*Agaricus nigra* strains and molecular marker combinations for identifying *Agaricus nigra* strains
By cultivating the lotus leaf agaric strain Finc-LD-9 and using SNP molecular marker combination identification and optimized cultivation technology, the stability and consistency issues of the lotus leaf agaric strain in industrialized cultivation were solved, achieving high-yield, high-quality, and long-shelf-life edible fungi production.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHANGHAI FINC BIO TECH INC
- Filing Date
- 2026-04-21
- Publication Date
- 2026-06-02
Smart Images

Figure CN122128113A_ABST
Abstract
Description
Technical Field
[0001] This application belongs to the field of edible fungi and relates to a strain of *Amanita muscaria* and a combination of molecular markers for identifying *Amanita muscaria* strains. Background Technology
[0002] Lyophyllum decastes (Fr.) Singer is a fungus belonging to the Tricholomataceae family and the Lyophyllum genus. It is a popular edible and medicinal fungus among consumers. Its unique shape, crisp and tender texture, and delicious taste make it rich in nutrients such as protein, polysaccharides, amino acids, and various minerals. It is not only a delicious dish but also has health benefits such as enhancing immunity, anti-oxidation, and regulating intestinal flora. It has broad application prospects in food processing, health product development, and other fields.
[0003] Currently, there are many problems to be solved in the industrial cultivation of *Amanita muscaria* strains on the market. For example, the uniformity of strains is poor, and the uniformity of mycelial growth, primordia development, and fruiting body development stages is insufficient, leading to high management difficulty and unstable yield during industrial production. Some strains have low yields and are not adaptable to environmental conditions (such as temperature, humidity, and contamination by other microorganisms), making them susceptible to contamination by *Phyllostachys edulis*, bacteria, and other microorganisms, resulting in low cultivation success rates. Some strains have long production cycles, affecting production efficiency and increasing planting costs. In addition, the shelf life of *Amanita muscaria* fruiting bodies cultivated by most existing strains is inconsistent, making it difficult to meet the market demand for high-quality, long-shelf-life *Amanita muscaria* products.
[0004] Therefore, cultivating a new strain of *Amanita muscaria* with high uniformity, stable yield, strong resistance to contaminating bacteria, wide environmental adaptability, and ease of industrial cultivation is of great practical significance for promoting the large-scale and standardized development of the *Amanita muscaria* industry.
[0005] Application content
[0006] The purpose of this application is to provide a strain of *Amanita muscaria* and a combination of molecular markers for identifying the strain, aiming to solve the problem of poor stability and consistency of *Amanita muscaria* varieties in the prior art under the factory-scale bottle cultivation mode.
[0007] To address the aforementioned technical issues, this application provides a Lyophyllum decastes strain, Finc-LD-9, which belongs to Lyophyllum decastes and is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 42092 and deposit date of August 29, 2025.
[0008] This application also provides a lotus leaf agaric spore, which is a spore obtained after culturing the lotus leaf agaric strain Finc-LD-9.
[0009] This application also provides a protoplast of *Amanita muscaria*, which is a protoplast obtained after culturing *Amanita muscaria* strain Finc-LD-9.
[0010] This application also provides a mycelium of *Amanita muscaria*, which is the mycelium obtained by culturing *Amanita muscaria* strain Finc-LD-9.
[0011] This application also provides a molecular marker combination for identifying the lotus leaf agaric strain Finc-LD-9, the molecular marker combination comprising the following 12 SNP molecular markers:
[0012] LyD900009_K01 has a physical location of 8-2434906 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site G / A.
[0013] LyD900014_K01 has a physical location of 1-4908913 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site C / T.
[0014] LyD900015_K01 has a physical location of 3-1162601 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site G / A.
[0015] LyD900065_K01 has a physical location of 1-1210105 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site T / C.
[0016] LyD900067_K01 has a physical location of 2-4840823 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site A / G.
[0017] LyD900069_K01 has a physical location of 3-4246939 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site C / T.
[0018] LyD900070_K01 has a physical location of 4-3446482 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site A / G.
[0019] LyD900071_K01 has a physical location of 6-1182559 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site C / T.
[0020] LyD900073_K01 has a physical location of 7-124574 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site T / C.
[0021] LyD900074_K01 has a physical location of 7-1246500 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site A / G.
[0022] LyD900075_K01 has a physical location of 9-2080525 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site G / A.
[0023] LyD900078_K01 has a physical location of 10-1704289 in the genome of *Amanita muscaria*, and contains the base polymorphism site G / A.
[0024] This application also provides a specific primer set for amplifying the above-mentioned molecular marker combination, including 12 primer sets, each primer set is used to amplify a corresponding SNP molecular marker, and each primer set includes 2 forward primers and 1 reverse primer;
[0025] The correspondence between SNP molecular markers and primer sets is as follows:
[0026] LyD900009_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.1, the forward primer 2 sequence is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.3;
[0027] LyD900014_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.4, the forward primer 2 sequence is shown in SEQ ID NO.5, and the reverse primer sequence is shown in SEQ ID NO.6;
[0028] LyD900015_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.7, the forward primer 2 sequence is shown in SEQ ID NO.8, and the reverse primer sequence is shown in SEQ ID NO.9;
[0029] LyD900065_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.10, the forward primer 2 sequence is shown in SEQ ID NO.11, and the reverse primer sequence is shown in SEQ ID NO.12;
[0030] LyD900067_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.13, the forward primer 2 sequence is shown in SEQ ID NO.14, and the reverse primer sequence is shown in SEQ ID NO.15;
[0031] LyD900069_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.16, the forward primer 2 sequence is shown in SEQ ID NO.17, and the reverse primer sequence is shown in SEQ ID NO.18;
[0032] LyD900070_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.19, the forward primer 2 sequence is shown in SEQ ID NO.20, and the reverse primer sequence is shown in SEQ ID NO.21;
[0033] LyD900071_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.22, the forward primer 2 sequence is shown in SEQ ID NO.23, and the reverse primer sequence is shown in SEQ ID NO.24;
[0034] LyD900073_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.25, the forward primer 2 sequence is shown in SEQ ID NO.26, and the reverse primer sequence is shown in SEQ ID NO.27;
[0035] LyD900074_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.28, the forward primer 2 sequence is shown in SEQ ID NO.29, and the reverse primer sequence is shown in SEQ ID NO.30;
[0036] LyD900075_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.31, the forward primer 2 sequence is shown in SEQ ID NO.32, and the reverse primer sequence is shown in SEQ ID NO.33;
[0037] LyD900078_K01 corresponds to the forward primer 1 sequence as shown in SEQ ID NO.34, the forward primer 2 sequence as shown in SEQ ID NO.35, and the reverse primer sequence as shown in SEQ ID NO.36.
