Pichia pastoris engineering bacteria with high yield of 11α-hydroxycanrenone and application thereof

Abstract

The application discloses a Pichia pastoris engineering bacterium with high 11alpha-hydroxyl canrenone yield and application thereof, and belongs to the field of genetic engineering and biological catalysis. The Pichia pastoris GS115 is used as a host, on the basis of heterogenous expression of steroid 11alpha-hydroxylase CYP68J5, superoxide dismutase SOD and / or catalase Cat are overexpressed, and thus the recombinant engineering bacterium GS115-CYP68J5-SOD, GS115-CYP68J5-Cat and GS115-CYP68J5-SOD-Cat are constructed. The intracellular peroxidation level is reduced by the antioxidant enzyme, and the excessive oxidative degradation of the product 11alpha-hydroxyl canrenone is inhibited. The product yield of the engineering bacterium co-expressing SOD and Cat reaches 82%, which is 5.1 times higher than that of a control group. The engineering bacterium constructed by the application has high conversion efficiency, excellent product yield, simple process and easy industrialization, and can be widely applied to the high-efficiency biosynthesis of 11alpha-hydroxyl canrenone.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and biocatalysis, specifically relating to a Pichia pastoris engineered strain that produces high levels of 11α-hydroxycanrenone, its construction method, and its application in the catalytic conversion of canrenone to 11α-hydroxycanrenone. Background Technology

[0002] 11α-hydroxycanrenone is a key intermediate in the synthesis of eplerenone, a novel selective aldosterone receptor antagonist. Eplerenone has shown significant efficacy in the clinical treatment of hypertension, heart failure, and myocardial infarction, and has broad market application prospects.

[0003] Currently, the main industrial method for preparing 11α-hydroxycanrenone is to use the filamentous fungus Aspergillus ochraceus to convert canrenone. However, this process has problems such as complex fermentation procedures, long conversion cycles, and low product yields, which make it difficult to meet the needs of efficient industrial production.

[0004] To address the aforementioned issues, existing technologies attempt to utilize substances derived from *Aflatoxin* (…). Aspergillus ochraceus The steroidal hydroxylase CYP68J5 was heterologously expressed in Pichia pastoris to construct recombinant strains for the biotransformation of canrenone. However, the strong intracellular oxidative environment of Pichia pastoris leads to excessive oxidative degradation of the transformation product 11α-hydroxycanrenone, resulting in extremely low product accumulation and a yield of only about 16%, which severely restricts the industrial application and promotion of this technology.

[0005] Therefore, developing a Pichia pastoris engineered strain that can inhibit the excessive oxidation of 11α-hydroxycanrenone and significantly improve the product yield is of great significance for achieving efficient biosynthesis of 11α-hydroxycanrenone and promoting the industrial production of eplerenone API. Summary of the Invention

[0006] The purpose of this invention is to overcome the defects of existing Pichia pastoris heterologous expression of CYP68J5 and conversion of canrone, which results in the easy over-oxidation of 11α-hydroxycanrone and extremely low yield. This invention provides a Pichia pastoris engineered strain that produces high yield of 11α-hydroxycanrone, and also provides its construction method and application, which greatly improves the product yield.

[0007] To achieve the above objectives, this invention reduces intracellular peroxidation levels and inhibits the excessive oxidative degradation of 11α-hydroxycanrenone by co-expressing superoxide dismutase (SOD) and / or catalase (Cat) in Pichia pastoris expressing steroidal 11α-hydroxylase CYP68J5, thereby obtaining a high-yield engineered strain.

[0008] The specific technical solution is as follows: In a first aspect, the present invention provides a Pichia pastoris engineered strain that produces high levels of 11α-hydroxycanrenone. The engineered strain uses Pichia pastoris as a host, heterologously expresses steroid 11α-hydroxylase CYP68J5, and overexpresses superoxide dismutase SOD and / or catalase Cat.

[0009] Furthermore, the Pichia pastoris host is Pichia pastoris GS115; the CYP68J5 gene is derived from Aspergillus ochraceus, and its nucleotide sequence is shown in SEQ ID NO:1.

[0010] Furthermore, the Cat gene is derived from Pichia pastoris, and its nucleotide sequence is shown in SEQ ID NO:2. The SOD gene is derived from Saccharomyces cerevisiae, and its nucleotide sequence is shown in SEQ ID NO:3.

