotherapy can be considered; if the postoperative MRD is positive, the clinical decision is: high risk, intensive adjuvant treatment + intensive monitoring every 3 months is recommended; if the MRD turns positive during the follow-up period, the clinical decision is: indicating the risk of recurrence, and enhanced CT / MRI examination is recommended within 1 month.

[0012] The beneficial effects of the present invention are as follows: 1. High sensitivity / specificity: The combination of multiple genes makes the sensitivity reach 82% and the specificity reach 95%, which is better than single-gene detection; 2. Cost-effectiveness: The cost of single-case detection is about 500 yuan - 1500 yuan (about 1 / 5 - 1 / 10 of the NGS sequencing cost), which is suitable for promotion in hospitals at all levels; 3. Fast turnover: The results can be obtained within 6 hours to 8 hours, meeting the needs of rapid clinical decision-making; 4. Full-cycle management: It covers the entire process of "postoperative → treatment → follow-up", realizing a closed-loop from risk stratification to recurrence intervention. Detailed implementation manners

[0013] Example 1 This example provides a colorectal cancer postoperative MRD detection system based on multi-gene methylation qPCR, specifically as follows: The first link: Sample processing (1) Plasma preparation: Standardly collect 5 mL of peripheral blood (EDTA anticoagulant) from postoperative patients, centrifuge at 1500 × g for 10 minutes, carefully aspirate the upper plasma into a new centrifuge tube (nuclease-free centrifuge tube), and pay attention not to aspirate the middle layer of white blood cells. Then centrifuge the plasma at 15000 × g for 10 minutes and transfer the plasma to a new centrifuge tube.

[0014] (2) Extract cfDNA using the nucleic acid extraction or purification reagent of Kedia Biological (Henan Zhengzhou Medical Device Preparation 20250288); the specific steps are as follows: ① Add 2 mL of plasma sample, 1 mL of lysis buffer, and 100 μL of proteinase K to a 15 mL centrifuge tube in sequence. Vortex for 15 s and incubate at 56 °C for 15 min.

[0015] ② Add 3 mL of binding solution to the above lysed sample. Vortex for 15 s, then add 120 μL of magnetic beads. Vortex for 15 s and incubate with shaking for 8 min.

[0016] ③ After incubation, perform a short centrifugation. Place the centrifuge tube on a magnetic stand for 3 - 5 min until the solution becomes clear and transparent. Carefully remove the supernatant. (Open the lid carefully to prevent nucleic acid loss caused by splashing of the solution.) ④ Add 4 mL of washing solution I to the centrifuge tube. Vortex for 15 s. Place the centrifuge tube on a magnetic stand for 3 - 5 min until the solution becomes clear and transparent. Carefully remove the supernatant.

[0017] ⑤ Add 2 mL of washing solution II to the centrifuge tube. Vortex for 15 s. Place the centrifuge tube on a magnetic stand for 3 - 5 min until the solution becomes clear and transparent. Carefully remove the supernatant.

[0018] ⑥ After repeating step ⑤ once, open the lid and dry at room temperature for 8 - 10 min until the surface of the magnetic beads is slightly matte and the magnetic beads have no cracks.

[0019] ⑦ Add 60 - 120 μL of elution buffer, mix by shaking, and let stand at room temperature for 1 - 2 min.

[0020] ⑧ Place the centrifuge tube on the magnetic stand. After the magnetic beads are completely adsorbed, carefully transfer the supernatant containing free DNA to a new centrifuge tube for standby.

[0021] (3)Bisulfite conversion: Use the pretreatment reagent for methylation detection of samples from Cotia Biotechnology (Henan Zhengzhou Medical Device Preparation 20250289) for conversion; the specific steps are as follows: ① Bisulfite conversion: Place the conversion solution on a metal bath and oscillate at room temperature for 10 min before use. Take μL of the test sample and add it to a new PCR tube. Add 120 μL of the conversion solution, mix well for 20 s, put it into a PCR instrument, and start the conversion. The conversion program is: 98 °C for 10 min; 64 °C for 2.5 h; 4 °C Hold (not exceeding 24 h).

[0022] ② Take a new 1.5 mL centrifuge tube and add <630 μL of binding solution (thoroughly mix by shaking before use), 300 μL of isopropanol, 180 μL of the above conversion product, and 15 μL of magnetic beads. Vortex thoroughly for 30 s and place it on a metal bath and incubate with shaking at 1200 rpm for 10 min.

