A reagent for pre-miRNA detection and its product and detection method

By using dual DNA probe technology, the limitations of existing pre-miRNA detection technologies in terms of specificity and high-throughput detection have been overcome. This technology enables highly specific, low-cost, and convenient pre-miRNA detection, suitable for multi-target and large-scale sample detection, and applicable to clinical and laboratory applications.

CN122128436APending Publication Date: 2026-06-02GUANGDONG UNIV OF TECH

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
GUANGDONG UNIV OF TECH
Filing Date
2026-05-06
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

Existing pre-miRNA detection technologies suffer from insufficient specificity, cumbersome operation, high cost, and difficulty in achieving high-throughput parallel detection, failing to meet the needs of large-scale sample and multi-target detection in basic research and clinical translation.

Method used

The dual DNA probe technology utilizes single-stranded anchor DNA and single-stranded signal DNA to target different regions of pre-miRNA, forming a stable ternary complex. Detection is achieved through a colorimetric binding reaction, avoiding homologous sequence interference and non-specific hybridization. Combined with an ELISA plate platform, it enables highly specific and sensitive quantitative detection.

Benefits of technology

It achieves highly specific recognition and signal amplification of pre-miRNA, with detection sensitivity and linear range superior to traditional methods. It is easy to operate, cost-controllable, suitable for batch sample testing, adaptable to high-throughput screening, reduces detection costs and technical barriers, and is applicable to the early diagnosis and targeted drug screening of pre-miRNA-related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122128436A_ABST
    Figure CN122128436A_ABST
Patent Text Reader

Abstract

This invention discloses a method for for me This invention relates to reagents, products, and detection methods for RNA detection. It belongs to the field of chemiluminescence detection technology and provides a... for me An RNA detection probe comprising single-stranded anchor DNA and single-stranded signal DNA, each containing three DNA sequences. This invention also provides a chemiluminescence kit containing this single-stranded DNA detection probe, which can be used for… for me RNA detection. The detection probe and kit provided by this invention achieve signal output through chemiluminescence, enabling sensitive and stable detection of different concentrations of RNA. for me RNA, and with good specificity. Detection products developed based on this system are easy to operate and cost-effective, requiring only conventional ELISA plates and colorimetric reagents to complete batch sample detection in a short time, significantly reducing detection costs and technical barriers, and possessing good prospects for application and promotion.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of chemiluminescence detection technology, and more specifically, to a method for... pre-mi Reagents, products, and detection methods for RNA detection. Background Technology

[0002] pre-mi RNA is a key precursor molecule in the biosynthesis of miRNAs, and its expression level is closely related to the occurrence and development of various diseases such as tumorigenesis, cardiovascular disease, and neurodegenerative diseases. It can serve as an important biomarker for early disease diagnosis, prognostic assessment, and drug efficacy monitoring. Therefore, establishing a highly sensitive, highly specific, and high-throughput miRNA biomarker is crucial. pre- mi RNA quantitative detection technology is of great significance for basic medical research and clinical translational applications.

[0003] existing pre-mi RNA detection technologies mainly include quantitative real-time PCR (qRT-PCR), Northern blotting, microarrays, and high-throughput sequencing. Among these, qRT-PCR is currently the most commonly used method, but it suffers from drawbacks such as cumbersome sample processing, demanding primer design requirements, and susceptibility to genomic DNA contamination, and it is difficult to achieve truly high-throughput parallel detection. Northern blotting is complex to operate, has low sensitivity, requires large sample volumes, and is only suitable for high abundance RNA. pre-mi Semi-quantitative analysis of RNA; while microarray chips and high-throughput sequencing have the advantage of high throughput, they also have problems such as high cost, complex data analysis and long detection cycle, which limit their widespread application in routine laboratories and clinical settings.

[0004] In recent years, nucleic acid probe-based fluorescence detection technology has gradually become popular due to its simple operation, rapid response, and high sensitivity. pre-mi RNA detection is a hot research topic. However, existing single-stranded RNA or DNA probes generally suffer from insufficient specificity, susceptibility to non-specific hybridization, and limited signal amplification efficiency. Furthermore, most detection systems can only detect a single sample or a few targets, failing to meet the high-throughput requirements of large-scale drug screening and batch testing of clinical samples. In addition, some probe systems require complex enzymatic reactions or signal amplification steps, further increasing operational complexity and detection costs, making them difficult to adapt to automated, high-throughput detection platforms.

[0005] In summary, currently pre-mi RNA quantification technology still suffers from technical bottlenecks such as insufficient specificity, cumbersome operation, high cost, and difficulty in achieving high-throughput parallel detection, failing to fully meet the needs of large-scale samples and multi-target applications in basic research and clinical translation.pre-mi There is a demand for RNA detection. Therefore, there is a need to develop a method that is highly specific, highly sensitive, easy to operate, and has the potential to achieve high-throughput screening. pre-mi RNA detection reagents and their products have significant theoretical value and promising practical applications. Therefore, this invention application is filed. Summary of the Invention

[0006] The technical problem to be solved by this invention is to overcome the existing pre-mi To address the shortcomings of RNA quantification detection, such as insufficient specificity, cumbersome operation, and susceptibility to environmental interference, this invention provides a method for... pre-mi Reagents, products, and detection methods for RNA detection.

[0007] The first objective of this invention is to provide pre-mi RNA detection probes.

[0008] The second object of the present invention is to provide pre-mi Application of RNA detection probes.

[0009] The third objective of this invention is to provide a pre-mi RNA testing products.

[0010] The fourth object of the present invention is to provide pre-mi Applications of RNA detection products.

[0011] The fifth objective of this invention is to provide an in vitro non-disease diagnostic tool. pre-mi RNA detection methods.

[0012] The above-mentioned objective of this invention is achieved through the following technical solution: This invention provides pre-mi An RNA detection probe comprising single-stranded anchor DNA and single-stranded signal DNA; wherein the single-stranded anchor DNA is one or more of the following: COOH-BP-155-3: 5'-TAATAATGTTAATGCTAATATGTAGGAGTCAGTT-3', COOH-BP-21: 5'-TAATAAACAGCCCATCGACTGGTGTTGCC-3', and COOH-BP-210: 5'-TAATAATCAGCCGCTGTCACACGCACAGTGG-3'; The single-stranded signal DNA is one or more of BP-155-3-Biotin: 5'-AGGCAAAAACCCCTATCACGATTAGCATTAATTAATT-3', BP-21-Biotin: 5'-CAACAGTCAACATCAGTCTGATAAGCTAAATT-3', and BP-210-Biotin: 5'-AGCGCAGTGTGCGGTGGGCAGGGGCTCCAATT-3'.