[0011] Furthermore, the Pichia pastoris engineered strain simultaneously overexpresses superoxide dismutase (SOD) and catalase (Cat).

[0012] The engineered Pichia pastoris strain is Pichia pastoris GS115-CYP68J5-SOD-Cat.

[0013] The engineered Pichia pastoris strain is Pichia pastoris GS115-CYP68J5-SOD or Pichia pastoris GS115-CYP68J5-Cat.

[0014] The method for constructing the Pichia pastoris engineered strain involves introducing the gene encoding steroid 11α-hydroxylase CYP68J5, the gene encoding superoxide dismutase SOD, and / or the gene encoding catalase Cat into Pichia pastoris host cells, and then screening to obtain recombinant engineered strains.

[0015] Secondly, the present invention also provides the application of the above-mentioned engineered Pichia pastoris strain in the catalytic conversion of canrenone to 11α-hydroxycanrenone. The engineered Pichia pastoris strain reduces intracellular oxidation levels by overexpressing SOD and / or Cat, inhibiting excessive oxidation of 11α-hydroxycanrenone and improving product yield.

[0016] The beneficial effects of this invention are as follows: (1) This invention effectively reduces intracellular oxidative stress levels and significantly inhibits the excessive oxidative degradation of 11α-hydroxycanrenone by co-expressing the antioxidant enzymes SOD and / or Cat in Pichia pastoris, resulting in a substantial increase in product yield: The yield of engineered Pichia pastoris strain GS115-CYP68J5-SOD was increased to 43%. The yield of engineered Pichia pastoris strain GS115-CYP68J5-Cat was increased to 71%. The yield of engineered Pichia pastoris strain GS115-CYP68J5-SOD-Cat was significantly increased to 82%.

[0017] (2) The Pichia pastoris engineered strain GS115-CYP68J5-SOD-Cat constructed in this invention has a synergistic effect of SOD and Cat in improving the intracellular oxidation environment and inhibiting product degradation. It has high conversion efficiency and excellent product yield, and is suitable for large-scale industrial production of 11α-hydroxycanrenone. Attached Figure Description

[0018] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0019] Figure 1 This is a schematic diagram of the C11α-hydroxylation reaction of canrone; Figure 2 A schematic diagram of the pPIC3.5K-CYP68J5 expression vector; Figure 3 This is a schematic diagram of the pPICZ A-Cat expression vector; Figure 4 This is a schematic diagram of the pPICZ A-SOD expression vector; Figure 5 A schematic diagram of the pPICZ A-SOD-Cat expression vector; Figure 6 This is a schematic diagram of Pichia pastoris electroconversion of recombinant transformants; Figure 7 HPLC analysis of recombinant Pichia pastoris after 72 hours of conversion to canrone; Figure 8 A bar chart showing the conversion rate of recombinant Pichia pastoris canrone after 72 hours. Detailed Implementation

[0020] The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent companies. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0021] Example 1: Construction of Pichia pastoris chassis 1. Linearization of recombinant plasmid pPIC3.5K-CYP68J5 like Figure 1As shown, in order to solve the problem that the product 11α-hydroxycanrenone is easily over-oxidized and the yield is extremely low when Pichia pastoris heterologous expression of CYP68J5 is converted into canrenone, this embodiment constructs a Pichia pastoris engineered strain that produces high yield of 11α-hydroxycanrenone. First, the Pichia pastoris chassis strain is constructed.

[0022] The recombinant plasmid pPIC3.5K-CYP68J5 Sac I. Enzyme digestion forms a linearized fragment, and the recombinant plasmid pPIC3.5K-CYP68J5 expression vector is shown in the schematic diagram. Figure 2 As shown.

[0023] Table 1. 50 μl linearized enzyme digestion system

[0024] The enzyme digestion products were purified, following the instructions for the Zhuangmeng Biotechnology Small-Scale DNA Product Purification Kit.

[0025] 2. Electroporation of the linearized fragment of recombinant plasmid pPIC3.5K-CYP68J5 into Pichia pastoris. Take out 80 μl of GS115 Pichia pastoris competent cells stored at -70℃, place them on an ice box to thaw at room temperature, add 20 μl of purified linearized fragment to 80 μl of yeast competent cells and mix well, then transfer to a 2 mm disposable electroporation vessel using a pipette and incubate on ice for 10 min.

