Use of oxr1 as a target in the preparation of a drug for treating osteoclast-related bone diseases

CN122124250BActive Publication Date: 2026-08-11THE FIRST AFFILIATED HOSPITAL OF WENZHOU MEDICAL UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-05-06
Publication Date
2026-08-11

AI Technical Summary

Technical Problem

[0006]为了解决现有治疗骨质疏松症的药物存在副作用大,机制单一等问题,本发明基于对破骨细胞分化调控机制的深入研究,首次鉴定出氧化抗性蛋白1(OXR1)是破骨细胞中一个此前从未被认识到的关键调控因子

Benefits of technology

(1)本发明首次鉴定出氧化抗性蛋白1(OXR1)是破骨细胞分化过程中一个此前从未被认识到的关键调控因子。现有技术中尚无任何关于OXR1与破骨细胞功能或骨质疏松之间关联的报道。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122124250B_ABST
    Figure CN122124250B_ABST
Patent Text Reader

Abstract

This invention discloses the application of OXR1 as a target in the preparation of drugs for treating osteoclast-related bone diseases. This invention reveals for the first time the crucial role of OXR1 in osteoclast differentiation: OXR1 directly binds to the KEAP1 protein, promoting the interaction between KEAP1 and p62, thereby mediating mitophagy, clearing excess reactive oxygen species generated during osteoclast differentiation, and maintaining mitochondrial homeostasis. Inhibiting OXR1 expression or function can effectively block osteoclast differentiation and reduce bone loss. Based on this, this invention provides two intervention strategies targeting OXR1: one is gene therapy using adeno-associated viruses carrying shRNA targeting OXR1; the other is screening and validating the novel use of the FDA-approved drug velpatasvir as an OXR1 inhibitor. In vitro and in vivo experiments confirmed that both significantly inhibit osteoclast activity and improve the osteoporotic phenotype in ovariectomized mice.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of oxidative resistance protein 1 (OXR1) as a novel drug target in the preparation of drugs for treating osteoporosis, rheumatoid arthritis, bone metastases from cancer, and other osteoclast-related bone diseases, as well as gene therapy drugs and small molecule inhibitors based on this target. Background Technology

[0002] Osteoporosis (OP) is a systemic bone metabolic disease characterized by decreased bone mass, destruction of bone microstructure, and increased bone fragility, severely impacting patients' quality of life. With the aging population, its incidence is increasing year by year. Osteoclasts (OCs) are the only cells in the body responsible for bone resorption; their overactivation is a major cause of osteolytic bone diseases such as osteoporosis, rheumatoid arthritis, and bone metastases from cancer.

[0003] Osteoclast differentiation and function are highly dependent on energy metabolism. Studies have shown that mitochondrial oxidative phosphorylation (OXPHOS) is significantly enhanced during osteoclast differentiation, providing cells with a large amount of ATP while generating a large amount of reactive oxygen species (ROS). ROS, as an important signaling molecule, participates in the regulation of osteoclast differentiation, but excessive accumulation of ROS leads to protein oxidation, lipid peroxidation, and DNA damage, ultimately endangering cell survival. Therefore, osteoclasts must precisely coordinate the production and clearance of ROS to maintain redox homeostasis in order to complete the differentiation process. However, the molecular mechanisms by which osteoclasts sense ROS levels and initiate mitophagy to clear damaged mitochondria are not yet fully understood.

[0004] Current medications for treating osteoporosis mainly include bisphosphonates, RANKL inhibitors (denosumab), and estrogen receptor modulators. However, these drugs have significant limitations: long-term use of bisphosphonates may lead to osteonecrosis of the mandible and atypical femoral fractures; there is a risk of vertebral fracture rebound after discontinuation of denosumab; and hormone replacement therapy may increase the risk of cardiovascular events and tumors. Therefore, developing anti-osteoporosis drugs based on novel mechanisms and targets is of significant clinical importance.

[0005] In recent years, studies have shown that autophagy and mitophagy play important roles in the regulation of osteoclast function. However, the expression pattern, function, and relationship of OXR1 in osteoclasts with bone metabolic diseases have never been reported before. Summary of the Invention

[0006] To address the issues of significant side effects and limited mechanisms of action in existing osteoporosis treatments, this invention, based on in-depth research into the regulatory mechanisms of osteoclast differentiation, identifies oxidative resistance protein 1 (OXR1) as a previously unknown key regulatory factor in osteoclasts. OXR1 coordinates mitophagy to clear excess reactive oxygen species (ROS), maintaining mitochondrial function and ensuring normal osteoclast differentiation. Targeting and inhibiting OXR1 expression or activity blocks the interaction between OXR1 and KEAP1, thereby inhibiting KEAP1-p62-mediated mitophagy, leading to osteoclast mitochondrial dysfunction and excessive ROS accumulation, ultimately suppressing osteoclast differentiation and bone resorption.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: This invention demonstrates the effectiveness of oxidative resistance protein 1 (OXR1) as a drug target through a series of in vitro and in vivo experimental evidence, as detailed below: 1. This study is the first to reveal the high expression of OXR1 in osteoclasts and its positive correlation with bone loss diseases.

[0008] 2. This study is the first to demonstrate that OXR1 is a gene essential for maintaining mitochondrial homeostasis and differentiation in osteoclasts.

[0009] 3. The molecular mechanism of OXR1 function was elucidated for the first time: OXR1 directly binds to the KEAP1 protein, promoting the interaction between KEAP1 and the autophagy aptamer p62, thereby mediating ubiquitin-dependent mitophagy and clearing damaged mitochondria and excess ROS.

[0010] Based on the above mechanism, this invention provides two intervention strategies targeting OXR1: a. Gene therapy: By injecting AAV9-shRNA vector into the bone marrow, OXR1 expression was knocked down in the bone marrow microenvironment, successfully inhibiting osteoporosis in ovariectomized mice.

