One-pot nucleic acid detection system based on APE1 and intermediate-temperature Ago cascade, its construction method and application

CN122128401APending Publication Date: 2026-06-02FUJIAN MEDICAL UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
FUJIAN MEDICAL UNIV
Filing Date
2026-01-23
Publication Date
2026-06-02

Smart Images

  • Figure CN122128401A_ABST
    Figure CN122128401A_ABST
Patent Text Reader

Abstract

This invention discloses a one-pot nucleic acid detection system based on APE1 and mesophilic Ago cascade, its construction method, and its application, belonging to the field of nucleic acid detection technology. The one-pot nucleic acid detection system provided by this invention includes an APE1 endonuclease, a mesophilic Ago endonuclease, a first single-stranded DNA probe, a second single-stranded DNA probe, and a reaction buffer, achieving a complete cascade reaction under isothermal conditions of 37-45℃. This invention overcomes the limitations of existing similar technologies that require step-by-step, temperature-varying operations, simplifying the detection process to a single sample addition and a single incubation, significantly reducing operational complexity, instrument dependence, and the risk of sample cross-contamination. Simultaneously, the system possesses high sensitivity, high specificity, and high stability, providing a new and effective tool for the accurate and rapid detection of low-abundance nucleic acid biomarkers, especially tumor fusion genes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of nucleic acid detection technology, and in particular to a one-pot nucleic acid detection system based on APE1 and intermediate-temperature Ago cascade, its construction method and application. Background Technology

[0002] The information disclosed in the background section of this invention is intended only to enhance the understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Nucleic acid testing technology plays a central role in disease diagnosis, pathogen screening, and precision medicine. However, polymerase chain reaction (PCR) technology, considered the gold standard, relies on sophisticated thermal cycling equipment and complex operating procedures, making it difficult to meet the urgent need for rapid, on-site, real-time testing in resource-constrained settings.

[0004] To simplify operations, a series of isothermal amplification techniques have been developed, which can amplify nucleic acids at a constant temperature, significantly reducing equipment requirements. However, these techniques often face the risk of false positive results due to nonspecific amplification, and the polymerases used have limited fidelity, which limits the reliability of their test results. Furthermore, while digital PCR and high-throughput sequencing technologies can achieve high-precision quantification, their high cost limits their widespread adoption in routine diagnosis and field screening.

[0005] Programmable nuclease technology, exemplified by the CRISPR-Cas system, has opened new avenues for highly specific, amplification-free nucleic acid detection. However, this system is typically limited by the motif adjacent to the protospacer sequence, and the RNA guide strand it relies on faces challenges in stability and synthesis cost, as well as potential off-target risks. Meanwhile, prokaryotic Argonaute proteins, as an emerging programmable nuclease, have shown advantages such as not requiring PAM sequences and being able to use more stable DNA guide strands, making them promising candidates for molecular diagnostics. However, most current pAgo-based detection strategies still rely on a pre-amplification step to achieve sufficient sensitivity. This two-step "amplification + detection" approach increases operational complexity, time consumption, and the risk of aerosol contamination. Furthermore, the extensively studied high-temperature pAgo requires high-temperature conditions to exert its activity, which is incompatible with the optimal reaction temperature of most biological enzymes. This often necessitates stepwise, temperature-controlled reaction systems, further hindering its application in point-of-care testing that prioritizes ease of operation and lightweight equipment.

[0006] Recent studies have attempted to cascade human depurinyl / depyrimidine endonucleases, which possess high specificity for recognition and signal amplification, with pAgo to construct an amplification-free detection platform. However, overcoming the differences in optimal reaction temperatures among different enzymes to achieve a truly simple, efficient, and stable "one-pot" single-temperature detection while maintaining high sensitivity remains a key challenge in this field. Therefore, developing a novel integrated nucleic acid detection method capable of completing the entire reaction process at a single, mild temperature, while possessing both high sensitivity and specificity, is of great significance for promoting the field application of molecular diagnostics. Summary of the Invention

[0007] In view of this, the present invention provides a one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade, its construction method and application. Based on the activity compatibility between mesothermal Ago protein and APE1 endonuclease, the present invention achieves efficient and highly specific cascade signal amplification under a single isothermal condition through an original probe design, thereby simplifying the operation process of amplification-free nucleic acid detection into a one-pot method, significantly improving the convenience and reliability of detection.

