Use of jsh-23 in the expansion and / or functional enhancement of human circulating hematopoietic stem / progenitor cells

By targeting the NF-κB pathway in NISS with the small molecule compound JSH-23, reducing the level of phosphorylated NF-κB p65 and upregulating HOXB4 gene expression, the problem of expansion and functional maintenance of human circulating hematopoietic stem/progenitor cells in in vitro culture was solved, achieving efficient cell expansion and maintenance of regenerative potential.

CN122128240BActive Publication Date: 2026-07-31THE FIRST AFFILIATED HOSPITAL ZHEJIANG UNIV COLLEGE OF MEDICINE +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
THE FIRST AFFILIATED HOSPITAL ZHEJIANG UNIV COLLEGE OF MEDICINE
Filing Date
2026-04-30
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

In existing technologies, human circulating hematopoietic stem/progenitor cells are difficult to rapidly expand in vitro while maintaining cell stemness and regenerative potential.

Method used

The small molecule compound JSH-23 was used to target the NF-κB pathway in NISS, reducing the protein level of phosphorylated NF-κB p65 and upregulating HOXB4 gene expression, thereby increasing the expansion fold of LIN-CD45RA-CD34+CD38low/- cells.

Benefits of technology

It significantly increased the expansion rate of human circulating hematopoietic stem/progenitor cells, maintained cell stemness and regenerative capacity, and solved the problems of rapid cell expansion and functional maintenance in existing technologies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122128240B_ABST
    Figure CN122128240B_ABST
Patent Text Reader

Abstract

This invention provides the application of JSH-23 in the expansion and / or functional enhancement of human circulating hematopoietic stem / progenitor cells, relating to the fields of stem cell biology and regenerative medicine. The small molecule compound JSH-23 effectively reduces the protein level of phosphorylated NF-κB p65 (Ser536) in cultured cells, accompanied by upregulation of HOXB4 gene expression, and significantly improves LIN. ‑ CD45RA ‑ CD34 + CD38 low / ‑ The cell expansion factor, maintaining cell stemness and regeneration capacity, provides a new approach to solving the technical problem of the difficulty in rapidly expanding human circulating hematopoietic stem / progenitor cells in in vitro culture while maintaining cell stemness and regeneration potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of stem cell biology and regenerative medicine, and in particular to the application of JSH-23 in the expansion and / or functional enhancement of human circulating hematopoietic stem / progenitor cells. Background Technology

[0002] Human circulating hematopoietic stem / progenitor cells (cHSPCs), as an easily accessible source of autologous stem cells, hold great potential in cell therapy. However, their extremely low abundance and rapid differentiation and loss of function under conventional in vitro culture conditions severely limit their clinical application. Existing expansion strategies mostly focus on adding cytokines or regulating a single pathway, but they cannot effectively maintain the self-renewal and transplantation capacity of the most primitive long-term hematopoietic stem cells (LT-HSCs).

[0003] Human circulating hematopoietic stem / progenitor cells (cHSPCs), as an easily accessible source of autologous stem cells, have shown great clinical application potential in the field of cell therapy. Compared with hematopoietic stem cells derived from bone marrow or umbilical cord blood, cHSPCs can be obtained from peripheral blood through a simple leukocyte ablation procedure, avoiding invasive tissue puncture and significantly reducing donor risk and operational difficulty, providing a safer and more accessible cell source for patients requiring autologous stem cell transplantation. Furthermore, the acquisition process of cHSPCs does not involve ethical controversies and can be repeated, laying the foundation for the large-scale application of cell therapy. However, the clinical application of cHSPCs still faces serious challenges: their abundance in the circulating system is extremely low, and once cultured in vitro, they rapidly lose their self-renewal capacity and differentiate into various blood cell lineages, leading to the depletion of the most therapeutically valuable long-term hematopoietic stem cells (LT-HSCs) within days, making it difficult to rebuild durable and stable multi-lineage hematopoietic function after transplantation.