[0011] b. Repurposing old drugs: Through virtual screening and experimental verification, it was found that the FDA-approved antiviral drug velpatasvir is a potent inhibitor of OXR1, which can mimic the effect of gene knockdown and inhibit osteoclast differentiation and bone resorption in vivo and in vitro, thus treating osteoporosis.

[0012] Specifically, the present invention provides the application of an OXR1 inhibitor in the preparation of a drug for treating osteoclast-related bone diseases.

[0013] Furthermore, the OXR1 inhibitor inhibits osteoclast differentiation and / or bone resorption by inhibiting the binding of OXR1 to KEAP1 or inhibiting the OXR1-KEAP1-p62 signaling axis.

[0014] Further, the OXR1 inhibitor comprises: (a) A nucleic acid molecule that targets the OXR1 encoding gene, said nucleic acid molecule being able to inhibit the expression of the OXR1 gene; (b) a small molecule compound, antibody or its antigen-binding fragment that specifically binds to the OXR1 protein and inhibits its activity; or (c) a small molecule compound that can bind to the OXR1-KEAP1 interaction interface and block the binding of the two.

[0015] Furthermore, nucleic acid molecules that target the OXR1 encoding gene include small interfering RNA (siRNA), short hairpin RNA (shRNA), antisense oligonucleotides (ASO), or gene editing tools (CRISPR-Cas9 system).

[0016] Further, the nucleic acid molecule is a short hairpin RNA contained in an adeno-associated virus vector; the adeno-associated virus vector is AAV9; the sequence of the short hairpin RNA (shRNA) is shown in SEQ ID NO: 1: GCCATTTAAAGTAAGTAGTGATGG.

[0017] Furthermore, the small molecule compound is velpatasvir or a pharmaceutically acceptable salt, hydrate, solvate, isomer, or prodrug thereof.

[0018] Furthermore, the osteoclast-related bone diseases include osteoporosis, rheumatoid arthritis, or bone metastases from cancer.

[0019] The present invention also provides a pharmaceutical composition for treating osteoclast-associated bone disease, comprising a therapeutically effective amount of the above-mentioned OXR1 inhibitor.

[0020] Furthermore, the pharmaceutical composition is delivered via intraosseous, abdominal injection, or systemic administration.

[0021] Compared with the prior art, the present invention has the following beneficial effects: (1) This invention is the first to identify oxidative resistance protein 1 (OXR1) as a key regulatory factor in osteoclast differentiation that was previously unknown. There are no reports in the prior art on the association between OXR1 and osteoclast function or osteoporosis.

[0022] (2) This invention is the first to fully propose the core role of the “OXR1-KEAP1-p62” signaling axis in regulating osteoclast mitochondrial homeostasis and differentiation. The mechanism is clear and the evidence chain is complete, providing a solid theoretical basis and clear molecular target for the subsequent design and screening of small molecule drugs targeting this axis.

[0023] (3) Based on the above mechanism, this invention innovatively provides two distinct intervention strategies (gene therapy strategy and small molecule drug therapy strategy) that both have high translational potential, which can meet different clinical needs.

[0024] In gene therapy strategies, an adeno-associated virus serotype 9 vector (AAV9-shOXR1) carrying a short hairpin RNA targeting OXR1 was constructed. Through intraosseous injection, this vector can be efficiently delivered to the bone marrow cavity and successfully knock down the expression of OXR1 in the bone marrow. In the OVX mouse model, AAV9-shOXR1 treatment significantly reduced bone loss, preserved the structure and number of trabecular bone, and inhibited osteoclast activity. This provides a new option for patients who cannot tolerate long-term drug treatment or require precise local intervention.

[0025] In small molecule drug therapy strategies, virtual screening identified the antiviral drug velpatasvir as having a high predicted binding affinity for OXR1 (binding energy of -10.41 kcal / mol) from approximately 2,600 FDA-approved drugs. SPR experiments confirmed its potent, concentration-dependent binding to OXR1. In vitro experiments showed that velpatasvir inhibited the expression of the osteoclast key proteins NFATc1 and CTSK. More importantly, in the OVX mouse model, intraperitoneal injection of velpatasvir significantly inhibited bone loss, with effects comparable to gene therapy. Since velpatasvir is already a marketed drug with known safety and pharmacokinetic properties, it can significantly shorten drug development cycles and reduce costs, possessing extremely high value for rapid clinical translation.

[0026] (4) The in vivo and in vitro experimental data of the present invention are sufficient, and the effectiveness of targeting OXR1 has been confirmed at the cellular, molecular and whole animal levels. AAV9 and velpatasvir are both known drug carriers / drugs with good safety and low expected side effects. Attached Figure Description

[0027] The present invention will now be described in further detail with reference to the accompanying drawings and specific embodiments.