[0013] This invention has developed a method for... pre-mi A dual-DNA probe for RNA quantification, consisting of a single-stranded anchor DNA and a single-stranded signal DNA, each targeting a specific target. pre-mi Different regions of RNA work together to form a stable ternary complex with the target, enabling rapid detection via a colorimetric binding reaction. pre-mi RNA-specific recognition and signal amplification enable visualized detection. The dual DNA probes provided in this invention effectively avoid homologous sequence interference and non-specific hybridization, exhibiting significantly better performance than traditional single-probe detection systems. They offer superior detection sensitivity and linearity, achieving nM-level accuracy. pre-miRNA The invention provides precise quantification, maintaining good linear correlation within the 0-1000 nM concentration range, with lower background signal and narrower detection limit, superior to traditional methods such as qPCR. Furthermore, the dual DNA probe provided by this invention exhibits good specificity and stability, unaffected by other targets. pre-miRNA Or interference from other RNA molecules. Based on this, the developed detection product is simple to operate and cost-effective, relying only on an ELISA plate and standard chromogenic reagents. The standardized operating procedure allows for batch sample testing in a short time, significantly reducing testing costs and technical barriers, making it more suitable for clinical and laboratory use. It can also be used for… pre-miRNA Early diagnosis, prognostic assessment, or targeted drug screening for related diseases.

[0014] Preferably, the 5' end of the single-stranded anchoring DNA is modified with a carboxylic acid group; the 3' end of the single-stranded signal DNA is labeled with biotin or digoxigenin.

[0015] This invention provides the above-mentioned probe in the preparation and detection pre-mi Applications of RNA in products.

[0016] This invention provides pre-mi RNA detection products contain the probes mentioned above.

[0017] Preferably, the product is a chemiluminescence detection kit, which also contains a colorimetric detection reagent.

[0018] Preferably, the kit further comprises a labeling reagent that specifically binds to the 5' end labeling group of single-stranded signal DNA, a fixation reagent that specifically binds to the 5' end modification group of single-stranded anchored DNA, a buffer, an ELISA plate coated with BSA protein, a blocking solution, an elution solution, streptavidin-horseradish peroxidase, a chromogenic solution, and a chromogenic stop solution.

[0019] More preferably, the labeling reagent that specifically binds to the labeling group at the 5' end of the single-stranded signal DNA is horseradish peroxidase-labeled streptavidin (SA-HRP) or digoxin antibody.

[0020] Preferably, the immobilization reagent that specifically binds to the 5' end modification group of the single-stranded anchored DNA is 1-ethyl-(3-dimethylaminopropyl)carbodiimide (EDCI) or other carboxyl-activating condensing agents, such as DCC, CMC and other carbodiimide reagents; more preferably, the use of NHS or Sulfo-NHS can further improve the crosslinking efficiency.

[0021] Preferably, the colorimetric solution is a TMB colorimetric solution.

[0022] Preferably, the buffer solution is PBS buffer or carbonate buffer.

[0023] Preferably, the elution solution is a 2×PBST solution or a 1×PBST solution.

[0024] Preferably, the colorimetric termination solution is a 2 M H2SO4 solution.

[0025] Preferably, the labeling reagent is SA-HRP.

[0026] The present invention provides a detection method for the above-mentioned kit: after cross-linking and activating single-stranded anchored DNA, it is fixed in an ELISA plate coated with BSA protein, blocked, then the sample to be tested is added and incubated, washed, then single-stranded signal DNA is added and incubated, then washed, then streptavidin-horseradish peroxidase is added, incubated and washed to remove unbound free streptavidin-horseradish peroxidase, then chromogenic solution is added, the reaction is terminated after color development, and then detection is performed.

[0027] This invention provides the technical principle of dual DNA probes: based on the sandwich recognition principle of dual DNA probes, solid-phase immobilization is achieved by covalently coupling single-stranded anchored DNA modified with a 5' carboxyl group to BSA on an enzyme-labeled plate. pre-mi RNA first binds complementary to the anchor DNA to complete target capture, and then pairs complementary with the 5' biotin-tagged single-stranded signal DNA in another region to form a stable "anchor DNA-" pair. pre-miThe RNA-signal DNA ternary complex is then utilized. Subsequently, the specific binding of SA-HRP to biotin catalyzes the color development of the TMB substrate. The absorbance value at 450 nm enables highly specific and sensitive quantitative detection of pre-miRNA. This method generates a signal only when both probes are completely complementary to the target, effectively avoiding non-specific hybridization. It is also compatible with ELISA plate platforms and has good versatility and high-throughput screening potential.

[0028] This invention also provides the above-mentioned product in the detection pre-mi Applications in RNA.

[0029] This invention also provides an in vitro non-disease diagnostic tool. pre-mi RNA detection methods utilize the aforementioned products for testing.

[0030] Preferably, the product is capable of targeting a target. pre-miR-155, pre-miR-21 and / or pre-miR-210 Perform specific detection.

[0031] More preferably, the product can [do something]. pre-mi RNA is used for qualitative and / or quantitative detection.

[0032] As a more preferred embodiment, the present invention provides for... pre-mi The method for RNA detection includes the following steps: (1) After thoroughly mixing the single-stranded anchored DNA with EDCI in PBS buffer, incubate it; (2) Add the mixed solution after incubation in step (1) to the enzyme-labeled plate coated with BSA for incubation. After incubation, wash the plate with PBST solution, then add blocking solution for blocking. After blocking, wash the plate with PBST solution to obtain an enzyme-labeled plate coupled with single-stranded anchored DNA. (3) Add the sample to be tested to the ELISA plate coupled with single-stranded anchored DNA in step (2). pre-mi Incubate RNA with PBS buffer, and wash the plate with PBST solution after incubation. (4) Add PBS buffer containing single-stranded signal DNA to the microplate from step (3) and incubate. After incubation, wash the plate with PBST solution. (5) Add SA-HRP to the microplate and wash the plate with PBST solution after incubation; (6) Add the colorimetric solution to the microplate, incubate in the dark, then add the colorimetric stop solution and measure the absorbance at a wavelength of 450 nm.