[0004] In view of this, the present invention is hereby proposed. Summary of the Invention

[0005] The purpose of this invention is to provide the application of JSH-23 in the expansion and / or functional enhancement of human circulating hematopoietic stem / progenitor cells, so as to solve the technical problem in the prior art that human circulating hematopoietic stem / progenitor cells are difficult to rapidly expand in vitro culture while maintaining cell stemness and regenerative potential.

[0006] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted: In a first aspect, the present invention provides the application of JSH-23 in A1~A4: A1. To prepare products for the expansion of human circulating hematopoietic stem / progenitor cells; A2. To prepare products for improving the regenerative capacity of human circulating hematopoietic stem / progenitor cells; A3. Prepare products for maintaining the stemness of human circulating hematopoietic stem / progenitor cells; A4. Prepare products for hematopoietic reconstruction.

[0007] Furthermore, the working concentration of JSH-23 is 0.1~50 μM.

[0008] Furthermore, the working concentration of JSH-23 is 10 μM.

[0009] Furthermore, the hematopoietic reconstitution includes at least one of B1 to B3: B1. Treatment of hematologic malignancies; B2. Treatment of hereditary blood diseases; B3. Restore hematopoietic function after chemotherapy and / or radiotherapy; Preferably, the product for hematopoietic reconstitution comprises a population of human circulating hematopoietic stem / progenitor cells obtained by amplification of human circulating hematopoietic stem / progenitor cells.

[0010] In a second aspect, the present invention provides a composition for in vitro expansion of human circulating hematopoietic stem / progenitor cells, comprising JSH-23.

[0011] Furthermore, the final concentration of JSH-23 is 0.1~50μM, preferably 10μM.

[0012] Thirdly, the present invention provides a culture medium for in vitro expansion of human circulating hematopoietic stem / progenitor cells, comprising the above-described composition.

[0013] Furthermore, the culture medium also includes basal culture medium and hematopoietic support factors; Preferably, the hematopoietic support factors include SCF, TPO, FLT3L, IL-3, and IL-6.

[0014] Fourthly, the present invention provides a method for in vitro expansion of human circulating hematopoietic stem / progenitor cells for non-disease diagnosis and treatment purposes, comprising culturing peripheral blood mononuclear cells containing cHSPCs using the above-described culture medium.

[0015] Fifthly, the present invention provides a human circulating hematopoietic stem / progenitor cell population, which is obtained by the above-described method.

[0016] The application of the small molecule compound JSH-23 provided by this invention in the expansion and / or functional enhancement of human circulating hematopoietic stem / progenitor cells: JSH-23 directly targets the NF-κB pathway, a core inflammatory signaling axis identified in NISS, effectively reducing the protein level of phosphorylated NF-κB p65 (Ser536) in cultured cells, accompanied by upregulation of HOXB4 gene expression, and significantly improving LIN -CD45RA - CD34 + CD38 low / - The cell expansion factor, maintaining cell stemness and regeneration capacity, provides a new approach to solving the technical problem of the difficulty in rapidly expanding human circulating hematopoietic stem / progenitor cells in in vitro culture while maintaining cell stemness and regeneration potential. Attached Figure Description