[0028] Figure 1 The pseudo-time analysis plot based on single-cell RNA sequencing data (GSE147174) shows that OXR1 expression is significantly positively correlated with the key osteoclast transcription factor NFATc1 and the marker gene Acp5. Figure 2 Immunofluorescence staining of mouse femoral tissue shows that OXR1 protein (green) is mainly located in mature osteoclasts on the bone surface (TRAP staining, red). Figure 3The Western blot plot shows that, compared with the sham operation group, the expression levels of OXR1 and cFOS proteins in the bone tissue of ovariectomized (OVX) mice were significantly increased in a synchronous manner. Figure 4 TRAP staining and quantitative analysis showed that knocking down OXR1 with siRNA (siOXR1) significantly reduced the number of osteoclasts (TRAP-positive multinucleated cells). Figure 5 The staining fluorescence pattern and quantitative analysis of JC-1 showed that the mitochondrial membrane potential (red / green fluorescence ratio) in osteoclast precursor cells of the siOXR1 group was significantly decreased, indicating mitochondrial dysfunction. Figure 6 The immunofluorescence staining image shows that the ubiquitin colocalization signal in mitochondria is significantly reduced in the siOXR1 group cells; Figure 7 The Western blot plot shows that the siOXR1 group had a decreased level of mitochondrial ubiquitination in the mitochondrial components isolated from cells. Figure 8 The image shows endogenous co-immunoprecipitation (co-IP), indicating that the amount of co-precipitation of KEAP1 and p62 is significantly reduced in OXR1 knockdown cells. Figure 9 TRAP staining and quantitative analysis showed that treatment with the mitophagy inducer PMI could significantly rescue siOXR1-induced osteoclast differentiation defects. Figure 10 The image shows a bioluminescence imaging pattern, demonstrating that the AAV9 vector can be effectively delivered into the bone marrow cavity of mice. Figure 11 The qPCR analysis diagram shows that the mRNA expression levels of OXR1 and its downstream target gene CTSK in the bone marrow of mice treated with AAV9-shOXR1 were significantly reduced. Figure 12 Micro-CT three-dimensional reconstruction and quantitative analysis of the femur showed that AAV9-shOxr1 treatment improved bone microstructure in OVX mice; Figure 13 HE and TRAP staining images of femoral tissue sections show that AAV9-shOxr1 treatment reduced osteoclast count and bone loss; Figure 14 The Western blot plot shows that velpatasvir inhibits the expression of the key osteoclast proteins NFATc1 and CTSK. Figure 15 Micro-CT three-dimensional reconstruction and quantitative analysis of the femur showed that intraperitoneal injection of velpatasvir significantly reduced bone loss in OVX mice. Detailed Implementation

[0029] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0030] Experimental methods: 1. Public Single-Cell RNA Sequencing and Proteomics Data Processing Single-cell RNA sequencing data processing began with downloading raw data (GSE147174) from the Omnibus (GEO) database. All upstream processes, including empty droplet detection, quality control indicator generation, two-cell prediction, and environmental RNA estimation, were completed using the Single Cell TKR software package (version 2.6.0). Subsequently, the SeuratR software package (Version 4.1) was used to select the 2000 most differentially expressed genes (HVGs) as cell type identification markers. Principal component analysis (PCA) was then performed on the highly variable genes (HVGs) to achieve dimensionality reduction, retaining the top 20 principal components for UMAP projection and cluster analysis. Cellular markers from the original paper were used to identify osteoclasts at different stages. The Wilcoxon rank-sum test was used to determine differentially expressed genes (DEGs) at each stage, and Monocle3 was applied to infer cell developmental trajectories and identify genes related to cell fate. Data visualization was performed using the SCPR software package. The integrated and manually annotated Human Bone Marrow Single Cell Atlas (v2.0) was downloaded from the Deeply Integrated Human Single Cell Omics Database (DISCO). To assess protein changes during the differentiation of bone marrow macrophages into osteoclasts, proteomics data on these changes were downloaded from ProteomeXchange (PXD009610) and reprocessed to generate a heatmap based on Logfc values. Potential interacting proteins of OXR1 were identified through reanalysis of the supplementary proteomics data. Regulatory information on KEAP1 was retrieved from the QuickGO database, which provides gene ontology (GO) annotations.

[0031] 2. Laboratory animals All animal experimental procedures were approved by the Animal Ethics Committee of Wenzhou Medical University (wydw2024-0487, wydw2025-0058, wydw2025-0087) and the Animal Ethics Committee of the University of Western Australia (2022 / ET000933). Oxr1-flox mice with a C57BL / 6J background were provided by Cyagen Biosciences (certificate number: S-CKO-18562). Lyz2-iCre mice with a C57BL / 6J background were generously provided by Professor Liu Qian (Guangxi Medical University) and could also be purchased commercially (GemPharmatech, certificate number T003822). The purpose was to construct myeloid-specific conditional knockout mice (Lyz2-Cre;Oxr1...). fl / fl Oxr1 fl / fl Mice were crossed with Lyz2-Cre mice to obtain Lyz2-Cre;Oxr1 mice. flox / + Descendants, subsequently with Oxr1 fl / fl Mice were inbred. Lyz2-Cre;Oxr1 was obtained as a result. fl / fl The mouse was named Oxr1 cKO Oxr1 of the same age and sex fl / fl Mice served as the control group. Genomic DNA extracted from tail biopsy samples was used for genotyping.

[0032] The following primers are used to detect the Oxr1-flox allele: The forward primer sequence is shown in SEQ ID NO: 8: 5'-CATTGTTACAGGGAGAATGAGCTGAGAGA-3'; The reverse primer sequence is shown in SEQ ID NO: 9: 5'-TGAGAAACACCAACACTGTCTGAAG-3'.

[0033] Cre recombinase detection uses the forward primer sequence as shown in SEQ ID NO: 10: 5'-GAACACACCTGGAAAGATGCTCC-3'; The reverse primer sequence is shown in SEQ ID NO: 11: 5'-CATCCTTGGCCACATAGATTCAGG-3'.

[0034] Primary bone marrow macrophages (BMMs) were isolated from wild-type C57BL / 6J mice, and an ovariectomy (OVX) model was established. All animals (no more than five per cage) were housed in a pathogen-specific sterile (SPF) facility with controlled environmental conditions: temperature (22±2°C), humidity (40-60%), and a 12-hour light-dark cycle. Animals had free access to water and were fed standard laboratory feed.