[0038] The specific primer sequences are as follows:
[0039] SEQ ID NO.1: GAAGGTGACCAAGTTCATGCTTCCGCAGCTCTTGTGGATCAAAC;
[0040] SEQ ID NO.2: GAAGGTCGGAGTCAACGGATTTCCGCAGCTCTTGTGGATCAAAT;
[0041] SEQ ID NO.3:CTACCTTCCCATCCTCCGTCACTC;
[0042] SEQ ID NO.4:GAAGGTGACCAAGTTCATGCTAGCGAACGTCGCGAGGGAGAG;
[0043] SEQ ID NO.5:GAAGGTCGGAGTCAACGGATTAGCGAACGTCGCGAGGGAGAA
[0044] SEQ ID NO.6:CCCCACAGGAATAACATCCCACATC;
[0045] SEQ ID NO.7:GAAGGTGACCAAGTTCATGCTGCACCAACGATAGACGTGTCCG;
[0046] SEQ ID NO.8:GAAGGTCGGAGTCAACGGATTGCACCAACGATAGACGTGTCCA;
[0047] SEQ ID NO.9:GTCATCGGCAAAGGCCAAGGT;
[0048] SEQ ID NO.10:GAAGGTGACCAAGTTCATGCTCAAAAAACAGTTGCGTGGATGGAT;
[0049] SEQ ID NO.11:GAAGGTCGGAGTCAACGGATTCAAAAAACAGTTGCGTGGATGGAC;
[0050] SEQ ID NO.12:GGTGGCTGAACGGCTCTTTGTTC;
[0051] SEQ ID NO.13:GAAGGTGACCAAGTTCATGCTGTCGGCTCATTGAGGAAGTTGGA;
[0052] SEQ ID NO.14:GAAGGTCGGAGTCAACGGATTGTCGGCTCATTGAGGAAGTTGGG;
[0053] SEQ ID NO.15:GTTGGTATAGGTGGGCTGGAAGTTG;
[0054] SEQ ID NO.16:GAAGGTGACCAAGTTCATGCTATGCGCAAATTATGAAACTCGGGC;
[0055] SEQ ID NO.17:GAAGGTCGGAGTCAACGGATTATGCGCAAATTATGAAACTCGGGT;
[0056] SEQ ID NO.18:ATCACAGGAAATCGCCCTGGTTT;
[0057] SEQ ID NO.19:GAAGGTGACCAAGTTCATGCTAAACGAGAAATAATGTGCGACCCA;
[0058] SEQ ID NO.20:GAAGGTCGGAGTCAACGGATTAACGAGAAATAATGTGCGACCCG;
[0059] SEQ ID NO.21:CATGTCAATCTTGTCCACGCTGAA;
[0060] SEQ ID NO.22:GAAGGTGACCAAGTTCATGCTCGAGGGTCTGTAAGGGGAAGTG;
[0061] SEQ ID NO.23:GAAGGTCGGAGTCAACGGATTCCGAGGGTCTGTAAGGGGAAGTA;
[0062] SEQ ID NO.24:TACTAGAGCCCAGCCTTGAGATCC;
[0063] SEQ ID NO.25:GAAGGTGACCAAGTTCATGCTAAGCCATAGAGGATGGCGTCACT;
[0064] SEQ ID NO.26:GAAGGTCGGAGTCAACGGATTAAGCCATAGAGGATGGCGTCACC
[0065] SEQ ID NO.27:CGTATGTGTTCCCAGCTCCTGAC;
[0066] SEQ ID NO.28:GAAGGTGACCAAGTTCATGCTCTGATGCACATCTGTAGACACACT;
[0067] SEQ ID NO.29: GAAGGTCGGAGTCAACGGATTCTGATGCACATCTGTAGACACACC;
[0068] SEQ ID NO.30: CTTCCAAAGATGTTCCACCGACAT;
[0069] SEQ ID NO.31: GAAGGTGACCAAGTTCATGCTATCAATGGGGATTCACGATCACC;
[0070] SEQ ID NO.32: GAAGGTCGGAGTCAACGGATTGATCAATGGGGATTCACGATCACT;
[0071] SEQ ID NO.33:TTGGTGTTAATTTGCGGATCGTAAG;
[0072] SEQ ID NO.34: GAAGGTGACCAAGTTCATGCTGGGAAGTCCAGCAGTATTGACCAC;
[0073] SEQ ID NO.35: GAAGGTCGGAGTCAACGGATTGGGAAGTCCAGCAGTATTGACCAT;
[0074] SEQ ID NO. 36: AGTGTTCTCGGTTTCGTCCTCGAT.
[0075] This application also provides a fruiting body of *Amanita muscaria*, which is a fruiting body obtained by cultivating the *Amanita muscaria* strain Finc-LD-9.