[0017] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0018] Figure 1 This is a schematic diagram of the NISS experiment for conventional culture-induced inflammatory signaling network of cHSPC amplification and function provided in Example 1 of the present invention; Figure 2 The figure shows the experimental results of the effect of the niche-induced inflammatory signaling network on cHSPC amplification and functional inhibition provided in Example 1 of this invention. It illustrates the effect of cHSPC culture alone and co-culture with PBMC helper cells for 7 days on LIN. - CD45RA - CD34 + CD38 low / - A quantitative statistical chart of cHSPC proportions, where A represents cHSPC culture alone and B represents cHSPC co-culture with PBMC helper cells. The data are expressed as mean ± SEM; n = 3 donors. Figure 3 CD34 derived from the cHSPC single-culture and co-culture systems provided in Example 1 of this invention + The results of differential gene analysis of cells show the results of differential gene enrichment in individual culture systems. Among them, A is the top KEGG pathway, B is the upregulated inflammatory factor interaction network, and C is the comparison of the expression levels of some factors occupying the main hub positions in the interaction network, n=3. Figure 4 To demonstrate the functional impact of the niche-induced inflammatory signaling network NISS provided in Example 1 of this invention on long-term implantation capability, n=12-13 mice; Figure 5 The detection results of the amplification effect of the small molecule compound JSH-23 provided in Example 2 of this invention on cHSPCs; Figure 6The results of Western blot analysis of the small molecule compound JSH-23 provided in Example 3 of the present invention inhibiting NF-κB p65, phosphorylated p65 (Ser536), c-Jun and phosphorylated c-Jun (Ser63), wherein ACTIN was used as an internal control. Figure 7 The results show the effect of the small molecule compound JSH-23 provided in Example 4 of this invention on the expression level of the hematopoietic stem cell gene HOXB4. Figure 8 The results show the effect of the small molecule compound JSH-23 provided in Example 5 of this invention on the clonogenic ability of hematopoietic stem / progenitor cells. Detailed Implementation

[0019] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0020] In this document, "prepared from" and "comprising" are synonymous. The terms "comprising," "including," "having," "containing," or any other variations thereof as used herein are intended to cover non-exclusive inclusion. For example, a composition, step, method, article, or apparatus that includes the listed elements is not necessarily limited to those elements, but may include other elements not expressly listed or elements inherent to such composition, step, method, article, or apparatus.

[0021] In this document, the conjunction "composed of" excludes any unspecified elements, steps, or components. If used in a claim, this phrase will make the claim closed, meaning it does not contain any materials other than those described, except for conventional impurities associated with them.

[0022] In this document, when a quantity, concentration, or other value or parameter is expressed as a range, a preferred range, or a range defined by a series of upper and lower preferred values, this should be understood as specifically disclosing all ranges formed by any pair of any upper or preferred value with any lower or preferred value, regardless of whether the range is disclosed individually. For example, when the range “1~5” is disclosed, the described range should be interpreted as including the ranges “1~4”, “1~3”, “1~2”, “1~2 and 4~5”, “1~3 and 5”, etc. When numerical ranges are described herein, unless otherwise stated, the range is intended to include its endpoints and all integers and fractions within that range.

[0023] In this document, “and / or” is used to indicate that one or both of the situations described may occur, for example, A and / or B includes (A and B) and (A or B).

[0024] In this document, unless otherwise stated, arbitrary numbering is used to distinguish one entity or behavior from another, and is not required to require or imply any actual relationship, order or importance between these entities or behaviors, such as numbering I...V; A1, A2...A7; first, second...fifth, etc.

[0025] In this document, unless otherwise stated, “optional,” “optional,” “optional,” or “optional” means that the event or situation described below may, but does not have to, occur, including the circumstances in which the event or situation may or may not occur.

[0026] In this article, “each…independently selected”, “…independently selected respectively”, and “…independently selected” are interchangeable and should all be interpreted broadly. They refer to the range or options that each member of a set of variables or components can choose independently, that is, the choice of each variable or component is independent and is not affected by the choice of other variables or components.

[0027] This invention provides, in one aspect, the application of JSH-23 in A1~A4: A1. To prepare products for the expansion of human circulating hematopoietic stem / progenitor cells; A2. To prepare products for improving the regenerative capacity of human circulating hematopoietic stem / progenitor cells; A3. Prepare products for maintaining the stemness of human circulating hematopoietic stem / progenitor cells; A4. Prepare products for hematopoietic reconstruction.

[0028] The inventors discovered that conventional culture induces Niche-Induced Inflammation Signaling (NISS), which inhibits cHSPC amplification and function. The small molecule compound JSH-23 directly targets the identified core inflammatory signaling axis in NISS—the NF-κB pathway—effectively reducing the protein level of phosphorylated NF-κB p65 (Ser536) in cultured cells, accompanied by upregulation of HOXB4 gene expression, and significantly improving LIN. - CD45RA - CD34 + CD38 low / - The cell expansion factor, maintaining cell stemness and regeneration capacity, provides a new approach to solving the technical problem of the difficulty in rapidly expanding human circulating hematopoietic stem / progenitor cells in in vitro culture while maintaining cell stemness and regeneration potential.