[0035] 3. Immunofluorescence (IF) For in vitro staining, cells were fixed in 4% paraformaldehyde at room temperature for 15 min, permeabilized with 0.1% Triton X-100 in PBS for 5 min, and then blocked by incubation with 3% BSA in PBS for 30 min. Cells were then incubated overnight at 4°C with primary antibody diluted in 0.2% BSA / PBS. After washing, cells were incubated with fluorescein-labeled secondary antibody at room temperature for 1 h. Cell nuclei were counterstained with DAPI, and samples were mounted using ProLong Glass mounting media (Invitrogen). Image acquisition was performed using a Nikon A1R or ZEISS Celldiscoverer 7 confocal microscope. For bone tissue sections, femurs were fixed in 4% paraformaldehyde solution at 4°C for 24 h, followed by gentle decalcification in 0.5M EDTA (pH 7.4) at 4°C for 7 days with stirring. Samples were cryoprotected in 20% sucrose solution for 24 h, and then in 30% sucrose solution for 24 h. Bone tissue was embedded in OCT and then cryosectioned. Thawed sections were rehydrated with PBS buffer, treated with 0.3% Triton X-100 to increase cell permeability, and blocked with 5% BSA in PBS for 1 h. Sections were incubated overnight with primary antibody at 4°C, followed by incubation with fluorescein-labeled secondary antibody at room temperature for 1 h. Stained sections were imaged using a Nikon A1R confocal microscope.

[0036] 4. Establishment and treatment of animal models of osteoporosis The animal experimental protocol was approved by the Academic Committee of Wenzhou Medical University (wdyw2025-0058 and wdyw2025-0087). To establish an osteoporosis model, 8-week-old female wild-type C57BL / 6 mice were randomly divided into a sham-operated group and an ovariectomy group (OVX). Under isoflurane anesthesia, mice in the sham-operated group underwent exploratory laparotomy to evert the ovaries but not remove them; while mice in the OVX group underwent bilateral ovariectomy to induce osteoporosis. All animals began velpatasvir or AAV9 treatment one week after surgery. For the velpatasvir treatment group, OVX mice received intraperitoneal injections of 20 mg / kg velpatasvir every two days for 8 weeks. The dosage was calculated based on the human-mouse clinical conversion factor. The sham-operated group and the OVX control group received the same volume of solvent.

[0037] 5. Plasmid and siRNA transfection Human OXR1 and KEAP1 cDNAs were cloned into the pcDNA3.1-FLAG and pcDNA3.1-HA vectors, respectively, to construct FLAG-tagged OXR1 expression plasmids and HA-tagged KEAP1 expression plasmids (GemPharma, No. B14916). All constructs were validated by first-generation sequencing. In the overexpression study, HEK293T cells were transfected with either the pcDNA3.1-OXRI or pcDNA3.1-KEAP1 plasmids using the Effectene transfection reagent (QIAGEN), following the manufacturer's instructions. Cells transfected with the empty vector pcDNA3.1 (Invitrogen) served as a control group. To silence OXR1 expression during osteoclast differentiation, primary bone marrow macrophages were transfected with OXR1-targeted siRNA using the DharmaFECT transfection reagent (HorizonDiscovery) or as a non-targeted negative control transfection (Millennium Science), following the manufacturer's instructions. Knockdown efficiency was validated by real-time quantitative PCR and Western blot analysis.

[0038] 6. Sample preparation and electron microscopy (EM) imaging Cells were cultured on etched mesh coverslips (MatTek) and fixed in 4% electron microscopy-grade formaldehyde solution after treatment. Confocal imaging was performed before electron microscopy, and the coordinates of target cells were recorded for subsequent correlation analysis. For bone tissue, samples were fixed in 0.1M sodium dimethylarsinate buffer containing 2% paraformaldehyde, 2.5% glutaraldehyde, and 2.1% sucrose. Decalcification was performed using a solution containing 1.9% glutaraldehyde and 0.15M EDTA in 0.06M sodium dimethylarsinate buffer for two weeks, using a rotary shaker, changing the solution every three days until the bone tissue softened. Post-fixation was performed using 2% osmium tetroxide and 1.5% potassium ferricyanide solution in an ice bath for 1 hour. Samples were then washed five times with cold distilled water, incubated in 1% thiocarbazide solution at room temperature for 45 minutes, and then treated with 2% osmium tetroxide for 30 minutes. The samples were then stained overnight in a 2% uranium acetate aqueous solution at 4°C. The following day, after washing, the samples were dehydrated using a gradient of ethanol (30%, 50%, 70%, 85%, 95%, 100%), and finally treated with 100% acetone, each step lasting 5 minutes. The dehydrated samples were then incubated sequentially in 50% and 75% resin (dissolved in anhydrous acetone) for 2 hours, and finally overnight in 100% resin, to impregnate the samples with Embed 812 resin. For cell samples, resin-filled coverslips were placed on individual BEEM capsules and cured in a vacuum oven at 65°C for 48 hours. After polymerization, the coverslips were removed using liquid nitrogen. All resin-embedded blocks (cells and tissues) were sectioned to a thickness of 500 nm using a Leica UC6 ultramicrotome and mounted on silicon wafers for electron microscopy imaging. Ultrastructural imaging was performed using a FEI Verios or Helios scanning electron microscope (ThermoFisher Scientific). For related light and electron microscopy (CLEM) techniques, cell samples previously imaged by immunofluorescence were processed using the same electron microscopy preparation procedure, and images were correlated using the easyCLEM plugin in ICY software. To image bone resorption lacunae, bovine bone sections were dried in a 37°C oven for 48 hours, treated with gold-palladium sputtering coating, and imaged using a FEIVerios scanning electron microscope with an Everhart-Thornley detector.

[0039] 7. Measurement of intracellular reactive oxygen species and detection of mitochondrial membrane potential After two rounds of siRNA transfection, cells were cultured for 1 h on day 3 in HBSS containing 20 μM 2',7'-dichlorodihydrofluorescein diacetate (H2DCFDA; Invitrogen) to assess intracellular reactive oxygen species (ROS) levels. Detection was performed using a Zeiss Celldiscoverer 7 (CD7) confocal microscope with an excitation wavelength of 488 nm and an emission wavelength collection range of 515–540 nm. Bright-field images were also acquired using transmitted light. For quantitative analysis, individual cells were segmented using Cellpose 3, and the average fluorescence intensity per cell was calculated using a custom ImageJ macro. To assess mitochondrial membrane potential (Δψm), cells were incubated with 10 μM JC-1 dye (Abcam) at 37 °C in complete culture medium for 20 min. After washing with 1×HBSS, images were created under a Zeiss CD7 microscope. JC-1 monomers (indicating low Δψm) emitted green fluorescence (excitation wavelength 475 nm), while J-aggregates (indicating high Δψm) emitted red fluorescence (excitation wavelength 535 nm). Cellpose 3 was used again for cell segmentation, and the red-green fluorescence ratio of each cell was calculated to quantify Δψm.