[0008] In a first aspect, the present invention provides a one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade, comprising: APE1 endonuclease; Intermittent Ago endonuclease; The first single-stranded DNA probe has a sequence complementary to the target nucleic acid molecule, and its 5' end and 3' end are modified with a fluorescent group and a quenching group, respectively; the middle of the first single-stranded DNA probe contains an AP site composed of non-base modifiers, which is recognized and cleaved by the APE1 endonuclease. The second single-stranded DNA probe has a sequence complementary to the DNA fragment carrying the quenching group generated after the first single-stranded DNA probe is cleaved by the APE1 restriction enzyme, and is used to be recognized and cleaved by the mesophilic Ago restriction enzyme; and there is a 2-3 base mismatch between the 3' end sequence of the second single-stranded DNA probe and the DNA fragment carrying the quenching group; the 5' end and 3' end of the second single-stranded DNA probe are modified with a fluorescent group and a quenching group, respectively. And reaction buffer.

[0009] Preferably, the mesophilic Ago endonuclease is selected from one of CpAgo, IbAgo, or CbAgo; the non-base modifier in the first single-stranded DNA probe is tetrahydrofuran or a debasement site mimic.

[0010] Preferably, the length of the first single-stranded DNA probe is 15-30 nucleotides, and the length of the second single-stranded DNA probe is 15-30 nucleotides.

[0011] Preferably, the reaction buffer contains Mn at a concentration of 100-1000 nM. 2+ ion.

[0012] Preferably, the concentration of the APE1 endonuclease in the reaction system is 100~500 U / mL, and the concentration of the mesophilic Ago endonuclease in the reaction system is 50~500 nM.

[0013] Preferably, the concentration of the first single-stranded DNA probe in the reaction system is 50-500 nM, and the concentration of the second single-stranded DNA probe in the reaction system is 30-500 nM.

[0014] Secondly, this invention provides a method for constructing the above-mentioned one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade, comprising the following steps: The APE1 endonuclease, the intermediate-temperature Ago endonuclease, the first single-stranded DNA probe, the second single-stranded DNA probe, and the reaction buffer are mixed to form a homogeneous reaction mixture, thus obtaining the one-pot nucleic acid detection system.

[0015] Thirdly, the present invention provides a nucleic acid detection method for non-disease diagnosis purposes, employing the aforementioned one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade, comprising the following steps: The sample to be tested is mixed with the components of the one-pot nucleic acid detection system and incubated at 37-45°C, and then the generated fluorescence signal is collected.

[0016] Fourthly, the present invention provides the application of the above-described one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade or the one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade constructed by the above-described construction method in the preparation of reagent kits for detecting pathogenic microorganisms, gene mutations or tumor markers.

[0017] Fifthly, the present invention provides a nucleic acid detection kit comprising the above-described one-pot nucleic acid detection system based on the APE1 and intermediate-temperature Ago cascade or the one-pot nucleic acid detection system based on the APE1 and intermediate-temperature Ago cascade constructed by the above-described construction method.

[0018] Compared with the prior art, the present invention has achieved the following beneficial effects: (1) This invention achieves a complete cascade reaction under constant temperature conditions of 37~45℃ by selecting the medium-temperature Ago and APE1 with the optimal overlapping temperatures and designing them to work in the same buffer system. This overcomes the limitations of existing similar technologies that must be operated in steps and at varying temperatures, simplifies the detection process to a single sample addition and a single incubation, significantly reduces operational complexity, instrument dependence and the risk of sample cross-contamination, and provides a practical technical basis for rapid on-site detection.