[0076] Furthermore, the *Finc-LD-9* strain of *Amanita muscaria* was cultured using a cultivation substrate to obtain *Amanita muscaria* fruiting bodies. The cultivation substrate, by weight percentage, comprised: 20-35% poplar sawdust, 10-25% corn cob, 15-25% rice bran, 15-25% wheat bran, 3-5% corn flour, and 1-2% gypsum; the moisture content of the cultivation substrate was 60%-65%.
[0077] Furthermore, the dry cultivation material comprises, by weight percentage: 34% poplar sawdust, 20% corn cob, 20% rice bran, 20% wheat bran, 5% corn flour, and 1% gypsum.
[0078] This application also provides an application of lotus leaf-shaped pleated umbrella fruiting bodies in food processing.
[0079] Compared with existing technologies, the *Amanita muscaria* strain Finc-LD-9 provided in this application exhibits superior overall characteristics and has broad market prospects, possessing the following advantages:
[0080] The fruiting bodies cultivated by this strain have the advantages of high bioconversion rate and stable yield. Furthermore, this strain exhibits strong resistance to contaminating microorganisms and higher environmental adaptability during cultivation, while also possessing the significant advantage of being easily cultivated in industrial settings. In addition, the fruiting bodies cultivated by the *Finc-LD-9* strain are firm, crisp, tender, and have a delicious taste and rich flavor. Moreover, the *Finc-LD-9* fruiting bodies produced by this strain have excellent preservation properties, facilitating long-distance transportation and extending shelf life.
[0081] This application also provides a molecular marker combination and corresponding primer set for identifying the Finc-LD-9 strain of Amanita muscaria, which can rapidly and accurately identify the Finc-LD-9 strain with high specificity and good repeatability. Attached Figure Description
[0082] Figure 1 This is a diagram of the mycelial morphology of the lotus leaf agaric strain Finc-LD-9 after its culture, as provided in the embodiments of this application.
[0083] Figure 2 This is a morphological diagram of the fruiting bodies obtained by culturing the *Finc-LD-9* strain of *Amanita muscaria* provided in the embodiments of this application. Detailed Implementation
[0084] The following detailed description, in conjunction with the accompanying drawings and specific embodiments, further illustrates the proposed *Amanita fulva* strain and the molecular marker set used for identifying *Amanita fulva* strains. The advantages and features of this application will become clearer from the following description. It should be noted that the drawings are all in a very simplified form and use non-precise proportions, used only to facilitate and clarify the illustration of the embodiments of this application. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.
[0085] This application provides a strain of Hericium erinaceus, Finc-LD-9, which belongs to Hericium erinaceus and is deposited at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 42092 and deposit date of August 29, 2025.
[0086] The novel strain Finc-LD-9 of *Pleurotus ostreatus* in this application was obtained through rigorous single-spore hybridization technology. Using *Pleurotus ostreatus* strains KX-HA090 and 5-99 as parent strains, single spores were isolated from each strain. After pairing hybridization, screening and purification, and multiple generations of subculturing, a new strain with stable genetic characteristics and excellent comprehensive performance was successfully selected and named Finc-LD-9.
[0087] The characteristics of the newly bred *Pleurotus ostreatus* strain Finc-LD-9 are as follows:
[0088] Strain morphological characteristics: The mycelial morphology of the new strain Finc-LD-9 of *Pleurotus ostreatus* cultured on PDA medium is as follows: Figure 1 As shown, the Finc-LD-9 strain has dense, white, fluffy colonies with neat edges, well-developed aerial hyphae, strong climbing ability, and vigorous mycelial growth. The mycelium grows well within a temperature range of 20-26℃. At 25℃, the mycelial growth rate is faster, and it can cover a 9cm diameter petri dish in 14-16 days.
[0089] Fruiting body cultivation conditions: Through the applicant's research, the new strain Finc-LD-9 exhibits excellent temperature adaptability, with fruiting bodies growing well within a temperature range of 14-19℃. The optimal temperature for primordia formation is 16-19℃, and for fruiting body growth, it is 14-16℃. Strain Finc-LD-9 also has a wide humidity tolerance range; a cultivation medium moisture content of 60%-65% and a relative humidity of 85%-95% promote normal growth and development of the fruiting bodies. Regarding pH, strain Finc-LD-9 thrives in an environment with a pH of 6.5-7.5, with optimal growth at a pH of 6.8-7.2. Compared to other common *Amanita muscaria* strains, strain Finc-LD-9 demonstrates outstanding resistance to contaminants. During cultivation, it effectively inhibits the growth of common contaminants such as *Penicillium* and *Trichoderma*, significantly reducing the contamination rate and increasing the cultivation success rate.
[0090] Fruiting body morphology characteristics: The fruiting body morphology of the new strain Finc-LD-9 of *Amanita muscaria* is as follows: Figure 2 As shown, the fruiting bodies grow in clusters, with a compact and neat shape. The cap is 2-4 cm in diameter, hemispherical to flat, and light brown to dark brown in color. The gills are straight, white to pale yellow, and the stipe is stout, 7-12 cm long and 0.8-1.5 cm in diameter. It has a crisp and tender texture and excellent overall characteristics.
[0091] Fruiting body yield: Multiple comparative trials in industrialized cultivation showed that, under the same cultivation conditions, the fruiting body yield of different batches of the new *Fragaria lobata* strain Finc-LD-9 was relatively stable and high. Taking a cultivation bottle with a filling weight of 610-630 g (dry weight 180 g) as an example, each bottle could produce 125-135 g of fresh *Fragaria lobata*, with a bioconversion rate as high as 69.4%-75%, significantly higher than that of existing conventional strains.
[0092] Fruiting body quality: The fruiting bodies of *Umbelliferae* produced by strain Finc-LD-9 are firm, crisp, and delicious. Furthermore, the fruiting bodies produced by this strain have excellent preservation properties, lasting 4-6 days at room temperature and 10-14 days under refrigeration (4℃), providing a longer shelf life and better meeting market demand.