[0040] 8. Virtual Filtering The active site of the OXR1 protein was determined using previous KEAP1-OXR1 protein docking results. To evaluate the binding interaction between FDA-approved small molecule ligands and the OXR1 protein, a molecular docking procedure was employed using the GPU-accelerated AutoDock4. Ligand structures were generated using the RDKit toolkit and subsequently preprocessed using the Meeko Python library, which included atom type assignment, calculation of Gasteiger local charges, and generation of rotatable bond information. Docking simulations were performed using AutoDock4-GPU, employing a Lamarckian genetic algorithm to explore potential binding conformations. Default parameters such as population size, mutation rate, and crossover rate were applied, while exhaustiveness parameters were adjusted, and the proteins were sorted according to predicted binding free energies. Docking results were visualized using PyMOL (3.1.4.1).

[0041] 9. Surface Plasmon Resonance (SPR) Detection SPR binding kinetics were evaluated using a Berthold bScreen LB 991 instrument. To detect drug binding, velpatasvir was immobilized on a three-dimensional photocrosslinked sensor chip as the stationary phase. Recombinant mouse OXR1 protein (MyBiosource, catalog number MBS1385663) was diluted in PBST buffer (pH 7.4, containing 0.1% Tween-20) to a series of concentration gradients (10, 40, 160, 640, and 2560 nM) and injected into the chip surface at a flow rate of 0.5 μL / s. The binding process was monitored at 4°C for 600 s, followed by a 360 s dissociation phase. To assess protein-protein interactions, recombinant human and mouse OXR1 and KEAP1 proteins (OriGene) were used in the experiments. In these experiments, OXR1 was immobilized on the chip surface, and different concentrations of KEAP1 (10–2560 nM in PBST) were allowed to flow through the chip surface under the same conditions.

[0042] 10. Western blot and co-immunoprecipitation Cell culture and bone tissue proteins were analyzed using a solution containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1 mM NaF, 0.25% sodium deoxycholate, 1% (v / v) Nonidet P-40, and a protease inhibitor cocktail (Roche). Cell lysates were clarified by centrifugation at 15,000 rpm for 15 min at 4 °C. Protein concentration was determined using a BCA protein assay kit (Thermo Fisher). An equal volume of protein was mixed with 1xSDS loading buffer, boiled at 100 °C for 5 min, separated by SDS-PAGE (10–17.5% gel), and transferred to a nitrocellulose membrane. The membrane was washed with 5% TBST in skim milk for 1 h (room temperature) and then incubated overnight at 4 °C with primary antibody. After washing, the membrane was incubated with HRP-labeled secondary antibody at room temperature for 1 h and then visualized using enhanced chemiluminescence (ECL; Bio-Rad) on a ChemiDoc (Bio-Rad) or FusionFX (Viber) imaging system. In the exogenous co-immunoprecipitation assay, HEK293T cells transfected with FLAG or HA-tagged constructs were lysed in RIPA buffer. After pre-cleaning, an equal volume of total protein was incubated overnight at 4°C with anti-FLAG agarose beads (Sigma). After washing, the bound proteins were eluted with 2xSDS buffer overnight at 4°C, followed by Western blot analysis. In the endogenous co-immunoprecipitation assay, cells were lysed in an ice bath with a buffer containing a mixture of 1 mM EDTA, 150 mM NaCl, 1% (v / v) Nonidet-P40, 0.25% sodium deoxycholate, and a protease inhibitor. After centrifugation, protein A / G magnetic beads were used for pre-cleaning, and the total protein content was quantified using a BCA protein assay kit. An equal volume of lysate protein was incubated overnight at 4°C with primary antibody. The next day, pre-washed magnetic beads were added to the immune complex and incubated at 4°C for 4 hours. After eluting the antigen-antibody-magnetic bead complex, Western spectroscopy was performed.

[0043] 11. Preparation of AAV9-shRNA treatment group The AAV9-shRNA treatment group used a custom-made AAV9 vector from GeneChem Ltd. (Shanghai, China). The experimental vector (AAV9-shOxr1) encoded a short hairpin RNA targeting mouse OXR1 (sequence shown in SEQ ID NO: 1: GCCATTTAAAGTAAGTAGTGATGG), under the control of the U6 promoter, and simultaneously carried an mCherry fluorescent reporter gene driven by the CAG promoter for transduction tracking. The control vector (AAV9-shCtrl) carried a non-targeting random sequence shRNA (sequence shown in SEQ ID NO: 2: CGCTGAGTACTTCGAAATGTC). At 11 weeks of age, mice were anesthetized, and the hair around the left knee joint was shaved. 10 μL of AAV9 (5 × 10⁻⁶) was administered using a microsyringe. 10 (vg) was injected intraosseously into the medullary cavity of the distal femur. Two weeks after injection, two mice from each group were randomly selected and euthanized, and tissue samples were collected for bioluminescence imaging to confirm mCherry expression. A second injection of the same dose was administered in week 4 to maintain transgene expression.

[0044] 12. Quantitative Real-Time PCR (qPCR) Total RNA was extracted from cultured cells or tissues using TRIzol reagents according to the manufacturer's instructions (Thermo Fisher Scientific). cDNA was synthesized using the Luna Universal Transcription Supermix Kit. Amplification was performed on a real-time PCR system using SYBR Green master mix and Luna universal primers. -ΔΔCt The method calculates relative gene expression levels, with Hprt1 used as an internal reference.

