A composition for preventing or treating inflammatory bowel disease and use thereof
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- THE FIRST AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
- Filing Date
- 2026-02-28
- Publication Date
- 2026-06-05
Smart Images

Figure CN122140776A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of inflammatory bowel disease technology, and more particularly to a composition for the prevention or treatment of inflammatory bowel disease and its use. Background Technology
[0002] Inflammatory bowel disease (IBD) mainly includes Crohn's disease (CD) and ulcerative colitis (UC). Its pathogenesis is driven by a complex interaction of genetic, microbial, environmental, and host immune factors, severely affecting the intestinal mucosal homeostasis and overall health of patients. The gut microbiota, as a key factor in regulating host intestinal immunity, is closely related to the occurrence and development of IBD when its composition and function are disordered; however, research on gut commensal fungi is still in its early stages.
[0003] The specific problems in the existing technology are as follows: 1. There is insufficient research on the specific functions of intestinal symbiotic fungi in the pathogenesis of IBD. There is a lack of methods for isolating live fungi from the mouse gut. Most of them can only be detected by sequencing, and live bacteria cannot be obtained for in vitro functional verification, which limits the research on fungal-related regulatory mechanisms; 2. The role of the C-type lectin receptor Dectin-2 / CARD9 signaling pathway in mediating the interaction between intestinal symbiotic fungi and host immunity and intestinal flora has not been elucidated, and its potential as a therapeutic target for IBD has not been explored; 3. No specific antagonistic relationship has been found between intestinal symbiotic fungi and specific strains of Lactobacillus, and the molecular mechanism by which this antagonistic relationship affects IBD through the regulation of intestinal metabolites and immune cells has not been clarified; 4. For the treatment of IBD, no targeted probiotic, metabolite or signaling pathway inhibitor therapeutic compositions and regimens have been developed based on the intestinal fungus-bacteria interaction mechanism. Summary of the Invention
[0004] In view of the above analysis, the present invention aims to provide a composition for the prevention or treatment of inflammatory bowel disease and its use, in order to solve one of the problems in the prior art: unclear understanding of the pathogenesis of inflammatory bowel disease mediated by intestinal symbiotic fungi; lack of therapeutic means targeting fungal-related signaling pathways; lack of intervention programs for inflammatory bowel disease based on the interaction of this microbiome; and difficulty of existing therapeutic drugs in regulating intestinal immune homeostasis and expanding regulatory T cells.
[0005] The first aspect of the present invention provides a composition for the prevention or treatment of inflammatory bowel disease, the composition comprising Lactobacillus johnsonii strain WXY, accession number CGMCC No. 37794.
[0006] Furthermore, the viable count of *Lactobacillus johnsonii* strain WXY in the composition is 1 × 10⁻⁶. 6 -1×10 ¹² CFU / g.
[0007] Furthermore, the Lactobacillus johnsonii WXY strain can express the glutaminase encoding gene glsA, and the Lactobacillus johnsonii WXY strain can synthesize and secrete L-glutamate through the gene glsA.
[0008] Furthermore, the composition also includes L-glutamic acid, which is either a chemically synthesized product or a microbial fermentation product, and the purity of the L-glutamic acid is ≥98%.
[0009] Furthermore, the L-glutamic acid in the composition has a mass percentage of 5% to 95%.
[0010] Furthermore, the inflammatory bowel disease includes Crohn's disease and ulcerative colitis.
[0011] Furthermore, the composition further includes one or more of the following: an anti-Dectin-2 antagonistic antibody, an antagonistic ligand of Dectin-2, a small molecule inhibitor of Dectin-2, a CARD9 antagonistic antibody, a small molecule inhibitor of CARD9, a silencing agent targeting the Clec4n / CLEC6A gene, or a TRAF6 inhibitor.
[0012] Furthermore, the composition further includes compounds that kill or inhibit fungal growth, including fluconazole, flucytosine, amphotericin B, nystatin, erythromycin, mepramycin, or itraconazole.
[0013] A second aspect of the present invention also provides the use of the above composition in the prevention or treatment of inflammatory bowel disease.