[0026] Insert the electroporation cuvette into the electroporator, set the temperature to 1500 V for 5 ms, remove the cuvette, and immediately add 1 mL of 1 mol / L sorbitol to the cuvette in a clean bench. Mix well by pipetting and aspiration, and incubate at 30°C for 1 h. Centrifuge at 14000 r / min for 20 s, resuspend approximately 150 μl of supernatant, and spread it onto a prepared MD plate to select HIS+ transformants. Incubate at 30°C for 2-3 days until transformants emerge.

[0027] 3. Screening and identification of high-copy recombinant Pichia pastoris transformants Prepare G418 YPD plates with concentrations of 0.5 mg / mL, 2 mg / mL, and 4 mg / mL in advance. Use a sterile toothpick to pick 48 transformants from the MD plate and spot them sequentially onto the digitally labeled YPD (0.5 mg / mL G418) plates. Incubate in a 30°C incubator in the dark for 2-3 days.

[0028] Pick 40-50 transformants from a YPD (0.5 mg / mL G418) plate and spot them onto a YPD (2 mg / mL G418) plate using a sterile toothpick. Then, transfer them sequentially to a YPD (4 mg / mL G418) plate. Incubate at 30°C in the dark for 2-3 days. The resulting transformants are high-copy transformants.

[0029] The recombinant Pichia pastoris genome was extracted and verified by PCR. Eight high-copy transformants selected from YPD (4 mg / mL G418) plates were transferred to liquid YPD for culture. The cells were collected and genomic DNA was extracted. The operation steps are as described in the instructions of Tiangen Biotech Yeast Genomic DNA Extraction Kit.

[0030] Take 1 μl of genomic DNA for PCR verification. The PCR system and procedure are shown in Tables 2 and 3. Verify by nucleic acid electrophoresis. The PCR product that is verified correctly is further sequenced. The recombinant strain that is sequenced correctly is the recombinant Pichia pastoris, which can be made into electrocompetent cells and stored at -70℃.

[0031] The primer sequences are as follows: AOH-F: GAAGGATCCTACGTAGAATTATGCCCTTCTTCACTGGGCT AOH-R: GCGGCCGCCCTAGGGAATTCTACACAGTTAAACTCGCCA Table 2 PCR reaction system

[0032] Table 3 PCR reaction conditions

[0033] Example 2: Construction of recombinant plasmids pPICZ A-Cat and pPICZ A-SOD 1. Preparation of the pPICZ A enzyme digestion backbone In plasmid pPICZ A Not I site linearization was performed, and the linearized enzyme digestion system is shown in Table 1. The sticky ends generated after enzyme digestion were filled in, and 5 μl of 2X ES Taq MasterMix (Dye) enzyme was added to every 50 μl of enzyme digestion product. The mixture was then placed in a metal bath at 72℃ for 10 min before purification.

[0034] 2. Obtain the SOD gene and Cat gene Polymerase chain reaction was performed using Saccharomyces cerevisiae genomic DNA as a template to obtain and purify the SOD gene and Cat gene.

[0035] The primer sequences are as follows: Cat-F: CCTCGAGCCGCGGCGGCCATGTCTCAACCACCTAAATG Cat-R: GGGCCCAAGCTGGCGGCCCTACAATCTTGCTGCAGAGT SOD-F: CCTCGAGCCGCGGCGGCCATGGTTCAAGCAGTCGCAGT SOD-R: GGGCCCAAGCTGGCGGCCTTAGTTGGTTAGACCAATGA The PCR reaction system and reaction conditions are shown in Tables 2 and 3.

[0036] 3. Obtain recombinant plasmids The above PCR products were respectively mixed with plasmid pPICZ A. Not After purification of the I-site restriction enzyme digestion product, homologous recombination was performed. The procedure was followed according to the instructions of the Hieff Clone® Plus One Step Cloning Kit. This yielded the recombinant plasmids pPICZ A-Cat and pPICZ A-SOD. Schematic diagrams of the expression vectors are shown below. Figure 3 Figure 4 As shown.

[0037] Example 3: Construction of recombinant plasmid pPICZ A-SOD-Cat 1. Construction of recombinant plasmid pBlue-TEF1-Box Using plasmid pPICZ A as a template, a polymerase chain reaction was performed with primers pTEF1-F / CYC1tt-R to obtain the expression cassette. After purification, it was inserted into the pBluescript II KS+ plasmid vector via homologous recombination. BamH I site yielded the recombinant plasmid pBlue-TEF1-Box.