[0019] (2) This invention utilizes the DNA fragment carrying a quenching group generated by APE1 cleavage as the sole guide strand for activating Ago at mesophilic temperatures. This design ensures that the signal amplification process is highly dependent on the initial cleavage triggered by the target, thereby effectively suppressing background signals caused by exogenous guide strand contamination or non-specific cleavage. Combined with the controllable mismatch of 2-3 bases introduced in the second probe, the cleavage kinetics and single-base resolution of Ago at mesophilic temperatures are further optimized, giving the system both high sensitivity and high specificity.

[0020] (3) Experiments show that the one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade provided by this invention improves the detection sensitivity of EML4-ALK fusion gene mRNA by five orders of magnitude compared with the single APE1 detection system, reaching 10, without the need for pre-amplification. -14 M level. Simultaneously, this system can effectively distinguish similar sequences with single-base differences, exhibiting excellent specificity and stability, providing a new and effective tool for the accurate and rapid detection of low-abundance nucleic acid biomarkers, especially tumor fusion genes. Attached Figure Description

[0021] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments and descriptions of the invention are used to explain the invention and do not constitute an undue limitation thereof. Obviously, those skilled in the art can obtain other drawings based on these drawings without any inventive effort.

[0022] Figure 1 This is a schematic diagram illustrating the working principle of a one-pot nucleic acid detection system based on the cascade of APE1 and intermediate-temperature Ago in a specific embodiment of the present invention; Figure 2 These are the fluorescence detection results (A) of different concentrations of APE1 probe and (B) of different concentrations of Ago probe in Example 1 of the present invention. Figure 3 The results show the sensitivity detection of the APE1-CpAgo cascade system (A) constructed in Example 1 of this invention and the single enzyme detection system (B) using only APE1. Figure 4This is the specificity test result in Embodiment 2 of the present invention; Figure 5 This is the stability test result in Embodiment 2 of the present invention; Figure 6 These are the test results of different groups in Embodiment 3 of the present invention; wherein, A is a schematic diagram of experimental variable control for Group 1, Group 2, Group 3, and Group 4; B is the detection result of four groups of experimental variable control; C is the detection result of Group 1; D is the detection result of Group 2; E is the detection result of Group 3; F is the detection result of Group 4; the EML4-ALKmRNA target concentration is 100 nM. Detailed Implementation

[0023] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0024] This invention provides a one-pot nucleic acid detection system based on APE1 and mesophilic Ago cascade, comprising an APE1 endonuclease, a mesophilic Ago endonuclease, a first single-stranded DNA probe, a second single-stranded DNA probe, and a reaction buffer. All components of the one-pot nucleic acid detection system are configured within the same reaction vessel and work synergistically at 37–45°C to achieve target detection and signal cascade amplification without nucleic acid pre-amplification.

[0025] The APE1 endonuclease is a human depurinyl / depyrimidine endonuclease 1, which specifically recognizes and cleaves depurinyl / depyrimidine (AP) sites in the DNA strand. The mesophilic Ago endonuclease is a prokaryotic Argonaute protein, preferably one of CpAgo, IbAgo, or CbAgo. These mesophilic Ago proteins can use 5' phosphorylated single-stranded DNA as a guide strand to programmatically recognize and cleave complementary single-stranded DNA targets.

[0026] The first single-stranded DNA probe (also known as the APE1 probe) has a sequence that is completely complementary to the target nucleic acid molecule (such as specific mRNA or DNA), and its length is 15-30 nucleotides, more preferably 25-30 nucleotides. The probe contains an AP site in its center, composed of a non-base modifier (such as tetrahydrofuran or idSp, a debasement site mimic). The AP site is strategically positioned, typically in the center of the probe, to ensure efficient cleavage by APE1. The 5' end of the first single-stranded DNA probe is modified with a fluorescent group (such as FAM, HEX, ROX, etc.), and the 3' end is modified with a corresponding quencher group (such as BHQ1, BHQ2, etc.). In the absence of a reaction, the fluorescent group and the quencher group, due to their close spatial distance, undergo fluorescence resonance energy transfer, quenching the fluorescence signal.