[0023] ③ After briefly centrifuging the 1.5mL centrifuge tube, place it on a magnetic rack for 3-5 minutes. Once the solution is clear, discard the supernatant.

[0024] ④ Add 100 μL of cleaning solution, vortex for 15-30 seconds, then centrifuge briefly and place on a magnetic rack for 3-5 minutes. After the solution becomes clear, discard the supernatant. Add 476 μL of desulfurizing agent, vortex thoroughly, and then place on a metal bath and incubate at room temperature with shaking at 1200 rpm for 15-20 minutes.

[0025] ⑤ Centrifuge briefly, place on a magnetic rack for 3-5 minutes, and discard the supernatant after the solution becomes clear.

[0026] ⑥ Add 500μL of cleaning solution, vortex for 15s-30s, then centrifuge briefly on a magnetic rack for 3min-5min. After the solution becomes clear, discard the supernatant.

[0027] ⑦ Repeat step ⑥ and discard the supernatant.

[0028] ⑧ Place the centrifuge tubes on a magnetic rack and let them air dry for 5-8 minutes, until the surface of the magnetic beads is slightly matte and the beads are not cracked. ⑨ Add 30 μL of elution buffer, vortex to mix, let stand for 5-8 minutes, centrifuge briefly, place on a magnetic rack and wait for the solution to clarify before transferring the conversion product to a new centrifuge tube for later use.

[0029] The second step: Multiplex PCR primer / probe design and detection (1) Through bioinformatics screening (TCGA / ICGC database + clinical sample verification), three gene combinations with high specificity for colorectal cancer were identified, such as KCNQ5, Septin9, and IKZF1; specific primers were designed for each methylation site and labeled with different fluorescent groups, namely KCNQ5, Septin9, IKZF1, and ACTB were labeled with FAM, VIC, CY5, and ROX fluorescent groups, respectively; KCNQ5-F: GATGCCTGGTCCTTGCC (SEQ ID NO: 1); KCNQ5-R: CTGAGGACTCGCCCGTGT (SEQ ID NO: 2); KCNQ5-P: CTCGCGGACTTGGCAGCCGCG (SEQ ID NO: 3); Septin9-F: GCTGAGCCAGGGGGCCTAGGG (SEQ ID NO: 4); Septin9-R:CCCGCGGTCAACGCGCAGCT (SEQ ID NO:5); Septin9-P: GGCCGGGGAGGGGCCGGCGCCCGC (SEQ ID NO: 6); IKZF1-F: GCGCCATCCTAACTTCTGCC (SEQ ID NO:7); IKZF1-R:GAGGATCAACTTTTCCCCACCC (SEQ ID NO:8); IKZF1-P: TTGTGTGCACCCAGGCCAACATGGAA (SEQ ID NO: 9); ACTB-F1: GTGATGGAGGAGGTTTAGTAAGTT (SEQ ID NO: 10); ACTB-R: CCAAATAAAACCTACTCCTCCCTTAA (SEQ ID NO: 11); ACTB-P: ACCACCACCCAACACACAATAACAAACACA (SEQ ID NO: 12).

[0030] (2) qPCR reaction system and conditions: ① Depending on the sample volume, remove the PCR reaction solution and primer mixture from the -20℃±5℃ freezer and place them on ice to thaw slowly. Vortex the PCR reaction solution for 10-15 seconds and then briefly centrifuge.

[0031] ② Each PCR reaction requires 18µL of PCR reaction solution and 2µL of primer mixture. Add the corresponding volumes of PCR reaction solution and primer mixture to a centrifuge tube according to the ratio. Vortex to mix and obtain the PCR pre-reaction solution, then briefly centrifuge.

[0032] ③ Add 20 µL of PCR pre-reaction solution to an 8-tube PCR apparatus. Add 20 µL of BisDNA to the corresponding well of the PCR tube. Seal the tube with the cap, and centrifuge briefly to ensure all the mixture flows to the bottom of the tube without any air bubbles appearing.

[0033] ④ Set up the reaction program as shown in Table 1: Table 1 Reaction Procedure Record Sheet Analyze the results, set the starting point of the baseline to the "10th" cycle and the ending point to the "18th" cycle, and set KCNQ5, Septin9, IKZF1, and ACTB to appropriate thresholds (fine-tuning can be made according to specific circumstances).

[0034] ⑤ Import the Ct value of the sample test into the P value calculation formula, Lg(P / 1-P)=55.652-0.577*Ct(Septin9)-0.479*Ct(KCNQ5)-0.303*Ct(IKZF1), calculate and output the P value and determine the positive or negative result.