[0029] In some specific embodiments, the working concentration of JSH-23 is 0.1~30μM; specifically, the working concentration of the small molecule compound JSH-23 can be, but is not limited to, 0.1μM, 0.5μM, 1μM, 10μM, 20μM, 30μM, or any value between 0.1~30μM, preferably 10μM.

[0030] In some specific embodiments, the hematopoietic reconstitution includes at least one of treating hematologic malignancies, treating hereditary hematologic diseases, or restoring hematopoietic function after chemotherapy and / or radiotherapy.

[0031] In some specific embodiments, the product for hematopoietic reconstitution comprises a population of human circulating hematopoietic stem / progenitor cells obtained by amplification of human circulating hematopoietic stem / progenitor cells.

[0032] According to another aspect of the invention, a composition for in vitro expansion of human circulating hematopoietic stem / progenitor cells, comprising JSH-23, is also provided.

[0033] In some specific embodiments, the final concentration of JSH-23 is 0.1~50μM, preferably 10μM.

[0034] According to another aspect of the present invention, a culture medium for in vitro expansion of human circulating hematopoietic stem / progenitor cells is also provided, comprising the above-described composition.

[0035] In some specific embodiments, the culture medium further includes a basal culture medium and hematopoietic support factors; in some specific embodiments, the hematopoietic support factors include SCF, TPO, FLT3L, IL-3 and IL-6.

[0036] The working concentrations of SCF, TPO, and FLT3L are each independently 50-100 ng / mL; the working concentrations of IL-3 and IL-6 are each independently 5-20 ng / mL.

[0037] According to another aspect of the present invention, a method for in vitro expansion of human circulating hematopoietic stem / progenitor cells for non-disease diagnosis and treatment purposes is also provided, comprising culturing peripheral blood mononuclear cells containing cHSPCs using the above-described culture medium.

[0038] The culture time is 5 to 10 days; during the culture period, the culture medium can be replaced as needed.

[0039] According to another aspect of the present invention, a human circulating hematopoietic stem / progenitor cell population is also provided, which is obtained by the above-described method.

[0040] The present invention will be further illustrated by the following examples. Unless otherwise specified, the materials in the examples are prepared according to existing methods or purchased directly from the market.

[0041] Materials and Methods 1. Human CD34 + Cell culture Human CD34 + Cells were cultured in hematopoietic stem cell expansion medium consisting of StemSpanSFEM II (StemCell Technologies, catalog number: 09655) supplemented with the following factors: 100 ng / ml human stem cell factor (SCF), 100 ng / ml human FMS-like tyrosine kinase 3 ligand (FLT3L), 50 ng / ml human thrombopoietin (TPO), and 1 µM SR1. The compounds were added to the HSC expansion medium at specified concentrations.

[0042] 2. Community Forming Unit (CFU) Experiment CD34 from fresh bone marrow + CD34 cells or CD34 cells cultured under different conditions + Cells were resuspended in 200 μl of IMDM (Thermo Fisher Scientific, 12440061) containing 2% FBS (Hyclone, catalog number: SH30396), and then seeded into 2 ml of methylcellulose medium (MethoCult™ H4435 Enriched, STEMCELLS Technologies, catalog number: 04435), with 300 cells per well as directed, using ultra-low adsorption six-well plates (Corning, catalog number: 3471). The plates were incubated at 37°C with 5% CO2. After 14 days, the clone count was performed. Each experiment was performed in triplicate.

[0043] 3. Flow cytometry analysis Cultured cells were collected at different time points and incubated with the specified antibody in PBS containing 0.5% BSA (Sigma, catalog number: A1470-100G) at 4°C for 30 minutes. Subsequently, the cells were washed three times with PBS and resuspended in 0.2 ml PBS for analysis. Flow cytometry analysis was performed using a CytoFLEX (BECKMAN COULTER) instrument. Data were analyzed using FlowJo-V10 (BD). The antibodies used were: anti-human CD34, anti-human CD38, anti-human CD49f, anti-human CD90, and anti-human CD45RA.