[0093] Based on the above description, this application also protects a type of *Amanita muscaria* spore, which is the spore obtained after culturing the above-mentioned *Amanita muscaria* strain Finc-LD-9.
[0094] This application also protects a protoplast of *Amanita muscaria*, which is a protoplast obtained after culturing the above-mentioned *Amanita muscaria* strain Finc-LD-9.
[0095] This application also protects a type of *Amanita muscaria* mycelium, which is the mycelium obtained by culturing the above-mentioned *Amanita muscaria* strain Finc-LD-9.
[0096] This application also protects a fruiting body of *Amanita muscaria*, specifically the fruiting body obtained by cultivating the aforementioned *Amanita muscaria* strain Finc-LD-9.
[0097] The cultivation method for the fruiting bodies involves culturing the *Finc-LD-9* strain of *Amanita fulva* in a cultivation medium to obtain *Amanita fulva* fruiting bodies. The cultivation medium, by weight percentage, comprises: 20-35% poplar sawdust, 10-25% corn cob, 15-25% rice bran, 15-25% wheat bran, 3-5% corn flour, and 1-2% gypsum; the moisture content of the cultivation medium is 60%-65%. Preferably, the cultivation medium, by weight percentage, comprises: 34% poplar sawdust, 20% corn cob, 20% rice bran, 20% wheat bran, 5% corn flour, and 1% gypsum.
[0098] This application also protects the use of a lotus leaf-shaped pleated umbrella fruiting body in food processing.
[0099] The applicant performed deep sequencing and SNP site screening on the genomic DNA of the Finc-LD-9 strain, its parental strains KX-HA090 and 5-99, and control strains (LD2019, FLD-J-1, FLD-J-2, FLD-J-3), ultimately identifying 12 specific SNP marker sites, which constitute the "molecular identity card" of the Finc-LD-9 strain. The names, physical locations in the genome, target sequences (base polymorphism sites), and allele information of these 12 SNP marker sites are shown in Table 1 below:
[0100] Table 1. SNP molecular marker sites of Finc-LD-9 strain
[0101]
[0102] Based on the above 12 SNP marker sites, this application uses KASP (competitive allele-specific PCR) technology to design a specific primer set for amplifying the above molecular markers.
[0103] Each primer set includes two allele-specific forward primers and one universal reverse primer. The forward primers each carry a different fluorescent adaptor sequence, while the reverse primer is a site-specific universal sequence.
[0104] The correspondence between SNP molecular markers and primer sets is shown in Table 2 below.
[0105] Table 2. Correspondence between SNP molecular markers and primers
[0106]
[0107] The method for identifying *Amanita muscaria* strains using the above primer combinations and molecular markers is roughly as follows:
[0108] DNA extraction: Fresh mycelium obtained from the strain culture was used to extract genomic DNA using the CTAB method. The purity and concentration were then determined using a nucleic acid detector, and the DNA concentration was adjusted to a uniform concentration of 50 ng / μL.
[0109] Primer preparation: KASP primer sets corresponding to 12 SNP sites were synthesized according to Table 2 above and aliquoted into 96-well plates.
[0110] PCR amplification: Perform PCR amplification according to the above reaction system and procedure, with 3 replicates for each sample, and double-distilled water as a negative control.
[0111] Genotyping: After amplification, data analysis was performed using QuantStudio Design & Analysis Software v1.5.3 to generate genotyping maps.
[0112] Strain identification: The sample to be identified and the control strain sample are tested in the same batch. After the above experiments, the results are corrected according to the general rules of SNP marker technology in variety determination, and reasonable errors are eliminated. The same strain is determined by whether the genotypes of each strain are the same at 12 SNP loci.
[0113] Identification of the strain of this invention: The strain Finc-LD-9 of this invention, along with parental strains KXHA090, 5-99, and other control strains, were tested in the same batch. After the above experiments, the results were corrected according to the general rules for SNP marker technology in variety identification, excluding reasonable errors. The genotype of strain Finc-LD-9 at the 12 SNP loci was completely consistent with the results in Table 1, and all strains showed independent populations in the genotyping diagram. The detection results of other strains were different from those of strain Finc-LD-9. Therefore, strain Finc-LD-9 can be identified as a strain distinct from all other strains. This indicates that the molecular marker and identification method of this application can rapidly and accurately identify strain Finc-LD-9, with high specificity and good repeatability.
[0114] To further highlight the advantages of the *Amanita muscaria* strain provided in this application, the following experiments provide a more detailed comparative explanation of the strain and its applications.
[0115] Example 1: Factory cultivation experiment of a new strain of lotus leaf aphid, Finc-LD-9
[0116] This application employs a factory-scale, year-round bottle cultivation model, using 850mL dedicated cultivation bottles to conduct factory-scale cultivation experiments on the new strain Finc-LD-9. Those skilled in the art will understand that cultivation bottles of different sizes can also be used for fruiting body culture of the strain; for example, 500mL or 1000mL cultivation bottles can be used, only requiring adjustment of the filling amount and perforation depth. Alternatively, plastic cultivation bags can be used instead of cultivation bottles for fruiting body culture of the strain; for example, 17cm × 35cm polypropylene bags can be used, each bag containing 500g of dry material.
[0117] The specific cultivation process is as follows:
[0118] (1) Cultivation preparation work:
[0119] Factory-style plant construction: A closed plant with excellent airtightness, insulation, and moisture resistance is constructed. The plant is divided into functional areas such as an inoculation area, cultivation area, fruiting area, and contamination area. The inoculation area maintains good dust protection, with smooth, corner-free interior walls and roof for easy cleaning. It is regularly disinfected and sterilized using purification devices such as ultraviolet lamps, ozone generators, high-efficiency air filtration systems, air showers, and laminar flow hoods, achieving an air cleanliness level of 10,000. The inoculation area reaches 100 level. The cultivation area maintains constant temperature and humidity, is light-protected, has good air exchange capabilities, and is equipped with insect and rodent control measures. The fruiting area is equipped with complete temperature control, humidification, ventilation, and lighting facilities, and the walls are moisture-proof and easy to clean. The contamination area must be located away from the sterile area and equipped with dust suppression spray facilities. Waste disposal complies with environmental protection requirements.