[0045] 13. Micro-CT Scanning and Analysis Collected bone samples were fixed in 10% neutral buffered formaldehyde for 24 hours to ensure the removal of all excess soft tissue. The femur was then scanned using a Skyscan 1276 microCT instrument (Bruker microCT, Contisch, Belgium). Scanning parameters included: source voltage 100kV, source current 200μA, an A1 0.5mm filter, pixel size 9μm, and rotation step size of 0.4 degrees. The acquired images were reconstructed using CTVOX software (Bruker microCT), with a ring artifact correction factor of 7, a smoothing factor of 2, and 40% beam hardening correction. A precise volume of interest (ROI) with a height of 1mm was established 0.5mm proximal to the distal femoral growth plate. Within this volume, the region of interest in cancellous bone was manually delineated. Bone parameters within this region were uniformly measured using a binarization threshold of 100-255. Quantitative analyses, particularly of bone volume fraction (BV / TV), trabecular bone number (Tb.N), trabecular bone spacing (Tb.Sp), and trabecular bone thickness (Tb.Th), were performed using CTAn software (Bruker microCT).

[0046] 14. Detection of osteoclastogenesis and bone resorption Primary bone marrow macrophages (BMMs) were isolated from C57BL / 6J mice. The procedure was as follows: Bone marrow was flushed from the femur and tibia, and then supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, 50 U / mL penicillin, and 50 U / mL streptomycin (complete medium). To enrich BMMs, non-adherent cells were collected after 24 hours of culture and transferred to complete α-MEM medium containing macrophage colony-stimulating factor (M-CSF, 25 ng / mL). After three days, adherent cells were harvested and induced to differentiate into multinucleated cells using nuclear factor kappa ligand receptor activator (RANKL, 10 ng / mL) and macrophage colony-stimulating factor (M-CSF, 25 ng / mL). The medium was changed every two days. At the end of differentiation, cells were fixed with 4% paraformaldehyde for 15 min and stained for tartrate-resistant acid phosphatase (TRAP) activity. Multinucleated cells with three or more nuclei were counted as osteoclasts under an optical microscope. For bone resorption detection, bone marrow macrophages (BMMs) were directly seeded onto inactivated bovine cortical bone sections and cultured in osteoclast induction medium. To assess resorption pit formation, cells were removed using a 10% bleach solution, and the bone sections were dried, sputtered with gold, and then imaged under an electron microscope. Quantitative analysis was performed using Fiji / ImageJ software.

[0047] 15. Total RNA Sequencing and Analysis RNA sequencing libraries were prepared according to the manufacturer's instructions using the Sureselect SSXT RNA Library Preparation Kit (Agilent). These RNA libraries were sequenced on an Illumina NovaSeq 6000 platform, generating 150 bp paired-end reads. Raw sequencing data were processed using the nf-core / rnaseq workflow (v3.18). Reads were aligned to the GRCm38 reference genome to generate gene expression values ​​in millions of transcripts (TPM). Differential gene expression analysis was performed using DESeq2 in the R environment. Genes with a corrected p-value < 0.05 and |log2 fold change| > 0.5 were considered differentially expressed genes. Enrichment analysis was then performed on these differentially expressed genes, including the GO, KEGG, and GSEA pathways, using the clusterProfiler package and visualized using the GseaVis package. To reduce redundancy and aid interpretation, the network-based tool vissE was used to organize the enriched gene sets.

[0048] 16. Flow cytometry Cells were seeded in 6-well plates and cultured for 3 days under osteoclast-inducing conditions, with or without siRNA treatment. After incubation, cells were collected by trypsin-EDTA digestion, washed with PBS, and stained with MitoTracker Deep Red dye (Thermo Fisher Scientific) according to the manufacturer's instructions. After staining, cells were washed again with PBS and resuspended in flow cytometry buffer (PBS containing 2% FBS). Flow cytometry analysis was performed using a BD flow cytometer, and data were analyzed using FlowJo software (version 10.8, BD Biosciences).

[0049] 17. Protein-protein docking and molecular dynamics simulation The mouse proteins KEAP1 (Uniprot ID: Q9Z2X8) and OXR1 (Uniprot ID: Q4KMM3) were refined using AlphaFold 2, a process that included feature extraction, domain identification, and model construction. Subsequent optimization employed the Preparation Wizard module (Schrödinger) for structural preprocessing, including hydrogen atom addition, hydrogen bond optimization, atom collision analysis, and energy minimization based on the OPLS4 force field after treatment at pH 7.0. Binding site analysis used the Site Map algorithm to identify potential non-covalent interaction regions on the surfaces of the two proteins. These potential binding pockets were then spatially characterized using a mesh generation module. Protein-protein docking simulations were performed using the Protein-Protein XP Docking Module (Schrödinger). After 70,000 diverse protein docking attempts, conformations were screened based on functional group overlap and electron cloud fusion. Feasible conformations were further screened using free energy analysis, with the lowest energy state being selected as the optimal solution. Finally, the stability was evaluated using the MM-GBSA scoring method (Schrödinger).

[0050] Molecular dynamics simulations were performed using Desmond software (DEShaw Research) to supplement previously obtained static protein-protein structure-conformation and energy data. A liquid system in an aqueous environment was established, containing the complex, water molecules, neutralizing ions, and a 0.15 M sodium chloride solution to simulate in vivo buffering conditions. The simulation chamber adopted an orthorhombic crystal form, with minimum volume as the optimization objective. Molecular dynamics simulations tracked intermolecular motion and bonding changes (covalent and non-covalent bonds, including hydrogen bonds, hydrophobic bonds, ionic bonds, and water bridges), with a default simulation duration of 6.0 ns (1000 frames). Key simulation parameters included an NPT ensemble (constant particle number, pressure, and temperature), with an initial temperature of 300 K and a pressure of 1.01325 bar.