[0044] 4. Western Blot Fresh CD34+ cells were co-cultured with peripheral blood mononuclear cells (PBMCs) for 7–10 days with either 10 μM JSH-23 or 0.01% DMSO. The cells were then centrifuged and washed with PBS. The pellet was resuspended in 45 μl PBS and 15 μl lysis buffer (200 mM Tris-HCl, 8% SDS, 400 mM DTT, 0.1% bromophenol blue, 40% glycerol) and incubated at 100°C for 10 min for lysis. The lysis buffer was electrophoresed on a 10% SDS-PAGE gel and then transferred to a PVDF membrane. The membrane was incubated overnight at 4°C with an appropriate primary antibody in 4% skim milk. It was then incubated with horseradish peroxidase (HRP)-labeled goat anti-mouse / rabbit IgG (Jackson Laboratories) secondary antibody, washed, and visualized using a Western blot imaging system.

[0045] 5. Reverse transcription-polymerase chain reaction (RT-PCR) The product uses Novizan HiScript Il Q RT SuperMix for qPCR (+gDNA wiper), and the installation steps are performed according to the instruction manual.

[0046] The primers used, HOXB4 primer sequence: Sequence(5'->3')F:TTGGAGCTGGAGAAGGAATT; Sequence (5'->3') R:CGAGCGGATCTTGGTGTTGG.

[0047] 6. Quantitative and Statistical Analysis Data are expressed as mean ± standard error (SEM) or standard deviation (SD). Paired comparisons between different groups were assessed using unpaired t-tests. For all analyses, p < 0.05 was considered statistically significant. Statistical significance and n-values ​​are reported in the figure captions.

[0048] All data are presented as mean ± standard error. Statistical significance was assessed using an unpaired t-test, with *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001.

[0049] Example 1: Establishment of an in vitro cHSPC culture system To investigate the potential and related obstacles of in vitro expansion of cHSPCs, this embodiment first established a co-culture system simulating the in vivo microenvironment. For example... Figure 1As shown, culturing cHSPCs alone or co-culturing them with PBMC helper cells in standard cytokine-containing medium (SCF, TPO, FLT3L, IL-3, IL-6, SR1) leads to rapid activation of inflammatory factors in both cHSPCs and helper cells; this process is termed niche-induced inflammatory signaling network. CD34 was isolated from peripheral blood of healthy donors. + cHSPCs (approximately ~0.01-0.1% of PBMCs). To simulate cell-cell interactions, the culture included PBMCs after cHSPC removal (in... Figure 1 (Represented as PBMC helper cells). After 7 days of culture alone with standard cytokine therapy including SCF, FLT3L, TPO, IL-3, IL-6, and the small molecule StemRegenin1 (SR1), cHSPCs showed the following results: Figure 2 As shown in Figure A, despite the support of cytokines, LIN CD45RA CD34 + CD38low / cHSPCs still showed a significant 11.09±4.83-fold decrease, with over 89% loss of the original phenotype by day 7. cHSPCs exhibited limited expansion and stem / progenitor cell frequency (defined as Lin). CD45RA CD34 + CD38 The significant decrease in cells indicates the existence of a mechanism that inhibits stemness. Figure 2 The B-cell model shows that, with the support of helper cells, LIN CD45RA CD34 + CD38 low / HSPCs achieved a significant improvement of 13.55 ± 3.00 times by day 7. Co-culture of cHSPCs with PBMC helper cells promoted HSPC expansion to some extent, but the expansion efficiency was still limited.