[0033] Preferably, the concentration of single-stranded anchored DNA in PBS buffer in step (1) is 2~50 nM.

[0034] Preferably, the amount of EDCI used in step (1) is 2 to 50 times the equivalent of single-stranded anchored DNA.

[0035] Preferably, the incubation temperature in step (1) is 20~30℃ and the incubation time is 10~60min.

[0036] Preferably, the blocking solution in step (2) is a skim milk powder solution or a PEG-4000 solution with a mass fraction of 0.5% to 2%.

[0037] Preferably, the blocking solution in step (2) is prepared using PBS buffer.

[0038] Preferably, the enzyme-labeled plate coated with BSA in step (2) is prepared by the following method: a BSA solution with a mass fraction of 0.5% to 2% is prepared using 50mM carbonate buffer at pH 9.0 to 9.6, the BSA solution is added to the enzyme-labeled plate, and after coating overnight at 2 to 8°C, the plate is washed 2 to 4 times with PBST solution; the amount of BSA solution added is preferably 100 to 300 μL.

[0039] Preferably, in step (2), the amount of mixed solution added is 50~200 μL and the amount of blocking solution added is 100~300 μL.

[0040] Preferably, the incubation temperature in step (2) is 35~39℃, and the incubation time is 1~3h.

[0041] Preferably, the sealing temperature in step (2) is 35~39℃ and the sealing time is 1~3h.

[0042] Preferably, in step (3) pre-mi The preferred RNA concentration is 0-1000 nM.

[0043] Preferably, the amount of pre-miRNA added in step (3) is 50~200μL.

[0044] Preferably, the incubation temperature in step (3) is 35~39℃ and the incubation time is 1~3h.

[0045] Preferably, the concentration of single-stranded signal DNA in step (4) is 2~50 nM.

[0046] Preferably, the amount of single-stranded signal DNA added in step (4) is 50~200 μL.

[0047] Preferably, the incubation temperature in step (4) is 35~39℃ and the incubation time is 1~3 h.

[0048] Preferably, in step (5), the dilution factor of SA-HRP is 5000~20000×, and the amount added is 50~200μL.

[0049] Preferably, the incubation temperature in step (5) is 20~30℃ and the incubation time is 10~60min.

[0050] Preferably, the amount of color developing solution added in step (6) is 50~200μL, and the amount of color development termination solution added is 50~200μL.

[0051] Preferably, the incubation temperature in step (6) is 20~30℃ and the incubation time is 30~90min.

[0052] Preferably, the colorimetric termination solution in step (6) is a 1-3M H2SO4 solution.

[0053] Preferably, in step (6), the absorbance is measured within 5-20 minutes after the addition of the colorimetric stop solution.

[0054] Preferably, the wavelength for measuring absorbance in step (6) is 400~500 nm.

[0055] Preferably, the PBST solution in steps (2), (3), (4) and (5) is 0.1×-2×PBST solution.

[0056] Preferably, the number of times the PBST solution is used to wash the plate in steps (2), (3), (4) and (5) is 1 to 6.

[0057] The present invention has the following beneficial effects: This invention provides a method for pre-mi The reagents, products, and detection methods for RNA detection have the following advantages: (1) Significantly improved specificity: The dual DNA probe sandwich recognition strategy is adopted, with the two probes targeting different DNA molecules. pre-miRNA Different non-overlapping regions can only form a stable complex when both are completely complementary to the target, effectively avoiding homologous sequence interference and non-specific hybridization, which is significantly better than the traditional single probe detection system.

[0058] (2) Better linear range for quantitative detection: By solid-phase anchoring and enriching target molecules, combined with enzyme-catalyzed colorimetric signal amplification, nM-level linearity can be achieved. pre-miRNA It provides precise quantification, maintains good linear correlation within the 0-1000 nM concentration range, exhibits lower background signal and narrower detection limit, and can be used for quantitative detection. pre-miRNA Its effect is superior to traditional methods such as qPCR.

[0059] (3) Simple operation and controllable cost: No complicated reverse transcription, PCR amplification or sequencing steps are required. It only relies on enzyme-labeled plates and conventional colorimetric reagents. The operation process is standardized and batch sample testing can be completed in a short time, which significantly reduces the testing cost and technical threshold, making it more suitable for clinical and laboratory promotion.

[0060] (4) High-throughput screening adaptation potential: The detection system of this invention is fully compatible with 96-well / 384-well microplates, and has the technical potential for parallel detection of multiple samples and multiple targets, which lays the foundation for subsequent... pre-miRNA It provides a feasible technological foundation and room for expansion for high-throughput applications such as drug screening and large-scale screening of clinical samples.

[0061] (5) High reliability of results: It shows highly consistent expression trends and differential characteristics with the gold standard qPCR method in a variety of cancer cells and normal cell lines, and can accurately reflect the expression of cancer cells in the sample. pre-miRNA It provides true abundance and has accuracy and stability comparable to qPCR, making it a viable alternative for rapid quantitative detection. Attached Figure Description

[0062] Figure 1 For single-stranded DNA anchoring COOH-BP-155-1, target pre-miR-155 A schematic diagram illustrating the complementary binding of the single-stranded signaling DNA BP-155-1-Biotin.

[0063] Figure 2 For the combined detection of single-stranded anchored DNA COOH-BP-155-1 and single-stranded signal DNA BP-155-1-Biotin pre-miRNA-155 OD content 450 Results analysis chart.

[0064] Figure 3 For the combined detection of single-stranded anchored DNA COOH-BP-155-2 and single-stranded signal DNA BP-155-2-Biotin pre-miRNA-155 OD content 450 Results analysis chart.

[0065] Figure 4 For the combined detection of single-stranded anchored DNA COOH-BP-155-3 and single-stranded signal DNA BP-155-3-Biotin pre-miRNA-155 OD content 450 Results analysis chart.

[0066] Figure 5The results of the screening for the optimal PBST solution concentration for plate washing are shown in the figure (A is 0.1×PBST; B is 0.2×PBST; C is 0.5×PBST; D is 0.8×PBST; E is 1×PBST; F is 2×PBST).

[0067] Figure 6 For the combined detection of single-stranded anchored DNA COOH-BP-21 and single-stranded signal DNA BP-21-Biotin pre- miRNA-21 OD content 450 Results analysis chart.