[0120] Cultivation bottle selection: 850 mL polypropylene plastic bottles with a diameter of 6 cm are selected as cultivation containers. These cultivation bottles have good stability and air permeability, providing suitable space for the growth of lotus leaf apocynum, and are convenient for mechanized bottling, inoculation, and fruiting operations.
[0121] Production equipment includes: professional mixing machines, automatic bottling machines, autoclaves, ultraviolet sterilization equipment, ozone generators, air filtration and purification equipment, temperature control equipment (such as air coolers and heaters), humidifying spray equipment, lighting fixtures, and ventilation equipment. The autoclave must meet national mandatory requirements to ensure sterilization effectiveness. The automatic bottling machine can precisely control the filling weight and filling depth.
[0122] (2) Cultivation substrate formula:
[0123] Raw material selection: Agricultural and forestry waste such as poplar sawdust, corn cobs, rice bran, wheat bran, and corn flour are used as cultivation materials, along with auxiliary materials such as gypsum. All raw materials must be fresh, free from insects, mold, and pesticide contamination.
[0124] Cultivation substrate formula: After extensive testing and optimization by the applicant, the following formulation ratio was found to achieve optimal yield and quality of *Hylocereus undatus*. The cultivation substrate ratio, by weight percentage, includes: 20-35% poplar sawdust, 10-25% corn cob, 15-25% rice bran, 15-25% wheat bran, 3-5% corn flour, and 1-2% gypsum. Poplar sawdust can be replaced with birch sawdust or mixed wood sawdust; corn cob can be replaced with sugarcane bagasse or cotton stalk powder; and rice bran can be replaced with wheat bran, rice bran residue, etc., achieving similarly good cultivation results.
[0125] (3) Cultivation experiment
[0126] Mixing: According to the cultivation substrate formula provided above, put all the raw materials into the mixing machine and mix thoroughly. During the mixing process, slowly add an appropriate amount of water while mixing, until the moisture content of the substrate reaches 60%-65% and the pH value is adjusted to 6.8-7.2. During the mixing process, a moisture meter and pH meter can be used to accurately detect the moisture content and pH value to ensure that they meet the requirements.
[0127] Bottling: Use an automatic bottling machine to fill the prepared culture medium into 850mL culture bottles. During bottling, ensure the medium is evenly distributed and appropriately packed, maintaining a medium surface depth of 1.1-1.3 cm and a weight of 610-630g per bottle. After bottling, use the provided perforation device to vertically punch holes in the center of the culture medium, approximately 1-1.5 cm in diameter and reaching the bottom of the bottle, to increase the aeration of the medium and meet the oxygen requirements for mycelial growth. Immediately after punching, cap the bottle with a dedicated cultivation bottle cap. This cap has ventilation holes and an internal cavity. The ventilation holes are located on both the outer and inner perimeters of the cap and are connected to the cavity. The cavity buffers, filters, and settles the air entering the bottle, preventing the entry of contaminants and allowing for a more gradual gas exchange, thus maintaining a stable microenvironment inside the bottle.
[0128] Sterilization: Arrange the culture bottles containing the culture medium and with the caps on neatly in an autoclave for sterilization. Sterilization conditions are: temperature 121℃, sterilization pressure 0.12-0.13 MPa, and sterilization time 90-120 minutes. During sterilization, strictly control the temperature and pressure to ensure thorough sterilization and kill all microorganisms and their vegetative forms in the culture medium. After sterilization, allow the pressure to naturally decrease to atmospheric pressure, and remove the culture bottles after they have cooled completely.
[0129] Inoculation: Transfer the sterilized culture bottles cooled to 18-22℃ to a sterile inoculation room. Under sterile conditions, open the bottle caps and use an automatic inoculation machine to inoculate the surface of the culture medium containing the new strain Finc-LD-9 of *Amanita muscaria*. The inoculation amount per bottle should be controlled at 5-8 g. After inoculation, quickly close the bottle caps to reduce contamination.
[0130] Mycelial Culture: After inoculation, the culture bottles are transferred to the culture area for mycelial culture. The temperature in the culture area is controlled at 20-23℃, and the relative humidity is maintained at 60%-70%. Multi-layer shelves can be installed in the culture room to neatly place the culture bottles for three-dimensional cultivation, making full use of space. During the cultivation process, the environment should be kept dark, and regular ventilation should be provided to ensure fresh air, while controlling the carbon dioxide concentration to not exceed 500 ppm. Generally, after 40-45 days, the mycelium will have completely covered the entire culture bottle. During this period, the culture bottles should be checked regularly, and contaminated bottles should be removed promptly to prevent the spread of contaminating microorganisms.
[0131] Primordia induction: Once the mycelium has fully colonized the bottle and reached physiological maturity, transfer the cultivation bottles to the fruiting area for primordia induction management. Maintain the temperature in the fruiting area at 16-18℃, keep the air humidity at a high humidity of 98%-100%, and ensure the carbon dioxide concentration does not exceed 3000 ppm. Provide appropriate diffused light stimulation (50-100 lx) and ventilate 2-3 times daily to induce primordia formation. Generally, after 6-8 days, dense white, needle-like mushroom primordia will appear on the surface of the substrate at the bottle opening, indicating successful primordia induction. During this period, strictly avoid direct sunlight and drastic fluctuations in temperature and humidity to prevent the young primordia from withering or developing abnormally.