[0014] Furthermore, the applications include the preparation of drugs for the prevention or treatment of inflammatory bowel disease.
[0015] Furthermore, the drug is an oral dosage form, and it prevents or treats inflammatory bowel disease by achieving stable colonization of Lactobacillus johnsonii WXY strain in the intestine or by effectively supplementing L-glutamate in the intestine.
[0016] Furthermore, the drug includes a targeting agent, which is a reagent that inhibits the Dectin-2 / CARD9 signaling pathway; The targeting reagent includes one or more of the following: anti-Dectin-2 antagonistic antibody, antagonistic ligand of Dectin-2, small molecule inhibitor of Dectin-2, CARD9 antagonistic antibody, small molecule inhibitor of CARD9, silencing reagent targeting the Clec4n / CLEC6A gene, or TRAF6 inhibitor.
[0017] Furthermore, the composition further includes compounds that kill or inhibit fungal growth, including fluconazole, flucytosine, amphotericin B, nystatin, erythromycin, mepramycin, or itraconazole.
[0018] Furthermore, the drug includes a targeting agent, which is a probiotic strain, a metabolite, or an antimicrobial peptide modulator; wherein the probiotic strain is a Lactobacillus johnsonii WXY strain that highly expresses the glsA gene and secretes L-glutamate; the metabolite is L-glutamate; and the antimicrobial peptide modulator is a calprotectin (S100A8 / A9) inhibitor.
[0019] A third aspect of the present invention also provides the use of the above composition in the auxiliary diagnosis of inflammatory bowel disease.
[0020] Furthermore, the application includes a biomarker combination for the auxiliary diagnosis of inflammatory bowel disease, the biomarker combination comprising fungi of the genus *Pleurotus*, *Lactobacillus johnsonii*, and at least one selected from calprotectin (S100A8 / A9), Dectin-2 (CLEC6A), and L-glutamate.
[0021] Furthermore, in the application, the samples used to detect the biomarker are one or more of the subject's fecal samples, colon tissue samples, and peripheral blood samples.
[0022] Furthermore, when the sample is a fecal sample, the auxiliary diagnostic criteria for inflammatory bowel disease are as follows: the abundance of *Laminaria japonica* fungi in the subject's feces is higher than that in healthy individuals, the abundance of *Lactobacillus johnsonii* is lower than that in healthy individuals, and the L-glutamate level is lower than that in healthy individuals; when the sample is a colon tissue sample, the auxiliary diagnostic criteria for inflammatory bowel disease are as follows: the expression levels of calprotectin (S100A8 / A9) and Dectin-2 (CLEC6A) in the subject's colon tissue are higher than those in healthy individuals.
[0023] A fourth aspect of the present invention also provides a method for constructing a mouse model for research on the prevention or treatment of inflammatory bowel disease, comprising one of the following steps: A mouse model of acute colitis was established by constructing a Dectin-2 / CARD9 signaling pathway defective mouse and inducing acute colitis in drinking water using sodium dextran sulfate (DSS). After colonization of mice with fungi of the genus *Pleurotus*, an acute colitis model was established by inducing oral administration of sodium dextran sulfate (DSS). Alternatively, an acute colitis model can be established in mice after antibiotic treatment to clear bacteria and colonization with Lactobacillus johnsonii strain WXY, using sodium dextran sulfate (DSS) in drinking water.
[0024] The fifth aspect of the present invention also provides the application of the above-mentioned mouse model in screening targeted reagents for the prevention or treatment of inflammatory bowel disease.
[0025] Furthermore, the targeting reagent is a reagent that inhibits the Dectin-2 / CARD9 signaling pathway; The targeting reagent includes one or more of the following: anti-Dectin-2 antibody, CARD9 protein small molecule inhibitor, silencing reagent targeting the Clec4n / CLEC6A gene, or TRAF6 inhibitor.
[0026] Furthermore, the targeting agent is a probiotic strain, metabolite, or antimicrobial peptide modulator, wherein the probiotic strain is a Lactobacillus johnsonii WXY strain that highly expresses the glsA gene and secretes L-glutamate, and the metabolite is L-glutamate; the antimicrobial peptide modulator is a calprotectin (S100A8 / A9) inhibitor.
