InDel molecular marker for screening salt-tolerant gene C2H2-24 of wild rice and application thereof
By designing specific primer pairs for PCR amplification and electrophoresis identification, the problem of identifying salt-tolerant genes in rice has been solved, enabling rapid and accurate identification of salt-tolerant genotypes, shortening the breeding cycle, and improving the efficiency of salt-tolerant rice breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SANYA NATIONAL INSTITUTE OF SOUTHERN BREEDING CHINESE ACADEMY OF AGRICULTURAL SCIENCES
- Filing Date
- 2026-04-30
- Publication Date
- 2026-05-29
AI Technical Summary
Existing technologies make it difficult to quickly and accurately identify salt-tolerant genes in rice, resulting in long breeding cycles for salt-tolerant rice, significant interference from environmental factors, and high consumption of human and material resources.
Specific primer pairs (WR-F and WR-R) were designed for PCR amplification. InDel molecular markers were used to identify the salt tolerance of the rice C2H2-24 gene. Electrophoresis bands were used to determine whether the 710 bp salt tolerance gene fragment was present.
It enables rapid and accurate identification of salt-tolerant genotypes, shortens the breeding cycle, reduces environmental interference and human and material consumption, and provides an efficient molecular marker-assisted selection technology system.
Smart Images

Figure CN122105003A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to the InDel molecular marker for screening the salt tolerance gene C2H2-24 in wild rice and its application. Background Technology
[0002] Rice ( Oryza sativa L. (Lysimachia christinae) is one of my country's major food crops, belonging to the category of moderately salt-sensitive plants, and is also one of the main crops used to improve saline-alkali land. According to statistics from the Food and Agriculture Organization of the United Nations in 2021, the global area of saline-alkali soil exceeds 833 million hectares. 2 Regarding methods for addressing soil salinization, Hugo BoyKo advocates using saline water to irrigate crops and employing salt-tolerant crops. Compared to methods like constructing water conservancy facilities for drainage and chemical treatments, which are slower to implement, these approaches are more economical and have more lasting effects. Therefore, identifying salt-tolerant genes in rice and studying the response mechanisms of rice to salt stress are of great significance for breeding salt-tolerant varieties.
[0003] Wild rice is the ancestor of cultivated rice. Having grown in the natural environment for a long time, it possesses a large number of stress-resistance and disease-resistant genes that were lost or weakened during rice domestication. In recent decades, due to the widespread adoption of bred varieties, the genetic base of cultivated rice varieties has become increasingly narrow. Developing and utilizing salt-tolerant genes in wild rice germplasm resources is a key means to broaden the genetic base of cultivated rice and cultivate salt-tolerant rice varieties. Molecular marker-assisted breeding can significantly shorten the breeding cycle and rapidly cultivate new salt-tolerant rice varieties; therefore, developing molecular markers associated with salt-tolerant genes in wild rice is particularly important. Summary of the Invention
[0004] The inventors of this invention have discovered a new salt-tolerant gene in wild rice. C2H2-24 (LOC_ Os02g08510) Through the construction of near-isogenic lines and transgenic experiments, the strong salt tolerance of the allele in wild rice was verified. The purpose of this invention is to design new molecular markers based on the sequence polymorphism of this gene in wild and cultivated rice, for future molecular-assisted selection to cultivate new varieties using this gene, thereby accelerating the process of salt-tolerant rice breeding.
[0005] To achieve the above objectives, the present invention provides the following technical solution: The first aspect of the present invention provides an InDel molecular marker-specific primer pair for identifying salt tolerance in rice, consisting of an upstream primer WR-F with the nucleotide sequence shown in SEQ ID NO. 1 and a downstream primer WR-R with the nucleotide sequence shown in SEQ ID NO. 2.
[0006] A second aspect of this invention provides the application of the InDel molecular marker-specific primer pair in identifying salt tolerance in rice. C2H2-24 The PCR amplification product of rice containing a salt-tolerant gene fragment in its gene coding region consists of only one 710 bp electrophoretic band. C2H2-24 PCR amplification products of rice whose gene coding region does not contain a salt-tolerance gene fragment showed no bands; rice containing a salt-tolerance gene fragment... C2H2-24 The nucleotide sequence of the gene is shown in SEQ ID NO. 3; the rice is wild rice, cultivated rice 9311, a wild rice near-isogenous line constructed with wild rice as the donor parent and cultivated rice 9311 as the recipient parent, and an F2 segregating population constructed by crossing the wild rice near-isogenous line with cultivated rice 9311.