[0038] Primer sequence information is as follows: pTEF1-F: CGCTCTAGAACTAGTGGATCAAGTTTCTACTCCTTTTTTAC CYC1tt-R:TCCTGCAGCCCGGGGGATCGCAAATTAAAGCCTTCGAGC The PCR reaction system and PCR reaction conditions are shown in Tables 4 and 5.

[0039] Table 4 PCR reaction system

[0040] Table 5 PCR reaction conditions

[0041] 2. Construction of recombinant plasmid pBlue-TEF1-Cat PCR was performed using plasmid pPICZ A-Cat as template (Cat to pTEF1-F / Cat to CYC1tt-R primers) and pBlue-TEF1-Box as template (TEF1-Box-F / TEF1-Box-R primers). Dpn Digest the remaining template in the two PCR products using enzyme I, and add 0.5 μl of [a specific enzyme] to every 50 μl volume of the PCR system. Dpn I enzyme, reacted at 37℃ for 30 min, and after purification, homologous recombination yielded the recombinant plasmid pBlue-TEF1-Cat.

[0042] The primer sequence information is shown below: Cat to pTEF1-F: GGGCGGTGTTGACAATTAAATGTCTCAACCACCTAAATG Cat to CYC1tt-R: TCGACAAAGGAAAAGGGGGACTACAATCTTGCTGCAGAGT TEF1-Box-F: TCCCCTTTCCTTTGTCGA TEF1-Box-R: TTAATTGTCAACACCGCCCC The PCR reaction system and PCR reaction conditions are shown in Tables 6 and 7.

[0043] Table 6 PCR Reaction System

[0044] Table 7 PCR reaction conditions

[0045] 3. Construction of recombinant plasmid pPICZ A-SOD-Cat Using plasmid pBlue-TEF1-Cat as a template and TEF1 to BamH IF / CYC1 to BamH IR as primers, a polymerase chain reaction was performed to obtain the pTEF1-Cat-CYC1tt expression cassette. Dpn After digestion and purification, it is inserted into pPICZ A-SOD. BamH The recombinant plasmid pPICZ A-SOD-Cat was obtained at site I, and its expression vector is shown in the schematic diagram below. Figure 5 As shown.

[0046] Primer sequence information is as follows: TEF1 to BamH IF: GACCTTCGTTGTGCGGATCAATGTTTCTACTCCTTTTTTAC CYC1 to BamH IR:CTATGGTGTGTGGGGGATCGCAAATTAAAGCCTTCGAGC The PCR reaction system and PCR reaction conditions are shown in Tables 8 and 9.

[0047] Table 8 PCR Reaction System

[0048] Table 9 PCR Reaction Conditions

[0049] Example 4: Construction of recombinant strains GS115-CYP68J5-Cat, GS115-CYP68J5-SOD, and GS115-CYP68J5-SOD-Cat 1. Electroporation of recombinant plasmids Electroporation of linearized DNA fragments into Pichia pastoris requires 5-20 μg of DNA, and the selection of restriction endonucleases is crucial. Sac The AOX1 promoter was digested with a single enzyme, and the linearized fragment of the recombinant plasmid was electroporated into competent cells of *Pichia pastoris* spp. The fragment was then plated on YPDS (100 μg / mL Zeocin) plates and incubated at 30°C. Transformants grew after 2-3 days. Figure 6 As shown.

[0050] 2. Validation of recombinant bacteria Twenty transformants were picked from YPDS plates using a sterile pipette tip and sequentially spotted onto labeled YPD plates containing 100 μg / mL Zeocin and 4.0 mg / mL G418. These plates were then incubated at 30°C in the dark for 2-3 days. The selected transformants were identified as high-copy transformants. Three of these high-copy transformants were picked from the double-antibiotic YPD (4 mg / mL G418; 100 μg / mL Zeocin) plates and transferred to liquid culture medium for genomic PCR verification, following the method described in Example 1.

[0051] Example 5: Fermentation and transformation of recombinant Pichia pastoris canrone in a fermenter 1. Seed culture medium The primary seed culture was prepared by picking single colonies of recombinant Pichia pastoris from YPD plates, inoculating them into 50 mL of liquid YPG medium, and culturing them in a constant temperature shaker at 28°C and 200 rpm for 24 h. The cell density OD was determined. 600 The initial OD value of the secondary seed culture should reach approximately 15. For secondary seed culture inoculation, take 2-3 mL of the primary seed culture and transfer it to two separate 100 mL bottles of YPG medium to achieve the desired initial OD value for the cells in the secondary seed culture. 600 The bacterial cell OD was 0.4, and the culture was carried out at 28℃ for 24 h. 600 It reaches around 12.