[0051] 18. Velpatasvir cytotoxicity assay Cells were seeded in 96-well plates and cultured overnight to promote adhesion. Subsequently, cells were treated with different concentrations of velpatasvir (0, 0.1, 1, 2.5, 5, 10, 100 μM) for 48 h. Following this, cells were co-cultured with CCK-8 solution for 2 h. Cell viability was quantified by measuring absorbance at 450 nm using a SpectraMax M5 (Molecular Devices).

[0052] 19. Histomorphometric Analysis Histomorphometry was performed on long bones according to the methods described previously. Bones were fixed in 10% neutral buffered formaldehyde for 24 h, decalcified in 14% EDTA solution at 37°C for 1 week, and then embedded in paraffin for sectioning. Osteoclast activity was assessed using TRAP staining, and bone microstructure was analyzed by H&E staining. All images were obtained from the equivalent anatomical region of each femoral section. Quantitative parameters included: osteoclast count per millimeter of bone surface (N.Oc / BS), osteoclast surface area as a percentage of bone surface area (Oc.S / BS), and the ratio of bone surface area to tissue area (BS / TS).

[0053] Example 1 Studies on the positive correlation between OXR1 expression and osteoclast function and bone loss diseases: In searching for regulatory factors of ROS during osteoclast differentiation, we first analyzed publicly available single-cell RNA sequencing datasets (GSE147174) of osteoclast precursor cells, monocytes, and mature osteoclasts.

[0054] Pseudo-time trajectory analysis revealed a highly consistent positive correlation between the expression of OXR1 gene in osteoclasts and the expression of Nfatc1, a key transcription factor for osteoclast differentiation, and Acp5, a maturation marker gene. Figure 1 As shown in the figure, OXR1 may play an important role in osteoclast differentiation.

[0055] Simultaneously, frozen sections of the femur from 8-week-old C57BL / 6J mice were prepared, and immunofluorescence co-localization technology was used to detect OXR1 (anti-OXR1 antibody) and TRAP (anti-tartrate acid phosphatase, an osteoclast marker). The results showed that the fluorescence signal of OXR1 protein almost completely overlapped with that of TRAP-positive mature osteoclasts attached to the bone surface, while almost no signal was detected in other cells such as osteocytes and bone marrow mesenchymal stem cells. Figure 2 (As shown). This indicates that OXR1 is a protein specifically highly expressed in osteoclasts.

[0056] Finally, to explore the relationship between OXR1 and pathological bone loss, a classic postmenopausal osteoporosis mouse model—oophorectomy (OVX)—was established. Eight weeks post-surgery, femurs were harvested from mice in the sham and OVX groups, and total protein was extracted for Western blot analysis. The results showed that, compared with the Sham group, the expression level of OXR1 protein in bone tissue of the OVX group was significantly increased, and its trend was completely synchronized with the expression of cFOS (clast activity-associated protein). Figure 3 As shown in the figure, this further confirms that OXR1 expression is positively correlated with pathological bone loss.

[0057] Example 2 Effects of OXR1 knockdown on osteoclast differentiation and function: Primary bone marrow macrophages (BMMs) were isolated from 6-8 week old C57BL / 6J mice to serve as osteoclast precursor cells. Premixed small interfering RNA (siOXR1) targeting OXR1 was used; the siOXR1 premix consisted of four sequences shown in SEQ ID NO: 3-6: GGACGAGTCTGAAGCGAAT、 GCATCGACTGTGAGCGGTA, CTAGATCAGTTGTCAGGAA、 TGAAATTACCAGCCAAGTA.

[0058] Alternatively, negative control siRNA can be used to transfect BMMs. siCtrl is a non-targeting random sequence, as shown in SEQ ID NO: 7: CGCTGAGTACTTCGAAATGTC.

[0059] Subsequently, the cells were cultured for 5-7 days under induction with M-CSF (25 ng / mL) and RANKL (10 ng / mL). TRAP staining results showed that the number of TRAP-positive multinucleated osteoclasts formed in the siOXR1 group was reduced by approximately 70% compared to the siCtrl group, and the area of ​​the resorption lacunae on bovine bone slices was also significantly reduced. Figure 4 As shown in the figure, OXR1 is essential for osteoclast differentiation and bone resorption.

[0060] Example 3 Research on the mechanism by which OXR1 regulates mitochondrial homeostasis: On day 3 of induced differentiation, transmission electron microscopy revealed that osteoclasts in the siCtrl group exhibited normal mitochondrial morphology and clear cristae structure; while mitochondria in the siOXR1 group showed severely damaged morphology, including swelling, cristae breakage, or disappearance. JC-1 staining analysis of mitochondrial membrane potential (ΔΨm) showed that the red / green fluorescence ratio in the siOXR1 group was significantly lower than that in the siCtrl group. Figure 5 As shown in the figure, OXR1 knockdown leads to loss of mitochondrial membrane potential and severe mitochondrial dysfunction. Simultaneously, the H2DCFDA probe was used to detect intracellular reactive oxygen species (ROS) levels, revealing that ROS levels in the siOXR1 group were significantly higher than in the control group (siCtrl group), indicating that OXR1 deficiency leads to excessive accumulation of intracellular ROS.

[0061] Example 4 Mechanism study of the OXR1-KEAP1-p62 molecular axis: To further investigate the mechanism by which OXR1 regulates mitochondrial homeostasis and osteoclast differentiation, co-immunoprecipitation combined with mass spectrometry (CoIP / MS) datasets were analyzed, revealing several potential candidate proteins that bind to OXR1. The results identified KEAP1 (Kelch-like ECH-associated protein 1) as an active molecule involved in osteoclastogenesis. Computer simulations of docking predicted a stable interaction between the active sites of OXR1 and KEAP1. Subsequent surface plasmon resonance (SPR) experiments confirmed a direct and concentration-dependent binding between the two proteins, with an equilibrium dissociation constant (KD) of 5.64 × 10⁻⁻⁻⁶. 7 mol / L.