[0007] The third aspect of the present invention provides screening rice C2H2-24 The method for determining the presence or absence of salt tolerance genes in gene coding regions includes the following steps: S1. Select rice leaves to extract genomic DNA, and then use the genomic DNA as a template and the corresponding sequences of WR-F and WR-R as specific primers to perform PCR amplification to obtain amplified fragments. S2. The PCR amplification products were classified by agarose gel electrophoresis, and the presence of salt tolerance gene fragments was determined based on the electrophoretic bands. S3. Identification Results: If the PCR amplification product shows only one 710 bp band, then the rice sample... C2H2-24 The gene coding region contains a salt tolerance gene fragment; if no band appears in the PCR amplification product, then the rice being tested... C2H2-24 The gene coding region does not contain salt tolerance gene segments; The rice varieties mentioned are wild rice, cultivated rice 9311, a near-isogenic population of wild rice constructed using wild rice as the donor parent and cultivated rice 9311 as the recipient parent, and an F2 segregating population constructed by crossing the near-isogenic population of wild rice with cultivated rice 9311.
[0008] Further, the PCR amplification system is as follows: 50 μL, including 25 μL of 2×PCR Buffer for KODFX Neo, 10 μL of 2mM dNTPs, 1.5 μL of 10 pmol / μL primer pair, 1 μL of KOD-FX-Neo enzyme, 5 μL of DMSO, 100 ng template DNA, and sterile water added to 50 μL.
[0009] Furthermore, the PCR amplification program is as follows: 95℃ pre-denaturation for 5 min; 98℃ pre-denaturation for 10 s, 60℃ annealing for 30 s, 68℃ extension for 45 s, for 35 cycles; and finally 68℃ extension for 10 min.
[0010] The beneficial effects of this invention are: Detection of different individual plants using this InDel molecular marker C2H2-24 The genotype of this gene enables rapid breeding of rice varieties improved using the salt-tolerant locus in wild rice. The successful development of this molecular marker has enabled precise laboratory identification of salt-tolerant genotypes. Compared to traditional field phenotypic screening methods, it effectively improves the current situation where field trials are greatly affected by environmental factors, have long screening cycles, and consume high levels of manpower and resources. It provides an efficient molecular marker-assisted selection technology system for salt-tolerant rice breeding, and has significant theoretical and practical implications. Attached Figure Description
[0011] Figure 1 For cultivated rice 9311 and wild rice C2H2-24 Electrophoresis diagram of gene PCR amplification products: Lanes 1, 2 and 3 are wild rice, 9311 and Marker, respectively.
[0012] Figure 2 Salt-sensitive individual plants (left) and salt-tolerant individual plants (right) in the F2 population.
[0013] Figure 3 For individual plants of the F2 segregating population C2H2-24 Electrophoresis diagram of gene PCR amplification products: Lane 12 is the marker, lanes 3, 5, 7, and 8 are salt-tolerant plants in the F2 population, and lanes 1, 2, 4, 6, 9, and 10 are salt-sensitive plants in the F2 population. Detailed Implementation
[0014] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.