[0050] Comparative transcriptomic analysis of cHSPCs cultured alone and cHSPCs co-cultured with PBMC helper cells revealed inflammatory response characteristics in the co-culture group, such as... Figure 3 As shown. The inflammatory response characteristics in the co-culture group were defined as microenvironment-induced inflammatory stress signals (NISS). For example... Figure 3As shown in Figure A, KEGG pathway enrichment analysis revealed that cultured cHSPCs were significantly enriched in inflammation, cell cycle, and differentiation-related signaling pathways, including cytokine-cytokine receptor interactions, the JAK-STAT signaling pathway, Th17 cell differentiation, and the p53 signaling pathway, but not in pathways related to stemness maintenance. This indicates that in vitro culture conditions actively induced transcriptional programs for inflammation, differentiation, and apoptosis. Figure 3 Gene interaction network analysis using significantly upregulated genes in individual cHSPC cultures in media B and C showed that these inflammatory factors (IFNG, IRF4, TNF superfamily) are closely related to cell cycle (CDKN2A, CCND2), interleukins (IL2, IL9, IL17A) and hematopoietic differentiation (CD19, CD70, CD40L).

[0051] To assess the impact of NISS on long-term implantation function, an in vivo transplantation experiment was conducted. Results are as follows: Figure 4 As shown, in xenograft experiments, cHSPCs cultured alone exhibited extremely low chimerism (<0.1% at 4 months). cHSPCs co-cultured with PBMC helper cells achieved multilineage engraftment, but the level of chimerism remained limited. This indicates that cHSPCs cultured alone completely lost their in vivo engraftment capability. Conversely, when co-cultured with PBMC helper cells, the expanded cells retained some engraftment activity, but the level of chimerism remained significantly limited.

[0052] Example 2: Treatment with the small molecule compound JSH-23 significantly improved cHSPC amplification. This embodiment investigates whether the small molecule compound JSH-23 (purchased from MedChemExpress (MCE), lot number HY-13982) can effectively promote cHSPC amplification.

[0053] The expression of TNCs and HSPC surface markers LIN, CD45RA, CD34, and CD38 was used as an efficiency indicator. Results are as follows: Figure 5 As shown, the addition of the small molecule compound JSH-23 to the culture medium significantly increased LIN compared to the DMSO-treated control group. CD45RA CD34 + CD38 low / The number of HSPCs indicates that the small molecule compound JSH-23 effectively promotes the amplification of cHSPCs.

[0054] Example 3: Small molecule compound JSH-23 promotes cHSPC amplification by inhibiting inflammatory signaling from the microenvironment of NF-κB and JUN. Cultures were treated with the small molecule compound JSH-23 to investigate whether JSH-23 promotes cHSPC amplification by regulating NF-κB and JUN. Results are as follows: Figure 6 As shown, the data indicate that JSH-23 inhibited the protein levels of total NF-κB p65 and its phosphorylated form (Ser536 site) and total c-Jun and its phosphorylated form (Ser63 site).

[0055] Example 4: Small molecule compound JSH-23 promotes cHSPC amplification by promoting HOXB4 expression. The expression of the stem gene HOXB4 after treatment with the small molecule compound JSH-23 was assessed by RT-PCR. The results are as follows: Figure 7 As shown, JSH-23 significantly promoted the expression of HOXB4 compared with the control group.

[0056] Example 5: The small molecule compound JSH-23 promotes the amplified hematopoietic clone formation potential of cHSPCs.

[0057] Through cloning experiments, such as Figure 8 As shown, compared with the control group, the small molecule compound JSH-23 significantly increased the number of expanded hematopoietic stem and progenitor cells, indicating that JSH-23 can enhance the clonogenic ability of expanded hematopoietic stem and progenitor cells.

[0058] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of JSH-23 in the preparation of products for the expansion of human circulating hematopoietic stem / progenitor cells, characterized in that, The working concentration of JSH-23 is 0.1~30μM.

2. The application according to claim 1, characterized in that, The working concentration of JSH-23 is 10 μM.

3. A method for in vitro expansion of human circulating hematopoietic stem / progenitor cells for non-disease diagnosis and treatment purposes, characterized in that, This includes culturing peripheral blood mononuclear cells containing cHSPCs in a medium containing JSH-23 at a working concentration of 0.1–30 μM.