[0027] The second single-stranded DNA probe (also known as the Ago probe) has a specially designed sequence of 15-30 nucleotides in length, more preferably 15-20. This probe sequence is complementary to the DNA fragment (i.e., the guide strand) carrying the quenching group generated after APE1 cleavage of the first single-stranded DNA probe. More importantly, there is a pre-defined mismatch of 2 to 3 bases between the 3' end sequence of the second single-stranded DNA probe and the guide strand, preferably a pre-defined mismatch of 2 bases. This mismatch design aims to optimize the cleavage kinetics of the mesophilic Ago protein, improving its turnover rate and single-base resolution. The 5' and 3' ends of the second single-stranded DNA probe are also modified with fluorescent and quenching groups, respectively.

[0028] The reaction buffer provides the appropriate pH, ionic strength, and cofactors required for the enzyme reaction. In one or more embodiments of the present invention, the reaction buffer contains Mn at a concentration of 100-1000 nM. 2+ ions, Mn 2+ The concentration of the ion is more preferably 300–700 nM, and even more preferably 400–600 nM, as it is an essential cofactor for the cleavage activity of mesophilic Ago proteins. The buffer system must be compatible with the activities of both APE1 and mesophilic Ago; for example, a suitable ratio of ThermoPol® buffer and NEBuffer can be used. TM 4. Mixed together.

[0029] The working principle of the detection system described above is as follows: When a target nucleic acid molecule is present in the reaction system, it specifically hybridizes with the first single-stranded DNA probe, forming a local double-stranded structure, thereby exposing the AP site inside. The APE1 endonuclease precisely recognizes and cleaves this AP site, causing the first probe to break. This cleavage event produces two direct results: first, the fluorescent group separates from the quencher group, generating a first detectable fluorescent signal; second, a single-stranded DNA fragment carrying a quencher group label and having a natural phosphate group at its 5' end is released. This fragment is the guide strand necessary for activating the mesophilic Ago. This guide strand binds to the mesophilic Ago protein, forming a ribonucleoprotein complex with cleavage activity. This complex then recognizes and binds to a second single-stranded DNA probe whose sequence is complementary to its own. The mesophilic Ago cleaves the second probe at a precise site, causing its fluorescent group to separate from the quencher group, generating a second amplified fluorescent signal. Since one target molecule can trigger the generation of multiple guide strands, and one guide strand can guide the mesophilic Ago to cleave multiple second probes, an exponential amplification of the signal is achieved. A schematic diagram of the working principle is shown below. Figure 1 As shown.

[0030] In some embodiments of the present invention, the concentration of the first single-stranded DNA probe in the final reaction system is 50-500 nM, more preferably 100-400 nM, further preferably 200-300 nM, and most preferably 250 nM. When the concentration is too high, although the fluorescence intensity increases, the background fluorescence also increases, leading to a decrease in the signal-to-noise ratio, and non-specific interference may occur due to probe overload; when the concentration is too low, the fluorescence intensity is too low, resulting in a low signal-to-noise ratio. The concentration of the second single-stranded DNA probe in the final reaction system is 30 to 500 nM, more preferably 30-100 nM, further preferably 40-60 nM, and most preferably 50 nM.

[0031] In some embodiments of the present invention, the concentration of the APE1 endonuclease in the final reaction system is 100-500 U / mL, more preferably 100-300 U / mL, and most preferably 200 U / mL; the concentration of the mesophilic Ago endonuclease in the final reaction system is 50-500 nM, more preferably 50-200 nM, and most preferably 100 nM.

[0032] The present invention also provides a method for constructing the above-mentioned one-pot nucleic acid detection system, comprising the following steps: mixing APE1 endonuclease, intermediate-temperature Ago endonuclease, a first single-stranded DNA probe, a second single-stranded DNA probe and a reaction buffer at a specific concentration range to form a homogeneous and stable reaction mixture, thereby obtaining the one-pot nucleic acid detection system.