[0035] The third step: quality control: setting up negative controls, positive controls, and internal reference gene (ACTB).

[0036] Table 2 Quality Control Result Record Sheet When there is no amplification in the FAM, VIC, and CY5 channels, the Ct value is defined as 43.0. All of the above requirements must be met simultaneously in the same experiment; otherwise, the result is considered invalid and must be repeated.

[0037] Example 2 This embodiment provides a dynamic monitoring system for postoperative MRD detection in colorectal cancer based on multi-gene methylation qPCR, including a qPCR detection module, a data acquisition module, a data analysis module, and a clinical decision support module, as detailed below: qPCR detection module: used to detect the Ct values ​​of KCNQ5, Septin9, IKZF1, and ACTB in the sample.

[0038] Data acquisition module: used to automatically read the Ct value of qPCR instrument, calculate the P value using binary logistic regression, Lg(P / 1-P)=55.652-0.577*Ct(Septin9)-0.479*Ct(KCNQ5)-0.303*Ct(IKZF1), and then use ROC curve analysis to determine the optimal decision threshold.

[0039] Data analysis module: used to determine MRD positive, MRD negative, or invalid results; if P ≥ 0.54, MRD is determined to be positive; if P < 0.54, MRD is determined to be negative; if the internal reference gene has no amplification curve or Ct value > 34, the result is invalid.

[0040] Clinical decision support module: used to make clinical decisions based on the results of dynamic monitoring.

[0041] Dynamic monitoring process: Baseline detection: Baseline methylation levels were measured 1 week before surgery; postoperative MRD was measured 4 weeks ± 1 week after surgery. Adjuvant therapy monitoring: Testing after every 2 cycles of chemotherapy (to assess efficacy); Follow-up monitoring: Test every 3 months to 2 years after surgery, and then every 6 months to 5 years thereafter.

[0042] If the postoperative MRD is negative, the clinical decision is: low risk, adjuvant chemotherapy can be waived or reduced. If the postoperative MRD is positive, the clinical decision is: high risk, and intensive adjuvant therapy + intensive monitoring every 3 months is recommended; If the MRD turns positive during the follow-up period, the clinical decision is: it indicates a risk of recurrence, and it is recommended to have an enhanced CT / MRI examination within 1 month (a warning 5-20 months earlier than imaging).

[0043] A three-year prospective cohort study is detailed below: We monitored 143 patients who underwent colorectal cancer surgery and 30 healthy volunteers for 3 years. Follow-up and sampling were conducted at 1 month, 6 months, 1 year, 2 years, and 3 years post-surgery. MRD analysis was performed on samples collected at each follow-up according to the above-mentioned testing procedure, and the results were then compared with the patients' subsequent imaging and pathological examinations. Details of the sample testing are shown in Table 3, and the statistical results are shown in Table 4. Table 3. Details of sample testing from 143 postoperative colorectal cancer patients and 30 healthy volunteers. Table 4 Statistical Table of Test Results During the 3-year follow-up, 27 postoperative patients experienced recurrence or distant metastasis, of whom 22 were correctly detected as MRD positive, and 5 were missed. Of all recurrence-free individuals (116 disease-free survivors + 30 healthy individuals = 146), 139 were correctly detected as MRD negative. Of all recurrence-free individuals, 1 healthy individual and 6 disease-free survivors were falsely detected as positive, totaling 7 cases.

[0044] Sensitivity = 22 / 27 ≈ 81.48%; Specificity = 139 / 146 ≈ 95.20%.

[0045] Case Study 1: Postoperative MRD Examination and Risk Stratification (1) Sample: 5 mL of peripheral blood was collected from a patient with stage II colon cancer 4 weeks after surgery, 2.3 mL of plasma was separated, and 18.2 ng of cfDNA (70 μL, 0.26 ng / μL) was extracted; (2) Bisulfite conversion: 15.6 ng (60 μL) was added for conversion; (3) qPCR detection: The combination of three genes KCNQ5, Septin9 and IKZF1 was used. The results showed that the Ct values ​​of KCNQ5, Septin9 and IKZF1 were 35.86, 36.24 and NoCt, respectively, and the P value was calculated to be 0.99. (4) Threshold determination: P value > 0.54, MRD positive; (5) Clinical decision-making: After MDT discussion, adjuvant chemotherapy was added, and ctDNA was monitored every 3 months.