[0132] Fruiting Management: After primordia formation, adjust the temperature to 15-16℃ and the relative humidity to 90%-95%, providing 1.5-2 hours of light daily (light intensity 500-800 lx) to promote bud growth. As the fruiting bodies grow, gradually increase ventilation to ensure fresh air, but avoid strong winds blowing directly on the mushrooms, maintaining a carbon dioxide concentration not exceeding 3500 ppm. Regularly check the growth of the fruiting bodies and adjust environmental parameters accordingly. Harvesting can begin when the fruiting body caps are flat, the stipes are thick, and the length reaches 7-12 cm. The entire fruiting cycle of the new *Amanita muscaria* strain Finc-LD-9 provided in this application is generally 25-30 days.
[0133] Harvesting and Subsequent Management: When the fruiting bodies of *Gymnocarpus natans* reach the harvesting standard, gently twist and pull them out by hand, keeping the fruiting bodies as intact as possible and avoiding damage to the mycelium on the surface of the culture medium. After harvesting, *Gymnocarpus natans* should be graded and cleaned in a timely manner, removing impurities and defective parts. Packaging should be done according to market demand, and products can be sold fresh or processed into dried products, canned goods, ready-to-eat products, etc.
[0134] Example 2: Spring Factory Bottle Planting Experiment
[0135] Following the industrialized cultivation method provided in Example 1, a new strain of lotus leaf apocynum, Finc-LD-9, was experimentally cultivated in spring. This strain served as the experimental group, and five batches were tested. Simultaneously, parental strains KX-HA090 and 5-99 were used as control groups, and industrialized cultivation experiments were conducted under the same conditions. These strains also served as control groups, and five batches were tested in the same manner.
[0136] The dry substrate formula is as follows: 34% poplar sawdust, 20% corn cob, 20% rice bran, 20% wheat bran, 5% corn flour, and 1% gypsum. The moisture content of the substrate is controlled at around 64%, and the pH value of the prepared substrate is around 7.0.
[0137] Bottling and punching: Use an automatic bottling machine to fill each bottle with about 620 g of material, with a material depth of about 1.2 cm. After filling, punch a hole in the center of the culture medium with a diameter of 1.2 cm and a depth to the bottom of the bottle. After punching, put on a special bottle cap with ventilation holes.
[0138] Sterilization: Autoclave at 121℃, sterilization pressure 0.125MPa, sterilization time 105 minutes. Allow to cool naturally to 20℃ after sterilization.
[0139] Inoculation: In a sterile inoculation room, use an automatic inoculation machine to inoculate 6g of bacterial culture per bottle, and quickly tighten the bottle cap after inoculation.
[0140] Mycelial culture conditions: Culture temperature 21-22℃, relative humidity 65%, in the dark, with regular ventilation to maintain CO2 concentration below 500 ppm. The mycelium will fully colonize the bottle in approximately 42 days. After colonization, continue culture for another 7-10 days to allow it to reach physiological maturity.
[0141] Bud induction: Transfer the cultivation bottles to the fruiting room, maintaining an ambient temperature of 17-18℃, humidity at around 99%, and CO2 concentration below 2500 ppm. Provide 80 lx diffused light stimulation and ventilate twice daily to induce primordia formation. Strictly avoid direct sunlight and drastic fluctuations in temperature and humidity during this period to prevent bud withering or abnormal development. After approximately 7 days, dense white, needle-like mushroom buds will appear on the surface of the substrate at the bottle opening, indicating successful bud induction.
[0142] Fruiting Management: After primordia formation, adjust the temperature to 15-16℃ and the relative humidity to 92%. Provide 1.5-2 hours of light daily (650 lx light intensity) to promote bud growth and development. As the fruiting bodies grow, avoid direct strong winds on the mushrooms and control the CO2 concentration to below 3000 ppm. Regularly check the growth of the fruiting bodies and adjust the temperature, humidity, light, and ventilation parameters promptly based on the shape and size of the mushrooms. The entire fruiting cycle is approximately 28 days.
[0143] Harvesting: Harvest when the cap of the fruiting body of the lotus leaf is flat and the stipe is 8-10cm in length, and count the fruiting body yield per bottle.
[0144] The fruiting data of the three strains are shown in Table 3 below.
[0145] Table 3 Comparison of fruiting data of Finc-LD-9 with parental strains KX-HA090 and 5-99
[0146]
[0147] Table 3 shows that in the five batches of fruiting trials, the average yield of the new Finc-LD-9 strain was more stable and higher than that of its parent strains KX-HA090 and 5-99. Under suitable conditions, the average yield of each batch of the new Finc-LD-9 strain was 125-135 g, with a bioconversion rate of 69.4%-75.0%. Furthermore, the differences in fruiting bodies between batches and within each batch were small, indicating strong consistency. In terms of contamination resistance, the new Finc-LD-9 strain was also significantly superior to its parent strains KX-HA090 and 5-99, indicating stronger resistance to contaminating microorganisms and higher economic benefits. Regarding shelf life, the fruiting bodies produced by the new Finc-LD-9 strain had an average shelf life that was about 2 days longer than those of its parent strains KX-HA090 and 5-99, demonstrating stronger preservation capabilities.
[0148] Example 3: Autumn Factory Bottle Planting Experiment
[0149] Following the industrialized cultivation method provided in Example 1, a new strain of lotus leaf apocynum, Finc-LD-9, was subjected to industrialized cultivation trials in autumn. This strain served as the experimental group, and five batches of trials were conducted. Similarly, parental strains KX-HA090 and 5-99 were used as control groups, and industrialized cultivation trials were conducted under the same conditions. These strains also served as control groups, and five batches of trials were conducted.
[0150] In the autumn factory-scale bottle cultivation experiment, the dry substrate formula was: 34% poplar sawdust, 20% corn cob, 20% rice bran, 20% wheat bran, 5% corn flour, and 1% gypsum. For autumn cultivation, the moisture content of the substrate was adjusted to 65%, and the pH value was approximately 7.2.