[0068] Figure 7 For the combined detection of single-stranded anchored DNA COOH-BP-210 and single-stranded signal DNA BP-210-Biotin pre- miRNA-210 OD content 450 Results analysis chart.

[0069] Figure 8 For the combined detection of single-stranded anchored DNA COOH-BP-155-3 and single-stranded signal DNA BP-155-3-Biotin pre-miRNA-21 OD content 450 Results analysis chart.

[0070] Figure 9 For the combined detection of single-stranded anchored DNA COOH-BP-155-3 and single-stranded signal DNA BP-155-3-Biotin pre-miRNA-210 OD content 450 Results analysis chart.

[0071] Figure 10 For the combined detection of single-stranded anchored DNA COOH-BP-21 and single-stranded signal DNA BP-21-Biotin pre- miRNA-155 OD content 450 Results analysis chart.

[0072] Figure 11 For the combined detection of single-stranded anchored DNA COOH-BP-21 and single-stranded signal DNA BP-21-Biotin pre- miRNA-210 OD content 450 Results analysis chart.

[0073] Figure 12 Joint detection of single-stranded anchored DNA COOH-BP-210 and single-stranded signal DNA BP-210-Biotin pre- miRNA-155 OD content 450Results analysis chart.

[0074] Figure 13 For the combined detection of single-stranded anchored DNA COOH-BP-210 and single-stranded signal DNA BP-210-Biotin pre- miRNA-21 OD content 450 Results analysis chart.

[0075] Figure 14 Co-detection of yeast with single-stranded anchored DNA COOH-BP-155-3 and single-stranded signal DNA BP-155-3-Biotin tRNA OD content 450 Results analysis chart.

[0076] Figure 15 For the combined detection of single-stranded anchored DNA COOH-BP-155-3 and single-stranded signal DNA BP-155-3-Biotin QSOX1 OD of mRNA content 450 Results analysis chart.

[0077] Figure 16 For the combined detection of single-stranded anchored DNA COOH-BP-155-3 and single-stranded signal DNA BP-155-3-Biotin c-MYC OD of mRNA content 450 Results analysis chart.

[0078] Figure 17 For the combined detection of single-stranded anchored DNA COOH-BP-155-3 and single-stranded signal DNA BP-155-3-Biotin HOTAIR OD of lncRNA content 450 Results analysis chart.

[0079] Figure 18 The method of this invention and the qPCR method are used to detect cytotoxicity in normal cells and cancer cells. pre-miRNA-155 Image showing the consistency test results for expression levels (A in the image represents OD). 450 Results; B represents the qPCR result.

[0080] Figure 19 The method of this invention and the qPCR method are used to detect cytotoxicity in normal cells and cancer cells. pre-miRNA-21 Image showing the consistency test results for expression levels (A in the image represents OD). 450 Results; B represents the qPCR result.

[0081] Figure 20 The method of this invention and the qPCR method are used to detect cytotoxicity in normal cells and cancer cells. pre-miRNA-210 Consistency test results of expression levels (A in the figure represents OD)450 Results; B represents the qPCR result. Detailed Implementation

[0082] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0083] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0084] The condensing agent used in the examples was EDCI (1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride), purchased from Maclean's; BSA, 12000×SA-HRP, TMB colorimetric solution, etc. were purchased from Beyotime; the pH of the 5×PBST, 2×PBST, 1×PBST, 0.8×PBST, 0.5×PBST, 0.2×PBST, and 0.1×PBST solutions used was 8.5; the pH of the 50mM carbonate buffer was 9.4; and the PBS solution was a common buffer in the art with a pH of 7.4.

[0085] It should be noted that the RNA sequence in the sequence listing submitted in this application contains substituted bases, with "U" replaced by "R".

[0086] Example 1: Design and Synthesis of Double-Stranded DNA because pre-miR-155, pre-miR-21, pre-miR-210 It plays a crucial regulatory role and has potential clinical diagnostic value in many major diseases, especially as a biomarker in tumors, chronic inflammation, and pregnancy-related diseases. Therefore, this embodiment first uses... pre-miR-155 (Its sequence is shown in SQE ID NO.1: 5'-UUAAUGCUAAUCGUGAUAGGGGUU2UUUGCCUCCAACUG2ACUCCUACAUAUUAGCAUUAACA-3') and its complementary strand are the targets, following the design principle: the two probes target... pre-mi Different non-overlapping regions of RNA were selected to avoid sequence complementation; hairpin structures or self-dimers were avoided; and regions with high specificity in the target sequence were preferentially selected to reduce cross-reactions of homologous sequences. Biotin labeling was performed on the 5' end of the single-stranded signal DNA sequence, and carboxylic acid group modification was performed on the 5' end of the single-stranded anchor DNA. Primer synthesis, biotin labeling, and carboxylic acid group modification were all completed by Guangzhou Aiji Biotechnology Co., Ltd.

[0087] Following the above design principles based on the target pre-miRNA was used to design and synthesize multiple single-stranded anchoring DNA strands with different sequences and complementary single-stranded signal DNA strands with different sequences. Based on preliminary screening results, it was found that when the two designed probes were compatible with the detection... pre-mi The detection effect is best when almost all bases of RNA are complementary (leaving 2-4 bases in the middle uncomplemented). Three primer pairs with better performance were selected for further verification. The nucleic acid sequences of the specific primers are shown in Table 1.

[0088] Table 1 Single-stranded anchored DNA and single-stranded signaling DNA

[0089] Example 2 pre-mi Screening for optimal RNA complementation sequences (1) Take energy and pre-miR-155 Complementary single-stranded anchored DNA (selected from COOH-BP-155-1, COOH-BP-155-2, or COOH-BP-155-3 in Table 1) were prepared into a single-stranded anchored DNA solution with a final concentration of 5 nM using PBS buffer at pH 7.4. A condensing agent EDCI (50 times the molar equivalent of the single-stranded anchored DNA) was added to the solution, and the mixture was thoroughly mixed and incubated at 25°C for 20 min to obtain an activated mixed solution. The EDCI was used to activate the carboxyl group at the 5' end of the single-stranded anchored DNA, causing it to covalently couple with the amino group of the BSA protein subsequently coated on the ELISA plate, thereby stably immobilizing the single-stranded anchored DNA on the surface of the ELISA plate.