[0052] 2. Empty sterilization and actual sterilization in fermenters The empty sterilization of the fermenter involves sterilizing a 5 L empty fermenter and feed bottles at 121°C for 30 min. The actual sterilization of the fermenter involves calibrating the pH and DO electrodes and inserting them into the fermenter, while simultaneously loading 1.8 L of inorganic culture medium into the fermenter and sterilizing at 121°C for 20 min. The composition of the inorganic culture medium is shown in Table 10.

[0053] 3. Fermentation tank inoculation Two 100 mL bottles of secondary seed culture were inoculated into the fermenter at a 10% inoculum rate via flame inoculation. The fermenter temperature was set to 30°C, pH 6.0, DO 20%, a purge rate of 1.0 NI / min, and an initial stirring speed of 250 rpm. The initial OD of the fermentation broth cells was monitored simultaneously. 600 .

[0054] 4. Cultivation and induction of microbial strains Set a negative correlation between dissolved oxygen and rotation speed. After the rotation speed reaches 800 rpm and the carbon source in the tank is consumed, set a negative correlation between dissolved oxygen and feed addition to feed 50% glycerol. Wait until the bacterial OD... 600 Stop feeding when the concentration reaches 150, add methanol to induce induction, and add methanol to dissolve canrone after induction is complete.

[0055] 5. Sampling Analysis Samples were taken every 4 hours and extracted with ethyl acetate. Samples after 48 hours of transformation were selected for high-performance liquid chromatography (HPLC) analysis. The analytical results are as follows: Figure 7 The transformation is as follows Figure 8 As shown, the experimental results indicate that the introduction of an antioxidant enzyme system significantly inhibited the peroxidative degradation of 11α-hydroxycanrenone. Control group (containing only CYP68J5): product yield was only 16%; GS115-CYP68J5-SOD: Product yield increased to 43%; GS115-CYP68J5-Cat: Product yield increased to 71%; GS115-CYP68J5-SOD-Cat (co-expression): Product yield was significantly increased to 82%.

[0056] The results showed that SOD and Cat had a significant synergistic effect in reducing the intracellular oxidative environment, which increased the product yield by 5.1 times compared with the control group.

[0057] Table 10 Inorganic Culture Medium Components

[0058] Finally, it should be noted that the above description of the present invention is merely a preferred embodiment and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A Pichia pastoris engineered strain that produces high levels of 11α-hydroxycanrenone, characterized in that, The engineered bacteria use Pichia pastoris as the host, heterologously express steroid 11α-hydroxylase CYP68J5, and overexpress superoxide dismutase SOD and / or catalase Cat; the nucleotide sequence of CYP68J5 is shown in SEQ ID NO:1, the nucleotide sequence of Cat is shown in SEQ ID NO:2, and the nucleotide sequence of SOD is shown in SEQ ID NO:

3.

2. The engineered Pichia pastoris strain according to claim 1, characterized in that, The Pichia pastoris host is Pichia pastoris GS115.

3. The engineered Pichia pastoris strain according to claim 1, characterized in that, The engineered bacteria simultaneously overexpress superoxide dismutase (SOD) and catalase (Cat).

4. The engineered Pichia pastoris strain according to claim 3, characterized in that, The engineered strain is Pichia pastoris GS115-CYP68J5-SOD-Cat.

5. The engineered Pichia pastoris strain according to claim 1, characterized in that, The engineered bacteria are Pichia pastoris GS115-CYP68J5-SOD or Pichia pastoris GS115-CYP68J5-Cat.

6. The engineered Pichia pastoris strain according to claim 1, characterized in that, The method for constructing the Pichia pastoris engineered strain involves introducing the gene encoding steroid 11α-hydroxylase CYP68J5, the gene encoding superoxide dismutase SOD, and / or the gene encoding catalase Cat into Pichia pastoris host cells, and then screening to obtain recombinant engineered strains.

7. The use of the engineered Pichia pastoris strain according to any one of claims 1 to 5 in the catalytic conversion of canrenone to 11α-hydroxycanrenone.

8. The application according to claim 7, characterized in that, The engineered bacteria reduce intracellular oxidation levels by overexpressing SOD and / or Cat, inhibiting excessive oxidation of 11α-hydroxycanrenone and improving product yield.

Images