[0151] Bottling and punching: Use an automatic bottling machine to fill each bottle with about 620 g of material, with a material depth of about 1.2 cm. After filling, punch a hole in the center of the culture medium with a diameter of 1.2 cm and a depth to the bottom of the bottle. After punching, put on a special bottle cap with ventilation holes.
[0152] Sterilization: Autoclave at 121℃, sterilization pressure 0.125MPa, sterilization time 105 minutes. Allow to cool naturally to 20℃ after sterilization.
[0153] Inoculation: In a sterile inoculation room, use an automatic inoculation machine to inoculate 6g of bacterial culture per bottle, and quickly tighten the bottle cap after inoculation.
[0154] Mycelial culture conditions: Mycelial culture temperature 22-23℃, relative humidity 65%, in the dark, with regular ventilation to maintain CO2 concentration below 500 ppm. The mycelium will fully colonize the bottle in approximately 42 days. After colonization, continue culture for another 7-10 days to allow it to reach physiological maturity.
[0155] Bud induction: Transfer the cultivation bottles to the fruiting room, maintaining an ambient temperature of 18-19℃, humidity around 98%, and CO2 concentration below 2800 ppm. Provide 60 lx diffused light stimulation and ventilate three times daily to induce primordia formation. Strictly avoid direct sunlight and drastic fluctuations in temperature and humidity during this period to prevent bud withering or abnormal development. After approximately 6 days, dense white, needle-like mushroom buds will appear on the surface of the substrate at the bottle opening, indicating successful bud induction.
[0156] Fruiting Management: After primordia formation, adjust the temperature to 14-15℃, the relative humidity to 90%, and provide 1.5 hours of light daily (550 lx light intensity) to promote bud growth and development. As the fruiting bodies grow, avoid direct strong winds on the mushrooms and control the CO2 concentration to below 3200 ppm. Regularly check the growth of the fruiting bodies and adjust the temperature, humidity, light, and ventilation parameters promptly based on the shape and size of the mushrooms. The entire fruiting cycle is approximately 28 days.
[0157] Harvesting: Harvest when the cap of the fruiting body of the lotus leaf is flat and the stipe is 8-10cm in length, and count the fruiting body yield per bottle.
[0158] The fruiting data of the three strains are shown in Table 4 below.
[0159] Table 4 Comparison of autumn fruiting data of Finc-LD-9 with parental strains KX-HA090 and 5-99
[0160]
[0161] In the autumn industrialized cultivation experiment shown in Table 4, compared with Table 1, the fruiting yield of the new Finc-LD-9 strain in the five batches in autumn was basically similar to that in spring, indicating that the new Finc-LD-9 strain has good stability, is less affected by external environmental factors, and is suitable for large-scale industrialized cultivation. Specifically, in the autumn industrialized cultivation, the average yield of each batch of the new Finc-LD-9 strain was around 128g, which is more stable and higher than that of the parent strains KX-HA090 and 5-99. The fruiting body differences between batches and within each batch of the new Finc-LD-9 strain were small, showing strong consistency. In terms of pollution resistance, the new Finc-LD-9 strain also performed well, with stronger resistance to contaminating microorganisms and higher economic benefits. In terms of shelf life, the fruiting bodies produced by the new Finc-LD-9 strain can be kept fresh at 4℃ for up to 13 days, demonstrating strong preservation ability.
[0162] Example 4 Molecular identification test of *Finc-LD-9* strain from *Amanita muscaria*.
[0163] Experimental subjects: *Anacarya paliurus* strain Finc-LD-9, parental strains KX-HA090 and 5-99, control strains LD2019 and LD2020, and three common *Anacarya paliurus* strains collected from the market.
[0164] Reagents and instruments: CTAB extraction kit, KASP PCR Mix, quantitative PCR instrument (QuantStudio 5), centrifuge, nucleic acid detector.
[0165] Identification methods:
[0166] DNA extraction: Take 0.1 g of fresh mycelium from each strain and extract genomic DNA using the CTAB method. Measure the purity and concentration using a nucleic acid detector and adjust to a uniform concentration of 50 ng / μL.
[0167] Primer preparation: KASP primer sets for the 12 SNP sites in Table 2 were synthesized and aliquoted into 96-well plates.
[0168] PCR amplification: Perform PCR amplification according to the above reaction system and procedure, with 3 replicates for each sample, and double-distilled water as a negative control.
[0169] Genotyping: After amplification, data analysis was performed using QuantStudio Design & Analysis Software v1.5.3 to generate genotyping maps.
[0170] The test results are as follows:
[0171] The genotypes of the Finc-LD-9 strain at 12 SNP sites were completely consistent with the target sequence results in Table 1, and all of them were independent populations in the typing diagram.
[0172] The parental strains KX-HA090 and 5-99, as well as the control strain, showed genotypic differences at multiple sites, clearly distinguishing them from the Finc-LD-9 strain.
[0173] None of the three strains collected from the market exhibited a genotype profile completely identical to Finc-LD-9. This indicates that the molecular markers and identification methods provided in this application are reliable, enabling rapid and accurate identification of Finc-LD-9 strains with high specificity and good reproducibility.
[0174] In summary, the *Amanita muscaria* strain Finc-LD-9 provided in this application exhibits excellent overall characteristics and has broad market prospects, possessing the following advantages:
[0175] The fruiting bodies cultivated by this strain have the advantages of high yield per unit area, high bioconversion rate, and stable yield. Furthermore, this strain exhibits strong resistance to contaminating microorganisms and higher environmental adaptability during cultivation, and also possesses the significant advantage of being easily cultivated in industrial settings. In addition, the fruiting bodies cultivated by the *Finc-LD-9* strain are firm, crisp, tender, and have a delicious taste and rich flavor. Moreover, the *Finc-LD-9* fruiting bodies produced by this strain have excellent preservation properties, which is beneficial for long-distance transportation and extends shelf life.