[0062] Given the established role of KEAP1 in ubiquitin-mediated mitophagy, subsequent immunostaining of ubiquitin and the mitochondrial marker Tomm20 revealed a significant decrease in mitochondrial ubiquitin signaling in OXR1 knockdown cells. Figure 6 As shown). Western blot analysis of the isolated mitochondrial components further confirmed that the siOXR1 group had decreased mitochondrial ubiquitin levels (as shown). Figure 7 (As shown).

[0063] Endogenous co-immunoprecipitation assays confirmed that OXR1 deficiency significantly reduced the amount of KEAP1 and p62 co-precipitated. Figure 8 (As shown). The mitophagy inducer PMI (p62-mediated mitophagy inducer) can bypass upstream signals and directly activate p62-mediated mitophagy. Treatment of siOXR1 knockdown cells with PMI showed that PMI treatment significantly restored osteoclast differentiation capacity and rescued differentiation defects caused by OXR1 deficiency. Figure 9 (As shown).

[0064] These findings suggest a direct binding between OXR1 and KEAP1, thereby promoting their interaction with p62. This process is crucial for ubiquitin-mediated mitochondrial autophagy during osteoclast differentiation.

[0065] Example 5 Translational application validation of OXR1-targeted therapy for osteoporosis: In an ovariectomized mouse model of osteoporosis, adeno-associated virus serotype 9 (AAV9-shOXR1) carrying short hairpin RNA targeting OXR1 was administered via intraosseous injection. The AAV9-shRNA treatment group used a custom-produced AAV9 vector from GeneChem Ltd. (Shanghai, China).

[0066] The experimental vector (AAV9-shOXR1) encodes a short hairpin RNA (sequence shown in SEQ ID NO: 1: GCCATTTAAAGTAAGTAGTGATGG) that targets mouse OXR1 mRNA. Under the control of the U6 promoter, it also carries an mCherry fluorescent reporter gene driven by the CAG promoter for transduction tracking.

[0067] The control vector (AAV9-shCtrl) carries a non-targeted random sequence shRNA (sequence shown in SEQ ID NO: 2: CGCTGAGTACTTCGAAATGTC).

[0068] Four weeks after injection, bioluminescence imaging confirmed that the AAV9 vector was efficiently delivered to the bone marrow. Figure 10 (A and B). qPCR analysis of bone marrow lysates confirmed that the expression level of OXR1 in the bone marrow was lower than that in the control group, and the expression of the downstream gene CTSK was also significantly decreased. Figure 11 (As shown).

[0069] Micro-CT scanning and 3D reconstruction display Figure 12 As shown in the figure, compared with the AAV9-shCtrl control group, the AAV9-shOXR1 treatment group showed significantly improved distal femoral trabecular structure, with a significant increase in bone volume fraction (BV / TV) and trabecular bone number (Tb.N). AAV9-shOXR1 treatment significantly reduced ovariectomy-induced bone loss, while preserving bone volume fraction and trabecular bone number.

[0070] Histological evaluation (HE staining and Trap staining) analysis showed that the number of osteoclasts (N.Oc / BS) was significantly reduced in the AAV9-shOXR1 treatment group. Figure 13 (As shown). The above results demonstrate that AAV9-mediated gene therapy targeting and knocking down OXR1 can alleviate bone microstructural damage caused by oophorectomy and inhibit osteoclast activity.

[0071] To complement this gene therapy approach, a virtual screening technique was used to screen approximately 2,600 FDA-approved drugs in the United States. Using binding free energy as an indicator, the antiviral drug velpatasvir was found to have an extremely high predicted binding affinity to the OXR1 protein (binding energy of -10.41 kcal / mol).

[0072] Surface plasmon resonance experiments confirmed that velpatasvir has a potent and concentration-dependent binding ability to mouse OXR1. Further Western blot analysis confirmed that velpatasvir inhibited the expression of key osteoclast differentiation proteins NFATc1 and CTSK. Figure 14 (As shown).

[0073] Finally, to evaluate the therapeutic potential of velpatasvir in vivo, velpatasvir was injected intraperitoneally into ovariectomized osteoporotic mice. Micro-CT analysis showed that ( Figure 15 As shown in the figure, compared with the OVX+solvent group, bone loss in mice treated with OVX+velpatasvir was significantly inhibited, and bone microstructural parameters (BV / TV, Tb.N) were significantly improved. This result is comparable to the effect of AAV9-shOXR1 gene therapy, confirming that velpatasvir, as a safe and marketed drug, can be effectively repurposed as an OXR1 inhibitor for the treatment of osteoporosis. Based on these findings, velpatasvir, an FDA-approved drug, is established as a potential therapeutic target for pathological osteoporosis.

[0074] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. The application of an OXR1 inhibitor in the preparation of a drug for treating osteoclast-related bone diseases, characterized in that, The OXR1 inhibitor is a short hairpin RNA or a small molecule drug velpatasvir containing a sequence in AAV9 as shown in SEQ ID NO: 1, and the osteoclast-associated osteoporosis is estrogen deficiency osteoporosis.

2. The application according to claim 1, characterized in that, The OXR1 inhibitors inhibit osteoclast differentiation and / or bone resorption by inhibiting the binding of OXR1 to KEAP1 or by inhibiting the OXR1-KEAP1-p62 signaling axis.

3. A pharmaceutical composition for treating osteoclast-associated bone disease, characterized in that, The OXR1 inhibitor comprises a therapeutically effective amount as described in claim 1 or 2, wherein the OXR1 inhibitor is a short hairpin RNA contained in AAV9 with a sequence as shown in SEQ ID NO:

1.

4. The pharmaceutical composition according to claim 3, characterized in that, The pharmaceutical composition is delivered via a systemic administration route.

Citation Information

Patent Citations

  • Combination formulation of three antiviral compounds

    CN109310678A