[0027] The inflammatory bowel disease includes Crohn's disease and ulcerative colitis, the fungus is an Ascomycota strain, and the Lactobacillus johnsonii WXY strain can express the glutaminase encoding gene glsA and secrete L-glutamate.
[0028] The sixth aspect of the present invention also provides the use of the above composition in regulating intestinal immune homeostasis, specifically, the composition is prepared for the preparation of foods, probiotic preparations, beverages, food additives or dietary supplements for maintaining intestinal immune homeostasis.
[0029] Compared with the prior art, the present invention can achieve at least one of the following beneficial effects: 1. The composition for the prevention or treatment of inflammatory bowel disease and its uses described in this invention reveal that *Lactobacillus johnsonii* strain WXY and L-glutamate are the core effective components for the prevention and treatment of inflammatory bowel disease. Both have clear mechanisms of action and can exert anti-inflammatory effects independently. *Lactobacillus johnsonii* strain WXY can stably colonize the intestine and continuously synthesize and secrete L-glutamate through high expression of the glutaminase encoding gene glsA. Exogenous L-glutamate can directly supplement the L-glutamate in the intestine. Both can enhance the interleukin-2 receptor signaling pathway and dose-dependently and efficiently amplify Foxp3. + Regulatory T cells, while inhibiting CD4 + T cells produce the pro-inflammatory factor IL-17, which enables precise regulation of intestinal immune homeostasis, effectively alleviating colonic inflammation, reducing intestinal epithelial damage and inflammatory cell infiltration, and solving the technical problem of existing treatments being unable to precisely regulate intestinal immunity and efficiently expand anti-inflammatory immune cells.
[0030] 2. The composition for the prevention or treatment of inflammatory bowel disease (IBD) and its uses described in this invention have revealed that the Dectin-2 / CARD9 signaling pathway is a core therapeutic target for IBD. Combining *Lactobacillus johnsonii* strain WXY and L-glutamate with agents that inhibit this pathway can achieve a synergistic therapeutic effect of inhibiting pro-inflammatory pathways and enhancing anti-inflammatory effects. On one hand, agents such as anti-Dectin-2 antibodies and small molecule inhibitors of CARD9 protein can block the pro-inflammatory chain reaction mediated by *Pleurotus lateralis* fungi, reduce neutrophil recruitment and calprotectin production, relieve the selective inhibition of calprotectin on *Lactobacillus johnsonii* strain WXY, and restore its intestinal colonization ability. On the other hand, *Lactobacillus johnsonii* strain WXY or L-glutamate can further enhance the intestinal anti-inflammatory level. The synergistic effect of *Lactobacillus johnsonii* strain WXY and L-glutamate with agents that inhibit this pathway significantly improves the effectiveness of IBD prevention and treatment, providing a targeted therapy design based on the intestinal fungal-bacterial interaction mechanism.
[0031] 3. The composition for the prevention or treatment of inflammatory bowel disease (IBD) and its uses described in this invention have good biocompatibility, high clinical safety, and dual preventive and therapeutic effects, making them suitable for a wide range of applications. Lactobacillus johnsonii strain WXY is a beneficial symbiotic bacterium in the gut, and L-glutamate is a natural intestinal metabolite. Both are compatible with the physiological characteristics of the intestinal microecology. Oral administration can achieve bacterial colonization or metabolite supplementation, directly targeting the core pathogenesis of IBD, avoiding excessive damage to the normal intestinal microecology, and exhibiting higher tolerability compared to traditional treatments. Simultaneously, this composition can be used for preventive intervention in high-risk groups with intestinal flora imbalance and immune homeostasis disorder, reducing the risk of IBD, and can also be used to treat IBD patients, improving disease symptoms.