[0176] This application also provides a molecular marker combination and corresponding primer set for identifying the Finc-LD-9 strain of Amanita muscaria, which can rapidly and accurately identify the Finc-LD-9 strain with high specificity and good repeatability.
[0177] The above description is merely a description of preferred embodiments of this application and is not intended to limit the scope of this application in any way. Any changes or modifications made by those skilled in the art based on the above disclosure shall fall within the protection scope of the claims.
Claims
1. A strain of Lyophyllum decastes, Finc-LD-9, characterized in that, The specimen, named Finc-LD-9, belongs to the genus *Pleurotus ostreatus* and is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Its accession number is CGMCC No. 42092, and the deposit date is August 29, 2025.
2. A type of lotus leaf-derived cypriniforme, characterized in that, The spores obtained after culturing the *Finc-LD-9* strain of *Amanita muscaria* as described in claim 1.
3. A lotus leaf-shaped protoplast, characterized in that, The protoplasts obtained after culturing the *Finc-LD-9* strain of *Amanita muscaria* as described in claim 1.
4. A type of lotus leaf agaric mycelium, characterized in that, The mycelium obtained for culturing the *Finc-LD-9* strain of *Amanita muscaria* as described in claim 1.
5. A molecular marker combination for identifying the *Finc-LD-9* strain of *Amanita muscaria* as described in claim 1, characterized in that, The molecular marker combination includes the following 12 SNP molecular markers: LyD900009_K01 has a physical location of 8-2434906 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site G / A. LyD900014_K01 has a physical location of 1-4908913 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site C / T. LyD900015_K01 has a physical location of 3-1162601 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site G / A. LyD900065_K01 has a physical location of 1-1210105 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site T / C. LyD900067_K01 has a physical location of 2-4840823 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site A / G. LyD900069_K01 has a physical location of 3-4246939 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site C / T. LyD900070_K01 has a physical location of 4-3446482 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site A / G. LyD900071_K01 has a physical location of 6-1182559 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site C / T. LyD900073_K01 has a physical location of 7-124574 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site T / C. LyD900074_K01 has a physical location of 7-1246500 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site A / G. LyD900075_K01 has a physical location of 9-2080525 in the genome of *Amanita muscaria* strain, and contains a base polymorphism site G / A. LyD900078_K01 has a physical location of 10-1704289 in the genome of *Amanita muscaria*, and contains the base polymorphism site G / A.
6. A specific primer set for amplifying the molecular marker combination as described in claim 5, characterized in that, It includes 12 primer sets, each primer set is used to amplify a corresponding SNP molecular marker, and each primer set includes 2 forward primers and 1 reverse primer; The correspondence between SNP molecular markers and primer sets is as follows: LyD900009_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.1, the forward primer 2 sequence is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.3; LyD900014_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.4, the forward primer 2 sequence is shown in SEQ ID NO.5, and the reverse primer sequence is shown in SEQ ID NO.6; LyD900015_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.7, the forward primer 2 sequence is shown in SEQ ID NO.8, and the reverse primer sequence is shown in SEQ ID NO.9; LyD900065_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.10, the forward primer 2 sequence is shown in SEQ ID NO.11, and the reverse primer sequence is shown in SEQ ID NO.12; LyD900067_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.13, the forward primer 2 sequence is shown in SEQ ID NO.14, and the reverse primer sequence is shown in SEQ ID NO.15; LyD900069_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.16, the forward primer 2 sequence is shown in SEQ ID NO.17, and the reverse primer sequence is shown in SEQ ID NO.18; LyD900070_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.19, the forward primer 2 sequence is shown in SEQ ID NO.20, and the reverse primer sequence is shown in SEQ ID NO.21; LyD900071_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.22, the forward primer 2 sequence is shown in SEQ ID NO.23, and the reverse primer sequence is shown in SEQ ID NO.24; LyD900073_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.25, the forward primer 2 sequence is shown in SEQ ID NO.26, and the reverse primer sequence is shown in SEQ ID NO.27; LyD900074_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.28, the forward primer 2 sequence is shown in SEQ ID NO.29, and the reverse primer sequence is shown in SEQ ID NO.30; LyD900075_K01, the corresponding forward primer 1 sequence is shown in SEQ ID NO.31, the forward primer 2 sequence is shown in SEQ ID NO.32, and the reverse primer sequence is shown in SEQ ID NO.33; LyD900078_K01 corresponds to the forward primer 1 sequence as shown in SEQ ID NO.34, the forward primer 2 sequence as shown in SEQ ID NO.35, and the reverse primer sequence as shown in SEQ ID NO.
36.
7. A lotus leaf-shaped pleated umbrella-shaped fruiting body, characterized in that, The fruiting body obtained by cultivating the lotus leaf agaric strain Finc-LD-9 as described in claim 1.
8. A method for cultivating lotus leaf-shaped umbelliferous fruiting bodies as described in claim 7, characterized in that, The *Amanita muscaria* strain Finc-LD-9 was cultured using a cultivation substrate to obtain *Amanita muscaria* fruiting bodies. The cultivation substrate, by weight percentage, comprised: 20-35% poplar sawdust, 10-25% corn cob, 15-25% rice bran, 15-25% wheat bran, 3-5% corn flour, and 1-2% gypsum; the moisture content of the cultivation substrate was 60%-65%.
9. The cultivation method for lotus leaf-shaped umbelliferous fruiting bodies according to claim 8, characterized in that, The dry ingredients of the cultivation substrate, by weight percentage, include: 34% poplar sawdust, 20% corn cob, 20% rice bran, 20% wheat bran, 5% corn flour, and 1% gypsum.
10. The application of the lotus leaf-shaped pleated fruiting body as described in claim 7 in food processing.