[0033] This invention also provides a nucleic acid detection method for non-disease diagnostic purposes, employing the aforementioned one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade, comprising the following steps: The sample to be tested (such as extracted RNA or DNA) is mixed with the components of the one-pot nucleic acid detection system and incubated in a constant temperature device at 35-45℃ (more preferably 40-45℃, most preferably 42℃) for 30-90 minutes, with an incubation time more preferably 40-80 minutes, and even more preferably 50-70 minutes. During this process, the fluorescence signal generated by the reaction system is collected using equipment such as a real-time fluorescence PCR instrument or a fluorescence microplate reader. By comparing the signal intensity of the sample to be tested with that of a standard of known concentration, qualitative or quantitative analysis of the target nucleic acid molecule can be achieved.

[0034] This invention also provides the application of the above-described one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade, or the one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade constructed by the above-described method, in the preparation of reagent kits for detecting pathogenic microorganisms, gene mutations, or tumor markers.

[0035] The present invention also provides a nucleic acid detection kit, comprising the above-described one-pot nucleic acid detection system based on the APE1 and mesothermal Ago cascade or the one-pot nucleic acid detection system based on the APE1 and mesothermal Ago cascade constructed by the above-described construction method. Further, the kit may also include one or more of the following: negative control, positive control (including target nucleic acid standard), sample processing solution, reaction tubes, and instructions for use.

[0036] The technical solution of the present invention will be further described below with reference to specific embodiments. The present invention does not impose any special restrictions on the source of reagents used in the following embodiments; commercially available products well known to those skilled in the art can be used.

[0037] The reagent information in the following examples is shown in Table 1.

[0038] Table 1. Reagent information in the examples name Purchase source 10x ThermoPol® Reaction Buffer New England Biolabs <![CDATA[10x NEBuffer TM 4. Reaction buffer New England Biolabs Ultrapure water Shanghai Sangon Biotech APE1 endonuclease New England Biolabs CpAgo Self-purification <![CDATA[MnCl2]]> Aladdin APE1 probe and Ago probe Shanghai Sangon Biotech The target sequence information in the following embodiments is shown in Table 2.

[0039] Table 2 Target sequences in the embodiments name Sequences (5'-3') EML4-ALK mRNA CAUGGCUUGCAGCUCCUGGUGCUUCCGGCGGUACA / CUUUAGGUCCUUUCCCAGGUGUGGGGCUCUACAGUA (SEQ ID NO: 1) ALK (WT) mRNA CAUGGCUUGCAGCUCCUGGUGCUUCCGGCGGUACACAAUCAUGAUGCC (SEQ ID NO: 2) EML4 (WT) mRNA ATTTGATATACACCUUUAGGUCCUUUCCCAGGUGUGGGCUCUACAGUA (SEQ ID NO: 3) Example 1 In this embodiment, the EML4-ALK fusion gene mRNA associated with non-small cell lung cancer was used as the detection target to construct the APE1-CpAgo cascade system.

[0040] 1. Design and synthesize probes: The first single-stranded DNA probe (APE1 probe) was designed based on the EML4-ALK fusion site sequence, with the sequence: 5'-FAM-AGGACCTAAAXTGTACCGCCGGAAGCAC-BHQ1-3' (SEQ ID NO: 4). Here, "X" represents the tetrahydrofuran-modified AP site.

[0041] The second single-stranded DNA probe (Ago probe) is designed to be complementary to the fragment carrying BHQ1 generated after the first probe is cleaved by APE1, and a base mismatch is introduced at the 3' end. The sequence is: 5'-FAM-TGCTTCCGGCGGTATT-BHQ1-3' (SEQ ID NO: 5).

[0042] 2. Preparation of the reaction system: In a sterile PCR tube, add the following components sequentially to form a detection system with a total volume of 10 μL: 0.5X ThermoPol® reaction buffer; 1X NEBuffer TM 4. Reaction buffer solution; 0.5 mM MnCl2; 200 U / mL APE1 endonuclease; 100 nM CpAgo (medium temperature Ago); 100~500 nM APE1 probe (SEQ ID NO: 4); 50~500 nM Ago probe (SEQ ID NO: 5) An appropriate amount of synthesized EML4-ALK mRNA target or RNA sample to be tested; Make up to 10 μL with nuclease-free water.