[0090] (2) Prepare a 1% BSA coating solution using 50mM carbonate buffer as solvent; add 200μL of the BSA coating solution to each well of a 96-well microplate and incubate overnight at 4°C; after coating, wash the plate 3 times with 2×PBST washing solution, 300 μL each time, to obtain a BSA-coated microplate; add 100μL of the activation mixture obtained in step (1) to each well and incubate at 37°C for 2h to covalently couple the single-stranded anchor DNA with the BSA at the bottom of the well; after coupling, wash the plate once with 2×PBST washing solution, 300μL each time; then add 200μL of 1% skim milk powder solution (prepared with PBS buffer) to each well and block at 37°C for 1h; after blocking, wash the plate 3 times with 2×PBST washing solution, 300μL each time, for later use.

[0091] (3) Prepare PBS buffer solutions with final concentrations of 0 nM, 200 nM, 400 nM, 600 nM, 800 nM and 1000 nM. pre-miR-155Take 100 μL of the solution and add it to the corresponding well of the ELISA plate after blocking in step (2). Incubate at 37°C for 2 hours to allow pre-miR-155 to specifically bind to the single-stranded anchored DNA fixed at the bottom of the well. After incubation, wash the plate 3 times with 2×PBST washing solution, 300 μL each time. In this example, a total of 6 pre-miR-155 concentration gradient groups were set up, and 3 parallel replicate experiments were set up for each group.

[0092] (4) Prepare a single-stranded signal DNA solution with a final concentration of 5 nM using PBS buffer (selected from those in Table 1). pre-miR-155 Add 100 μL of each of the complementary BP-155-1-Biotin, BP-155-2-Biotin, or BP-155-3-Biotin to the corresponding well in step (3), and incubate at 37°C for 2 hours to allow the single-stranded signal DNA to react with the BP-155-1-Biotin, BP-155-2-Biotin, or BP-155-3-Biotin. pre-miR-155 Another region specifically binds; after incubation, wash the plate three times with 2×PBST washing solution, 300 μL each time.

[0093] (5) Add 100 μL of streptavidin-horseradish peroxidase (SA-HRP) diluted 12000× to each well and incubate at 25℃ for 20 min to allow SA-HRP to specifically bind to biotin at the end of single-stranded signal DNA. After incubation, wash the plate 6 times with 300 μL of 2×PBST washing solution each time to remove unbound free SA-HRP.

[0094] (6) Add 100 μL of TMB colorimetric solution to each well and incubate at 25°C in the dark for 60 min; then add 100 μL of 2 MH2SO4 colorimetric stop solution to terminate the reaction. Within 15 min, measure the absorbance value of each well at a wavelength of 450 nm using an ELISA reader and record the results.

[0095] Single-stranded anchored DNA and single-stranded signaling DNA and targets pre-miR-155 A diagram illustrating complementary combinations is shown below. Figure 1 As shown, by comparing the detection performance of three groups of anchored DNA of different lengths (COOH-BP-155-1, COOH-BP-155-2, COOH-BP-155-3) with their corresponding signal DNA, the results are as follows: Figures 2 - 4 As shown, the detection signal-to-noise ratio and linear range significantly improve with increasing complementary binding region length; among them, the COOH-BP-155-3 group (longest complementary length) performs best in the range of 0~1000nM. pre-miR-155 It exhibits good linear correlation within the concentration range (and can also construct a standard curve for quantitative detection), with the lowest background signal and detection limit.

[0096] This indicates that in this detection system, a longer complementary base length can enhance the binding stability of the probe and the target pre-miRNA, and improve the detection specificity and sensitivity. Therefore, the length of COOH-BP-155-3 was determined to be the optimal complementary length.

[0097] Example 3: Screening for the optimal PBST concentration for plate washing 1. Preparation of PBST solutions of different concentrations Six PBST concentration groups were designed, and 5× PBST was diluted to 2× PBST solution, 1× PBST solution, 0.8× PBST solution, 0.5× PBST solution, 0.2× PBST solution and 0.1× PBST solution, respectively.

[0098] 2. Screening for the optimal PBST concentration for plate washing Using COOH-BP-155-3 single-stranded anchored DNA and BP-155-3-Biotin single-stranded signal DNA as research subjects, and referring to the method in Example 2, the optimal PBST concentration for the entire washing process was screened. The specific method is as follows: (1) Take COOH-BP-155-3 single-stranded anchored DNA and prepare a single-stranded anchored DNA solution with a final concentration of 2 μM using PBS buffer at pH 7.4; add condensing agent EDCI (molar amount of 50 times the equivalent of single-stranded anchored DNA) to it, mix thoroughly and incubate at room temperature of 25°C for 20 min to obtain the activated mixed solution; the EDCI is used to activate the carboxyl group at the 5' end of the single-stranded anchored DNA, so that it covalently couples with the amino group of BSA protein subsequently coated on the enzyme-labeled plate, thereby stably fixing the single-stranded anchored DNA on the surface of the enzyme-labeled plate.

[0099] (2) Prepare a 1% BSA coating solution using 50mM carbonate buffer as solvent; add 200μL of the BSA coating solution to each well of a 96-well microplate and incubate overnight at 4°C; after coating, wash the plate three times with PBST washing solution of corresponding gradient concentrations, 300μL each time, to obtain a BSA-coated microplate; add 100μL of the activation mixture obtained in step (1) to each well and incubate at 37°C for 2h to covalently couple the single-stranded anchor DNA with the BSA at the bottom of the well; after coupling, wash the plate once with PBST washing solution of corresponding gradient concentrations, 300μL each time; then add 200μL of 1% skim milk powder solution (prepared with PBS buffer) to each well and block at 37°C for 1h; after blocking, wash the plate three times with PBST washing solution of corresponding gradient concentrations, 300μL each time, for later use.

[0100] (3) Prepare PBS buffer solutions with final concentrations of 0 nM, 20 nM, 40 nM, 60 nM, 80 nM, 100 nM, 200 nM, 400 nM, 600 nM, 800 nM, 1000 nM, 1200 nM, and 1400 nM. pre-miR-155 Take 100 μL of the solution and add it to the corresponding well of the ELISA plate after sealing in step (2). Incubate at 37°C for 2 hours to allow pre-miR-155 to specifically bind to the single-stranded anchored DNA fixed at the bottom of the well. After incubation, wash the plate 3 times with PBST washing buffer of the corresponding gradient concentration, 300 μL each time. In this example, a total of 6 PBST concentration gradient groups (2×, 1×, 0.8×, 0.5×, 0.2×, 0.1×) were set up, and 3 parallel replicate experiments were set up for each group.