[0015] Explanation of the sequence list: SEQ ID NO. 1 (WR-F): TACTCAGTTTCAGGGGGAGGG SEQ ID NO. 2 (WR-R): CGGAAAATTATATGATGTTTA SEQ ID NO. 3 (wild rice) C2H2-24 (Gene nucleotide sequence) ACATCTCAAGTTAAGTTGGTGTGGTGGTGTTCGTCGACGTAGCGCGCGCCATGGAAGGGATGAGCAAGCTCGCCGGAGGAGGAGGCGACGTGACGTTCGTCGGCGGCGGCCGTCGCATGGCGGCCGCGGCCGCCGCGGCGCTCCGGCTCGTCGAGCTGGACCTCATCGGCACGGTGGGCGCCGCCGTGCCGGGGCAGGCGACGGCGCCTCGTCTGCTCGTCGTGTCGCCGGCGCCGGCGAAGGAGGAGGAACGCGACGGCGACGACGACGGCGAGCCGCGGCAGCTGTTCGCGTGCCACTACTGCCGGCGCGAGTTC TACTCAGTTTCAGGGGGAGGG AGCTCGCAGGCGCTGGGCGGCCACCAGAACGCGCACAAGCGGGAGCGCACGCTCGCCAGGCGCGGCGCCGGCGCGGGCGCCGGCGGCGAGCAAGCGTCGTCGTCGTCTTTCGCCATCCACCACGGCGCGTTCGTGTCGGCGTCGCCGGGGTGGATGGCGCGCGTGCTTCACGGCGAGGCGCCGCCGGCGATCTCGGTGGCCGGCGACGGCGGCGGCGGCGAGCGGTGGTGGTGGGGCGGTGGAAACGTCGGCTACTACTGGCCGCGCGACGGAGACGATCAAACGCGTCAACTCGACCTGACGCTAAAGCTGTGAAATTGCTGGTGTAAAAAAACACACATATGGACACATATTTTTGCTGCTGGAAATGACCCTAGCTTTTTCTTCTCCTGCATTTTTTTTTCTTGCTTCTACATTTCTGGTGTCCCGGTTGATCGGGACACGGATCCTCTGCAGTACTGCACTTGCAGTAGCAGTAGTTGACGGGTGGTCCCAATCCCATATTTCAATGGCAGCTACTGTAGGTGCAGTAATGTAAATAATCCCCACTGTGTTGATCGATGTATATAAATACTAGTAATTTTACAACCTTAATTCCAAGAATTACTTGGCATCTCTTTCCATCATTCCATGCACGTATGCTCTACTATGTAAACTGACCCTGACCGTAA TAAACATCATATAATTTTCCG SEQ ID NO. 4 (Cultivated Rice 93-11) C2H2-24 (Gene nucleotide sequence) Experimental materials: wild rice, cultivated rice 9311, a near-isogenic line of wild rice constructed using wild rice as the donor parent and cultivated rice 9311 as the recipient parent, and an F2 segregating population constructed by crossing the near-isogenic line of wild rice with cultivated rice 9311. Example 1
[0016] A method for screening the presence of salt-tolerant genes in the C2H2-24 coding region of wild rice includes the following steps: Primer design: Through analysis of cultivated rice 9311 C2H2-24 Sequence alignment of the gene and wild rice alleles revealed an 18bp insertion in the wild rice allele. Primers were designed based on the upstream and downstream sequences of this 18bp insertion. SEQ ID NO. 1 (WR-F): TACTCAGTTTCAGGGGGAGGG SEQ ID NO. 2 (WR-R): CGGAAAATTATATGATGTTTA Step 1: Extract genomic DNA from rice leaves. Using the DNA as a template, and with WR-F and WR-R corresponding sequences as specific primers, perform PCR amplification to obtain amplified fragments. The PCR amplification volume is 50 μL, including 25 μL of 2×PCR Buffer for KOD-FX-Neo, 10 μL of 2 mM dNTPs, 1.5 μL of 10 pmol / μL primer pair, 1 μL of KOD-FX-Neo enzyme, 5 μL of DMSO, 100 ng template DNA, and sterile water to a final volume of 50 μL. The PCR amplification program is as follows: DNA pre-denaturation at 95℃ for 5 min; pre-denaturation at 98℃ for 10 s; annealing at 60℃ for 30 s; extension at 68℃ for 45 s; 35 cycles; and a final extension at 68℃ for 10 min.
[0017] Step 2: The PCR amplification products are classified by agarose gel electrophoresis, and the presence of salt tolerance gene fragments is determined based on the electrophoretic bands.
[0018] Step 3, Identification Results: The rice with only one 710 bp band in the PCR amplification product is wild rice, which is a salt-tolerant single plant; the rice with no band after electrophoresis is cultivated rice 9311, which is a salt-sensitive single plant.
[0019] Two types of rice C2H2-24 The molecular identification results of the gene were consistent with the salt tolerance phenotype identification results, indicating that the identification procedure of this invention is simple and has a wide range of applications. Figure 1 ). Example 2
[0020] Constructing wild rice with cultivated rice 9311 as the background parent. C2H2-24 Near-isogenic line NIL was developed. NIL was backcrossed with cultivated rice 9311 to construct an F2 segregating population. The salt tolerance of individual F2 plants was then assessed.