[0043] 3. Perform one-pot testing: After gently mixing the above reaction mixture, place it in a real-time fluorescence PCR instrument or a constant-temperature metal bath and incubate at 42°C for 60 minutes. Monitor the fluorescence changes using a PCR instrument or detect the fluorescence intensity before and after the reaction using a fluorescence meter.

[0044] The concentration of the first single-stranded DNA probe (APE1 probe) was optimized. The concentration of the Ago probe in the reaction system was 50 nM, and the concentration of the EML4-ALK mRNA target was 100 nM. Fluorescence detection was performed on the systems with different concentrations of APE1 probe (100 nM, 250 nM, and 500 nM), and the relative fluorescence intensity data are as follows: Figure 2 As shown in Figure A, it can be seen that the reaction system reaches the highest signal-to-noise ratio when the concentration is 250 nM.

[0045] The concentration of the second single-stranded DNA probe (Ago probe) was optimized. The concentration of APE1 probe in the reaction system was 250 nM, and the concentration of EML4-ALK mRNA target was 100 nM. Fluorescence detection was performed on systems with different concentrations of Ago probe (50 nM, 100 nM, 250 nM, and 500 nM). The relative fluorescence intensity data are as follows: Figure 2 As shown in B, it can be seen that the reaction system reaches the highest signal-to-noise ratio when the concentration is 50 nM.

[0046] Example 2 This embodiment provides sensitivity testing, specificity testing, and stability testing.

[0047] 1. Sensitivity test: The synthesized EML4-ALK mRNA target was serially diluted 10-fold (from 10... -7 M to 10 -15 M). The APE1-CpAgo cascade system constructed according to Example 1 was used as the test sample with each target concentration. The concentration of the APE1 probe was 250 nM and the concentration of the Ago probe was 50 nM.

[0048] The results are as follows Figure 3 As shown in A, the detection limit (LOD) of the APE1-CpAgo cascade system constructed in this invention for EML4-ALK mRNA can reach 10. -14 M, compared to single-enzyme detection systems using only APE1 (such as... Figure 3 As shown in B, the LOD is approximately 10. - 9 (M), sensitivity has been improved by five orders of magnitude.

[0049] The APE1 single enzyme detection system consists of the following components: 0.5X ThermoPol® reaction buffer; 1X NEBuffer TM 4. Reaction buffer solution; 200 U / mL APE1 endonuclease; 250 nM APE1 probe (SEQ ID NO: 4); An appropriate amount of synthesized EML4-ALK mRNA target or RNA sample to be tested; Make up to 10 μL with nuclease-free water.

[0050] 2. Specificity test: The detection system constructed in Example 1 was used to test the EML4-ALK fusion gene mRNA (EML4-ALK mRNA), EML4 wild-type mRNA (EML4(WT) mRNA), and ALK wild-type mRNA (ALK(WT) mRNA) at a concentration of 100 nM, respectively.

[0051] The results are as follows Figure 4 As shown, the detection system produces a strong fluorescence signal growth curve only when the EML4-ALK fusion gene mRNA is present. For wild-type EML4 or ALK mRNA, the signal is comparable to the background level of the negative control (no target, NC), indicating that the system can effectively distinguish between fusion genes with single-base differences and wild-type genes, and has high specificity.

[0052] 3. Stability test: Using the same batch of prepared detection system reagents, for low concentrations (10... -13 M and 10 -14 The EML4-ALK mRNA target (M, i.e., 100 fM and 10 fM) was detected in 8 independent replicates. The results of the relative fluorescence intensity detection are shown in […]. Figure 5 ,from Figure 5 This demonstrates that the detection system exhibits excellent repeatability and operational stability.

[0053] Example 3 To further verify and elucidate the performance advantages of the one-pot nucleic acid detection system based on APE1 and intermediate-temperature Ago cascade described in this invention, particularly the impact of introducing specific base mispairing into the second single-stranded DNA probe (Ago probe) on the system's detection sensitivity and specificity, the following comparative experiment was designed in this embodiment.