[0101] (4) Prepare a BP-155-3-Biotin single-stranded signal DNA solution with a final concentration of 2 μM using PBS buffer. Add 100 μL of the solution to the corresponding wells in step (3) and incubate at 37°C for 2 h to allow the single-stranded signal DNA to react with the PBS buffer. pre-miR-155 Another region-specific binding; after incubation, wash the plate three times with 300 μL of PBST at the same concentration as this group.

[0102] (5) Add 100 μL of streptavidin-horseradish peroxidase (SA-HRP) diluted 12000× to each well and incubate at 25℃ for 20 min to allow SA-HRP to specifically bind to biotin at the end of single-stranded signal DNA. After incubation, wash the plate 6 times with 300 μL of PBST at the same concentration as this group to fully remove unbound free SA-HRP.

[0103] (6) Add 100 μL TMB colorimetric solution to each well and incubate at 25°C in the dark for 60 min; then add 100 μL 2 M H2SO4 colorimetric stop solution to terminate the reaction. Within 15 min, measure the absorbance value of each well at a wavelength of 450 nm using an ELISA reader and record the detection results.

[0104] The results of screening and validation using PBST washing solutions of different concentrations are as follows: Figure 5 As shown, 2×PBST is the optimal washing concentration: when using this concentration for washing, the constructed pre-miRNA detection system has the broadest detection range and can effectively cover the target. pre-mi The RNA detection system, spanning from low to high concentrations, exhibits strong signal specificity, low background interference, and good repeatability, demonstrating significantly superior overall detection performance compared to other concentration groups. Determining the optimal 2×PBST washing concentration further optimizes the stability and detection performance of the detection system, laying the foundation for subsequent... pre-miR-155, pre-miR-21 and pre-miR- 210This provides key experimental conditions to support the efficient and accurate detection, and also lays the foundation for the promotion and application of the detection method of this invention.

[0105] Example 4 Different Targets pre-mi RNA assay This embodiment is based on the optimal complementary length probe design strategy verified in Embodiment 2 and the optimal washing conditions optimized in Embodiment 3, and applies them to different... pre-mi RNA targets pre-miR-2 1 (its sequence is shown in SQE ID NO.8: UAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGU) and pre-miR- 210 The detection and verification of (its sequence as shown in SQE ID NO.9: GGAGCCCCUGCCCACCGCACACUGCGCUGCCCCAGACCCACUGUGCGUGUGACAGCGGCUGA) is carried out using the following method: First, refer to pre-miR-155 To optimize the complementary length of the probes, primers were designed to specifically complement pre-miR-21 and pre-miR-210, namely single-stranded anchoring DNA (COOH-BP-21, COOH-BP-210) and single-stranded signal DNA (BP-21-Biotin, BP-210-Biotin). The specific primer sequences are detailed in Table 2.

[0106] Table 2 Single-stranded anchored DNA and single-stranded signaling DNA

[0107] Subsequently, the optimized method of Example 3 was adopted, using the same method as in Example 3. pre-miR-155 The testing system has exactly the same operating procedures and parameter conditions, for pre-miR-21 and pre-miR-210 Primers were used for detection. Using anchor DNA and signal DNA of optimal complementary length as core functional elements, the following steps were performed sequentially: ELISA plate coating, anchor probe immobilization, target pre-miRNA incubation, and optical signal detection. In each step, the optimal washing conditions determined in Example 3 were used for plate washing. Other parameters, such as reagent concentration, incubation temperature, and time, were also kept consistent with the pre-miR-155 detection system to ensure the uniformity and comparability of experimental conditions.

[0108] The results are as follows Figure 6 and Figure 7 As shown, for pre-miR-21 and pre-miR-210Gradient concentrations from 0 to 1000 nM were detected (three parallel replicates per group). The probe, with its optimal complementary length design, was used in conjunction with optimized plate washing conditions. pre-miR-21, pre-miR-210 Both exhibited excellent detection performance comparable to pre-miR-155, and achieved good linear response in the 0-1000 nM concentration range, with stable signal and good repeatability.

[0109] In summary, the optimal complementary length and best washing conditions combination obtained by this invention have good versatility and can be efficiently applied to various applications. pre-mi Specific detection of RNA targets, for more pre-mi This provides a feasible design approach for the detection of RNA targets.

[0110] Example 5: A detection method based on double-stranded DNA probes pre-mi RNA methods Rapid detection was performed using different double-stranded DNA probes to detect the target separately. pre-miR-155 (Anchored DNA was COOH-BP-155-3, and signal DNA was BP-155-3-Biotin) pre-miR-21 (The anchoring DNA used was COOH-BP-21, and the signal DNA used was COOH-BP-210.) pre-miR-210 (The anchoring DNA was BP-21-Biotin, and the signal DNA was BP-210-Biotin).

[0111] 1. Preparation of detection reagents Prepare a single-stranded anchored DNA solution with a final concentration of 5 nM using PBS buffer at pH 7.4; add condensing agent EDCI, with a molar volume of EDCI equal to 50 times the amount of single-stranded anchored DNA, mix thoroughly, and incubate at 25°C for 20 min to obtain the activated mixed solution.

[0112] Prepare a single-stranded signal DNA solution with a final concentration of 5 nM using PBS buffer for later use.

[0113] Prepare an ELISA plate coated with BSA protein (containing 1% BSA coating solution).

[0114] 2. Testing Add 100 μL of activation mixture to the ELISA plate coated with BSA protein and incubate at 37°C for 2 h to allow single-stranded anchor DNA to covalently couple with BSA. After coupling, wash the plate once with 300 μL of 2×PBST washing buffer. Then add 200 μL of 1% skim milk powder solution (prepared with PBS buffer) to each well and block at 37°C for 1 h. After blocking, wash the plate three times with 300 μL of 2×PBST washing buffer and set aside.

[0115] Add 100 μL of the sample to be tested to the above-blocked ELISA plate and incubate at 37°C for 2 h to allow the target to specifically bind to the single-stranded anchored DNA. After incubation, wash the plate 3 times with 300 μL of 2×PBST washing buffer each time.