[0021] Step 1: Genomic DNA was extracted from leaves of cultivated rice populations 9311 and F2. Using this DNA as a template and specific primers corresponding to the WR-F and WR-R sequences, PCR amplification was performed to obtain amplified fragments. The PCR amplification volume was 50 μL, including 25 μL of 2×PCR Buffer for KOD-FX-Neo, 10 μL of 2 mM dNTPs, 1.5 μL of 10 pmol / μL primer pair, 1 μL of KOD-FX-Neo enzyme, 5 μL of DMSO, 100 ng template DNA, and sterile water to a final volume of 50 μL. The PCR amplification program was: DNA pre-denaturation at 95℃ for 5 min; pre-denaturation at 98℃ for 10 s; annealing at 60℃ for 30 s; extension at 68℃ for 45 s; 35 cycles; and a final extension at 68℃ for 10 min.
[0022] Step 2: The PCR amplification products are classified by agarose gel electrophoresis, and the presence of salt tolerance gene fragments is determined based on the electrophoretic bands.
[0023] Step 3, Identification Results: PCR amplification products showing only a 710 bp band indicate salt-tolerant individual plants from the F2 population; electrophoresis showing no band indicates salt-sensitive individual plants from the F2 population. Figure 2-3 ).
[0024] Table 1 Experimental Results .
Claims
1. A specific primer pair of InDel molecular markers for identifying salt tolerance in rice, characterized in that, It consists of the upstream primer WR-F with the nucleotide sequence shown in SEQ ID NO. 1 and the downstream primer WR-R with the nucleotide sequence shown in SEQ ID NO.
2.
2. The application of the InDel molecular marker-specific primer pair according to claim 1 in identifying salt tolerance in rice, characterized in that, C2H2-24 The PCR amplification product of rice containing a salt-tolerant gene fragment in its gene coding region consists of only one 710 bp electrophoretic band. C2H2-24 PCR amplification products of rice whose gene coding region does not contain a salt-tolerance gene fragment showed no bands; rice containing a salt-tolerance gene fragment... C2H2-24 The nucleotide sequence of the gene is shown in SEQ ID NO. 3; the rice is wild rice, cultivated rice 9311, a wild rice near-isogenous line constructed with wild rice as the donor parent and cultivated rice 9311 as the recipient parent, and an F2 segregating population constructed by crossing the wild rice near-isogenous line with cultivated rice 9311.
3. Selecting rice varieties C2H2-24 A method for determining the presence or absence of salt tolerance genes in gene coding regions, characterized in that... It includes the following steps: S1. Select rice leaves to extract genomic DNA, and then use the genomic DNA as a template and the corresponding sequences of WR-F and WR-R as specific primers in claim 1 to perform PCR amplification to obtain amplified fragments. S2. The PCR amplification products were classified by agarose gel electrophoresis, and the presence of salt tolerance gene fragments was determined based on the electrophoretic bands. S3. Identification Results: If the PCR amplification product shows only one 710 bp band, then the rice sample... C2H2-24 The gene coding region contains a salt tolerance gene segment; If no band appears in the PCR amplification product, then the rice being tested... C2H2-24 The gene coding region does not contain salt tolerance gene segments; The rice containing the salt-tolerant gene fragment C2H2-24 The nucleotide sequence of the gene is shown in SEQ ID NO. 3; The rice varieties mentioned are wild rice, cultivated rice 9311, a near-isogenic population of wild rice constructed using wild rice as the donor parent and cultivated rice 9311 as the recipient parent, and an F2 segregating population constructed by crossing the near-isogenic population of wild rice with cultivated rice 9311.
4. The method according to claim 3, characterized in that, The PCR amplification system was as follows: 50 μL, including 25 μL of 2×PCR Buffer for KOD-FX-Neo, 10 μL of 2 mM dNTPs, 1.5 μL of 10 pmol / μL primer pair, 1 μL of KOD-FX-Neo enzyme, 5 μL of DMSO, 100 ng template DNA, and sterile water to a final volume of 50 μL.
5. The method according to claim 3, characterized in that, The PCR amplification program is as follows: 95℃ pre-denaturation for 5 min; 98℃ pre-denaturation for 10 s, 60℃ annealing for 30 s, 68℃ extension for 45 s, for 35 cycles; and finally 68℃ extension for 10 min.