[0054] 1. Experimental group design (i) Group 1 (Single Enzyme System Control): This group contains only APE1 endonuclease (200 U / mL) and its corresponding first-stranded DNA probe (i.e., APE1 probe, SEQ ID NO: 4, concentration 250 nM), and 100 nM of target EML4-ALK mRNA (positive group, P) or no target (negative control group, N). This group is used to verify the basic recognition and cleavage ability of APE1 enzyme at the AP site in the probe, serving as a baseline for performance comparison.

[0055] (ii) Group 2 (Cascade System - Perfect Match): This group is the complete cascade detection system described in this invention, comprising APE1 restriction enzyme (200 U / mL), CpAgo (100 nM), APE1 probe (SEQ ID NO: 4, 250 nM), and a second single-stranded DNA probe (Ago probe). The Ago probe sequence used in this group is perfectly complementary to the guide strand generated after APE1 cleavage of the first probe, with no pre-set mismatch, and its sequence is: 5'-FAM-TGCTTCCGGCGGTACA-BHQ1-3' (SEQ ID NO: 6). The target setting is the same as in Group 1.

[0056] (iii) Group 3 (Cascade System - Single Base Mismatch): This group has the same structure as Group 2, except that the Ago probe is replaced with a version that introduces a single base mismatch at a specific position. The single base mismatch probe sequence is: 5'-FAM-TGCTTCCGGCGGTACT-BHQ1-3' (SEQ ID NO: 7). This group is used to assess the impact of lower-degree mismatches.

[0057] (iv) Group 4 (Cascade System - Two-Base Mismatch): This group has the same structure as Group 2, but uses an Ago probe that introduces two-base mismatch at a specific position, i.e., the mismatch design preferred in Example 1 of this invention. The two-base mismatch probe sequence is: 5'-FAM-TGCTTCCGGCGGTATT-BHQ1-3' (SEQ ID NO: 5). The target setting is the same as in Group 1.

[0058] 2. Experimental Results and Analysis Experimental results are as follows Figure 6 As shown, the specific analysis is as follows: The fluorescence kinetics curves of Group 1 validated the basic effectiveness of the APE1 / Probe1 (first probe) reaction. A significant increase in fluorescence signal was observed in the presence of the target (Group P), while the background signal was very low in the absence of the target (Group N). This forms the basis for subsequent comparisons of cascaded amplification effects.

[0059] The experimental results for Groups 2 and 3 revealed key issues. Despite the introduction of CpAgo for cascade amplification, Group 2 (perfectly matched) achieved approximately 4-fold enhancement in endpoint fluorescence intensity compared to Group 1's P group, demonstrating the strong signal amplification potential of the cascade structure. However, both Group 2 and Group 3 (single-base mismatch) exhibited extremely high initial background fluorescence, and their negative control (N group) also produced strong fluorescence signal growth throughout the reaction, highly overlapping with the positive group (P group). Figure 6 Statistical analysis in B showed that at the reaction endpoint, there was no significant difference (ns) between groups P and N in both Groups 2 and 3. This indicates that when the Ago probe is perfectly matched with the guide strand or only has a single base mismatch, the system is prone to non-specific activation, possibly due to non-specific interactions between probes or between the probe and the enzyme, resulting in a low signal-to-noise ratio and an inability to effectively distinguish the presence or absence of the target.

[0060] Group 4 (dibase mismatch) significantly outperformed other cascade groups. Its fluorescence kinetics curves exhibited ideal reaction characteristics, such as... Figure 6 As shown in F, in the initial stage of the reaction (approximately the first 20 minutes), the background fluorescence remained at a low level; after approximately 20 minutes, the positive group (P group) curve showed a distinct "inflection point" with a sharply increasing slope, indicating that the cascade reaction was specifically and efficiently triggered and entered the rapid amplification stage. Ultimately, the fluorescence intensity of Group P in Group 4 significantly exceeded that of its N group, exhibiting an extremely high signal-to-noise ratio, with a statistically significant difference (F). This result clearly demonstrates that introducing a pre-defined two-base mismatch between the 3' end sequence of the second single-stranded DNA probe and the guide strand can effectively optimize the cleavage kinetics of Ago (CpAgo) at 37–45 °C. This design, while retaining efficient cascade amplification capabilities (signal enhancement significantly compared to Group 1), significantly suppresses background signals caused by non-specific binding or cleavage, thus achieving a balance between high sensitivity and high specificity.