[0116] Add 100 μL of single-stranded signal DNA solution and incubate at 37°C for 2 h to allow the single-stranded signal DNA to specifically bind to another region of the target. After incubation, wash the plate three times with 300 μL of 2×PBST washing buffer each time.

[0117] Then add 100 μL of streptavidin-horseradish peroxidase (SA-HRP) diluted 12000× and incubate at 25°C for 20 min to allow SA-HRP to specifically bind to biotin at the end of the single-stranded signal DNA. After incubation, wash the plate 6 times with 300 μL of 2×PBST washing buffer each time to thoroughly remove unbound free SA-HRP.

[0118] Finally, add 100 μL of TMB chromogenic solution and incubate at 25°C in the dark for 60 min. Then, add 100 μL of 2 M H2SO4 chromogenic stop solution to terminate the reaction. Within 15 min, measure the absorbance value at 450 nm wavelength using an ELISA reader and record the results.

[0119] The above detection method is simple and easy to operate. The double-stranded DNA probe provided by this invention is used to detect the target... pre-miR- 155 , pre-miR-21 , pre-miR-210 The samples can be rapidly detected, potentially enabling high-throughput processing. pre-mi RNA detection.

[0120] Example 6: Specificity test for the same type of RNA To verify the specificity of the detection method of this invention, combinations of single-stranded anchor DNA and single-stranded signal DNA from Table 1 were used to cross-detect different... pre-mi RNA (using) pre-miR-155 Primer detection pre-miR-21 , pre-miR-210 ;use pre-miR-21 Primer detection pre-miR-155 , pre-miR-210 Needle; usingpre-miR-210 Primer detection pre-miR- 155 , pre-miR-21 The cross-reactivity of the system was evaluated. The steps of Example 3 described above were strictly followed to complete the enzyme-labeled plate coating, DNA fixation, target incubation, washing, and colorimetric detection. Simultaneously, the cross-reactivity of each... pre-mi RNA was set up with a gradient concentration of 0-1400 nM, and each group was set up with 3 parallel replicates. The absorbance value was measured at 450 nm and the average value was calculated.

[0121] The results are as follows Figures 8 - 13 As shown, it can be seen that each detection combination is effective in detecting non-target targets. pre-mi When RNA is present, OD 450 The values ​​remained at low levels and did not change significantly with increasing non-target RNA concentration (0-1400 nM). This result indicates that the detection method of this invention is effective against the target RNA. pre-mi RNA exhibits good sequence specificity compared to other RNA sequences. pre-mi RNA exhibits no significant cross-reactivity and can effectively distinguish between different sequences. pre-mi RNA provides a reliable guarantee of specificity for subsequent actual sample testing.

[0122] Example 7: Specificity testing for different types of RNA To verify the specificity of the detection method of the present invention for different types of RNA, the following was used: pre-miR-155 Combinations of single-stranded anchored DNA and single-stranded signal DNA (COOH-BP-155-3, BP-155-3-Biotin) were used to detect non-... pre-mi RNA-like RNA molecules: yeast tRNA, QSOX1 mRNA, c-MYC mRNA and HOTAIR lncRNA was used, and the cross-reactivity of the system was evaluated. The operation procedure in Example 3 above was strictly followed to complete the coating of enzyme-labeled plates, DNA fixation, target incubation, washing, and colorimetric detection; at the same time, a gradient concentration group of 0-1400 nM was set for each non-target RNA, and three parallel replicates were set for each group. The absorbance value was measured at 450 nm and the average value was calculated.

[0123] The results are as follows Figures 14 - 17 As shown, it can be seen that the following is adopted. pre-miR-155 The system of single-stranded anchored DNA and single-stranded signal DNA combinations and their detection methods in the detection of yeast tRNA , QSOX1 mRNA, c-MYC mRNA and HOTAIR When using different types of RNA such as lncRNA, OD 450The values ​​remained at low levels and did not change significantly with increasing concentrations of the aforementioned non-target RNA (0-1400 nM). This result indicates that the detection method of the present invention exhibits no significant cross-reactivity with different types of RNA, possesses good specificity, and can effectively eliminate interference from non-target RNA, making it suitable for complex real-world samples. pre-mi RNA precision detection provides reliable technical support.

[0124] Example 8 Verification of Method Consistency To verify Example 4 pre-mi The accuracy and reliability of RNA detection methods, with qPCR as the gold standard, are assessed for the same... pre-mi RNA samples were tested in parallel to compare the consistency of the results from the two methods.

[0125] 1. Detection based on double-stranded DNA probes pre-mi RNA methods Single-stranded anchoring DNAs were selected from COOH-BP-155-3, COOH-BP-21, and COOH-BP-210, respectively; single-stranded signal DNAs were selected from BP-155-3-Biotin, BP-21-Biotin, and BP-210-Biotin, respectively; and detection targets were pre-miR-155, pre-miR-21, and pre-miR-210. The procedures for coating the ELISA plate, immobilizing the probes, incubating the target, washing, and performing colorimetric detection were strictly followed according to the steps in Example 4. Simultaneously, for each... pre-mi RNA was set up with a gradient concentration of 0–1000 nM, and each group was set up with 3 parallel replicates. The absorbance value was measured at 450 nm and the average value was calculated.

[0126] 2. qPCR detection method ① Total RNA extraction from cells: Normal cells (normal human breast epithelial cells MCF-10A, normal human colon epithelial cells NCM460) and cancer cell samples (cervical cancer cells HeLa, breast cancer cells MDA-MB-231, pancreatic cancer cells Mia-paca-2, and lung cancer cells A549) in logarithmic growth phase from ATCC were used to extract total RNA from cells using the Trizol method: The culture medium was discarded, the cells were washed twice with pre-cooled PBS, and after complete lysis with Trizol reagent, they were transferred to RNase-free centrifuge tubes, chloroform was added and vortexed, and centrifuged at 12000 rpm for 15 min at 4℃. The upper aqueous phase was collected, an equal volume of isopropanol was added to precipitate RNA, and centrifuged at 12000 rpm for 10 min at 4℃. The supernatant was discarded, the precipitate was washed with 75% DEPC ethanol, dried and dissolved in RNase-free water, and the RNA concentration and purity (A260 / A280 ratio of 1.8-2.0) were determined by micro-spectrophotometer. The integrity was verified by agarose gel electrophoresis.