[0046] Case Study 2: Dynamic Monitoring and Recurrence Early Warning (1) Patient background: Stage III rectal cancer patient, MRD negative 4 weeks after surgery, and discontinued medication after completing 6 weeks of adjuvant chemotherapy; (2) Follow-up monitoring: ctDNA was still negative 12 months after surgery, and the P value (0.61) > 0.54 at 15 months (positive); (3) Intervention measures: Immediate chest, abdomen and pelvis CT was performed, and a 1.2cm metastatic lesion in the right lobe of the liver was found (8 months earlier than the imaging results). (4) Treatment adjustment: surgical resection of metastatic lesions + chemotherapy, currently disease-free survival.

[0047] The monitoring data are shown in Table 5: Table 5. Statistical table of postoperative monitoring data for patients with stage III rectal cancer. The above embodiments are only used to illustrate the technical ideas and features of the present invention, and are not intended to be unique or to limit the present invention. Those skilled in the art should understand that various changes or equivalent substitutions made to the present invention without departing from its scope are all within the scope of protection of the present invention.

Claims

1. A primer and probe composition for detecting postoperative MRD in colorectal cancer based on multi-gene methylation qPCR, characterized in that, Associated with three genes: KCNQ5, Septin9, and IKZF1, ACTB serves as an internal reference gene. The primer and probe composition includes: KCNQ5-F: GATGCCTGGTCCTTGCC; KCNQ5-R: CTGAGGACTCGCCCGTGT; KCNQ5-P: CTCGCGGACTTGGCAGCCGCG; Septin9-F: GCTGAGCCAGGGGGCCTAGGG; Septin9-R:CCCGCGGTCAACGCGCAGCT; Septin9-P: GGCCGGGGAGGGGCCGGCGCCCGC; IKZF1-F: GCGCCATCCTAACTTCTGCC; IKZF1-R:GAGGATCAACTTTTCCCACCC; IKZF1-P: TTGTGTGCACCCAGGCCAACATGGAA; ACTB-F1:GTGATGGAGGAGGTTTAGTAAGTT; ACTB-R: CCAAATAAAACCTACTCCTCCCTTAA; ACTB-P:ACCACCACCCAACACACAATAACAAACACA.

2. The primer and probe composition for postoperative MRD detection of colorectal cancer based on multi-gene methylation qPCR according to claim 1, characterized in that, KCNQ5, Septin9, IKZF1, and ACTB were labeled with FAM, VIC, CY5, and ROX fluorescent groups, respectively.

3. The application of the primer-probe composition according to claim 1 or 2, characterized in that, Use in the preparation of a kit for MRD detection after colorectal cancer surgery.

4. A dynamic monitoring system for postoperative MRD detection in colorectal cancer based on multi-gene methylation qPCR, characterized in that, include: qPCR detection module: used to detect the Ct values ​​of KCNQ5, Septin9, IKZF1, and ACTB in the sample, using the primer and probe composition described in claim 1 or 2 during detection; Data acquisition module: used to automatically read the Ct value of qPCR instrument, calculate the P value using binary logistic regression, Lg(P / 1-P)=55.652-0.577*Ct(Septin9)-0.479*Ct(KCNQ5)-0.303*Ct(IKZF1), and then use ROC curve analysis to determine the optimal decision threshold; Data analysis module: used to determine MRD positive, MRD negative, or invalid results; Clinical decision support module: used to make clinical decisions based on the results of dynamic monitoring.

5. The dynamic monitoring system for postoperative MRD detection of colorectal cancer based on multi-gene methylation qPCR according to claim 4, characterized in that, The judgment rule of the data analysis module is: if P≥0.54, then MRD is judged to be positive; If P < 0.54, then MRD is considered negative; If the internal reference gene has no amplification curve or the Ct value is >34, the result is invalid.

6. The dynamic monitoring system for postoperative MRD detection of colorectal cancer based on multi-gene methylation qPCR according to claim 4, characterized in that, The decision-making rules of the clinical decision support module are as follows: if the postoperative MRD is negative, the clinical decision is: low risk, adjuvant chemotherapy can be exempted or reduced; if the postoperative MRD is positive, the clinical decision is: high risk, and intensive adjuvant therapy + intensive monitoring every 3 months is recommended. If the MRD turns positive during the follow-up period, the clinical decision is: it indicates a risk of recurrence, and it is recommended to undergo enhanced CT / MRI examination within 1 month.

Images