[0061] In summary, the strategy of cascading APE1 with a mesophilic Ago (such as CpAgo) in this invention achieves exponential signal amplification and significantly improves detection sensitivity compared to a single APE1 detection system (Group 1). The performance of the cascade system is highly dependent on the precise design of the Ago probe. The key optimization point of this invention is the introduction of a two-base mismatch at the 3' end of the second single-stranded DNA probe (as shown in Group 4). This design effectively solves the high background problem caused by perfectly matched or low-mismatch probes, enabling the system to possess both strong signal amplification capabilities and excellent specificity under isothermal conditions, providing a reliable guarantee for high-precision "one-pot" detection of low-abundance nucleic acid targets.

[0062] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade, characterized in that, include: APE1 endonuclease; Intermittent Ago endonuclease; The first single-stranded DNA probe has a sequence complementary to the target nucleic acid molecule, and its 5' end and 3' end are modified with a fluorescent group and a quenching group, respectively; the middle of the first single-stranded DNA probe contains an AP site composed of non-base modifiers, which is recognized and cleaved by the APE1 endonuclease. The second single-stranded DNA probe has a sequence complementary to the DNA fragment carrying the quenching group generated after the first single-stranded DNA probe is cleaved by the APE1 restriction enzyme, and is used to be recognized and cleaved by the mesophilic Ago restriction enzyme; and there is a 2-3 base mismatch between the 3' end sequence of the second single-stranded DNA probe and the DNA fragment carrying the quenching group; the 5' end and 3' end of the second single-stranded DNA probe are modified with a fluorescent group and a quenching group, respectively. And reaction buffer.

2. The one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade as described in claim 1, characterized in that, The mesophilic Ago endonuclease is selected from one of CpAgo, IbAgo, or CbAgo; the non-base modifier in the first single-stranded DNA probe is tetrahydrofuran or a debasement site mimic.

3. The one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade as described in claim 1, characterized in that, The first single-stranded DNA probe is 15-30 nucleotides long, and the second single-stranded DNA probe is 15-30 nucleotides long.

4. The one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade as described in claim 1, characterized in that, The reaction buffer contains Mn at a concentration of 100-1000 nM. 2+ ion.

5. The one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade as described in claim 1, characterized in that, The concentration of the APE1 endonuclease in the reaction system is 100~500 U / mL, and the concentration of the mesophilic Ago endonuclease in the reaction system is 50~500 nM.

6. The one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade as described in claim 1, characterized in that, The concentration of the first single-stranded DNA probe in the reaction system is 50~500 nM, and the concentration of the second single-stranded DNA probe in the reaction system is 30~500 nM.

7. The method for constructing a one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade as described in any one of claims 1 to 6, characterized in that, Includes the following steps: The APE1 endonuclease, the intermediate-temperature Ago endonuclease, the first single-stranded DNA probe, the second single-stranded DNA probe, and the reaction buffer are mixed to form a homogeneous reaction mixture, thereby obtaining the one-pot nucleic acid detection system based on the cascade of APE1 and intermediate-temperature Ago.

8. A nucleic acid detection method for non-disease diagnostic purposes, characterized in that, The one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade as described in any one of claims 1 to 6 includes the following steps: The sample to be tested is mixed with the components of the one-pot nucleic acid detection system and incubated at 37-45°C, and then the generated fluorescence signal is collected.

9. The application of the one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade as described in any one of claims 1 to 6, or the one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade constructed by the construction method described in claim 7, in the preparation of reagent kits for detecting pathogenic microorganisms, gene mutations, or tumor markers.

10. A nucleic acid detection kit, characterized in that, The system includes the one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade as described in any one of claims 1 to 6, or the one-pot nucleic acid detection system based on APE1 and mesothermal Ago cascade constructed by the construction method described in claim 7.