[0127] ② cDNA first strand synthesis: Using the extracted total RNA as a template, a 10 μL reverse transcription reaction system was prepared on ice using the 5×Evo M-MLV RT Master Mix kit: 2 μL of 5×Evo M-MLV RT Master Mix and an appropriate amount of total RNA sample were added, and RNase-free water was added to bring the total to 10 μL; the reverse transcription reaction was completed by incubation at 37℃ for 15 min, followed by incubation at 85℃ for 5 sec to inactivate the reverse transcriptase, and finally stored at 4℃ for later use to obtain the cDNA first strand.

[0128] ③ qPCR amplification detection: Using the 2× SYBR Green Pro Taq HS Premix kit and the ABIQuantStudio™ 5 Real-Time PCR System as the detection platform, a 20μL qPCR reaction system was prepared: 10μL of 2× SYBR Green Pro Taq HS Premix, ≤100 ng of reverse transcription product cDNA template, 0.4μL of 10μM upstream primer (final concentration 0.2μM), 0.4μL of 10μM downstream primer (final concentration 0.2μM), and 0.4μL of 4μM ROXReference Dye (final concentration 0.08μM) were added to the system, and the volume was brought up to 20μL with RNase-free water; the primer sequences used are shown in Table 3.

[0129] Table 3. Primer information for qPCR detection

[0130] qPCR amplification was performed using a two-step procedure: pre-denaturation at 95℃ for 30 sec (one cycle), followed by amplification cycles of 95℃ for 5 sec denaturation and 60℃ for 30 sec annealing extension (40 cycles in total), and then melting curve acquisition: 95℃ for 15 sec, 60℃ for 1 min, and 95℃ for 1 sec (one cycle); Ct values ​​were recorded, and a 22T / T curve was used. -ΔΔCt Normalization was performed using hGAPDH as an internal reference, and the values ​​for each concentration group were calculated. pre-mi The relative expression levels of each RNA pre-mi The RNA concentration group was tested in triplicate to ensure reliable results.

[0131] The measurement results are as follows Figures 18 - 20 As shown, the expression trends of the two detection methods are highly consistent. Using the dual DNA probe detection method and qPCR method of this invention, the expression trends of six cell lines (HeLa, MDA-MB-231, Mia-paca-2, A549, MCF-10A, and NCM460) were analyzed. pre-miR-155, pre-miR-21, pre-miR-210The expression level detection results showed a completely consistent trend: (1) The signal features were highly consistent: the OD of the method of the present invention 450 The signal intensity closely correlated with the fold change and high / low distribution characteristics of the relative expression levels (relative to hGAPDH) in qPCR across different cells, demonstrating that this method can accurately reflect the expression levels in the sample. pre-mi The true difference in RNA abundance. (2) Specificity and stability verification: Both methods can effectively distinguish between cancer cells and normal cells. pre-mi The method of the present invention exhibits RNA expression differences and stable detection results in repeated experiments, indicating that it has the same specificity and reliability as qPCR.

[0132] In summary, this invention is based on dual DNA probes. pre-mi The RNA quantification method shows high consistency with the gold standard qPCR method in various cell samples, and can accurately reflect... pre-miRNA It demonstrates good accuracy, specificity, and stability in analyzing expression levels and differential characteristics across different cell lines, and holds promise as a potential replacement for qPCR. pre-mi Rapid, high-throughput quantitative detection of RNA has important application value in basic scientific research and clinical sample screening.

[0133] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A kind pre-mi RNA detection probe, characterized in that... The probe contains single-stranded anchor DNA and single-stranded signal DNA; the single-stranded anchor DNA is one or more of the following: COOH-BP-155-3: 5'-TAATAATGTTAATGCTAATATGTAGGAGTCAGTT-3', COOH-BP-21: 5'-TAATAAACAGCCCATCGACTGGTGTTGCC-3', and COOH-BP-210: 5'-TAATAATCAGCCGCTGTCACACGCACAGTGG-3'; The single-stranded signal DNA is one or more of BP-155-3-Biotin: 5'-AGGCAAAAACCCCTATCACGATTAGCATTAATTAATT-3', BP-21-Biotin: 5'-CAACAGTCAACATCAGTCTGATAAGCTAAATT-3', and BP-210-Biotin: 5'-AGCGCAGTGTGCGGTGGGCAGGGGCTCCAATT-3'.

2. The probe according to claim 1, characterized in that, The 5' end of the single-stranded anchoring DNA is modified with a carboxylic acid group; the 3' end of the single-stranded signal DNA is labeled with biotin or digoxigenin.

3. The probe according to claim 1 or 2 in the preparation and detection pre-mi Applications of RNA in products.

4. A kind pre-mi RNA detection products, characterized in that, Includes the probe as described in claim 1 or 2.

5. The product according to claim 4, characterized in that, The product is a chemiluminescence detection kit, which also contains a colorimetric detection reagent.

6. The product according to claim 5, characterized in that, The kit also contains a labeling reagent that specifically binds to the 5' end labeling group of single-stranded signal DNA, a fixation reagent that specifically binds to the 5' end modification group of single-stranded anchored DNA, a buffer, an ELISA plate coated with BSA protein, a blocking solution, an elution solution, streptavidin-horseradish peroxidase, a chromogenic solution, and a chromogenic stop solution.

7. The product according to claim 6, characterized in that, The detection method of the kit is as follows: after cross-linking and activating the single-stranded anchored DNA, it is fixed in an ELISA plate coated with BSA protein, blocked, then the sample to be tested is added and incubated, washed, then single-stranded signal DNA is added and incubated, then washed, then streptavidin-horseradish peroxidase is added, incubated and washed to remove unbound free streptavidin-horseradish peroxidase, then chromogenic solution is added, the reaction is terminated after color development, and then detection is performed.

8. The product according to any one of claims 4 to 7 for in vitro detection purposes other than disease diagnosis and treatment. pre-mi Applications in RNA.

9. A method for purposes other than disease diagnosis pre-mi An RNA detection method, characterized in that, The product described in any one of claims 4 to 7 shall be used for testing.

10. The method according to claim 9, characterized in that, The product can target pre-miR-155, pre-miR- 21 and / or pre-miR-210 Perform specific detection.