[0032] Biological Preservation Information: The present invention relates to Lactobacillus johnsonii strain WXY ( Lactobacillus johnsonii WXY), deposited at the China General Microbiological Culture Collection Center (CGMCC) on February 27, 2026, at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, 100101, China, with accession number CGMCC No. 37794. Attached Figure Description
[0033] The accompanying drawings are for illustrative purposes only and are not intended to limit the invention. Throughout the drawings, the same reference numerals denote the same parts. Figure 1 This image shows the binding of mouse Decin-1-Fc and Decin-2-Fc fusion proteins to fecal symbiotic microorganisms. Figure 2Abundance distribution of Dectin-2-binding fungal species in the mouse gut; Figure 3 Figure showing the homology comparison results of ITS sequencing of fungi in the genus *Pleurotus*. Figure 4 A graph showing the changes in body weight loss rate after colonization of *Pleurotus lateralis* fungi in mice of different genotypes; Figure 5 A pathological morphological image of mouse colon tissue colonized by fungi of the genus *Pleurotus*. Figure 6 A statistical diagram showing the colon length of mice with different genotypes after colonization by *Pterygomys* fungi. Figure 6 A is a bar chart. Figure 6 B shows a comparison of actual mouse colons from four groups; Figure 7 H&E histological score statistical diagram of colon tissue after colonization by *Dendrobium* fungi in mice. Figure 7 A is a bar chart. Figure 7 B is a pathological section of mouse colon tissue; Figure 8 A statistical chart showing the proportion of immune cells in the lamina propria of the colon after colonization by *Pterygomys* fungi in mice. Figure 8 CD45 in the lamina propria of mouse colon + Ly6G in cells + CD11b + A bar chart showing the percentage of neutrophils. Figure 8 CD4 in the lamina propria of the colon of mouse B + CD25 in T cells + FoxP3 + A bar chart showing the percentage of regulatory T cells; Figure 9 Heatmap of z-score analysis of gene expression in mouse colon tissue; Figure 10 Figure showing the weight loss rate of mice colonized with *Pleurotus lateralis* fungi; Figure 11 A graph showing the changes in the disease activity index of *Pleurotus lateralis* fungi colonized in mice; Figure 12 A statistical chart showing the proportion of immune cells in the lamina propria of the colon after colonization by *Pterygomys* fungi in mice. Figure 12 A is CD45 + Ly6G in cells + CD11b + Percentage of neutrophils Figure 12 B CD25 + FoxP3 + Percentage of regulatory T cells; Figure 13 Figure showing the effect of fluconazole treatment on weight loss rate in mice of different genotypes; Figure 14 Disease activity index of mice with different genotypes treated with fluconazole; Figure 15 A statistical chart showing the colon length and histological score in fluconazole-treated mice. Figure 15 A is a picture of the colon. Figure 15 B is a diagram showing the length measurement results. Figure 15 C represents the colonic histopathological scoring results; Figure 16 Pathological section of colon tissue in mice treated with fluconazole; Figure 17 A summary chart showing the effects of fluconazole treatment on colitis-related indicators after DSS modeling in mice of different genotypes; Figure 18 A statistical chart showing the relative abundance of Lactobacillus strains in the mouse gut; Figure 19 Flowchart for the isolation and identification of Lactobacillus johnsonii WXY; Figure 20 A statistical graph showing the rate of change in body weight of mice in different treatment groups; Figure 21 A graph showing the changes in disease activity index in mice under different treatment groups; Figure 22 Figure showing the effect of Lactobacillus johnsonii WXY and mixed lactic acid bacteria on the histological score of DSS-induced colitis in mice; Figure 23 Statistical graph of colon histological scores of mice in different treatment groups; Figure 24 A graph showing the correlation between the abundance of Lactobacillus in mouse feces and the expression of S100a8 / a9 mRNA in the colon; Figure 25 The graph shows the inhibitory effect of S100A8 / A9 on the in vitro growth of Lactobacillus johnsonii WXY. Figure 26 S100A8 / A9 for rectal administration of Clec4n - / - The effect of Lactobacillus johnsonii abundance in mouse feces; Figure 27 Figure showing the effect of Lactobacillus johnsonii WXY and mixed lactic acid bacteria on the proportion of regulatory T cells in the lamina propria of the mouse colon; Figure 28 A graph showing the KEGG pathway enrichment analysis of metabolomics in the supernatant of Lactobacillus johnsonii WXY culture. Figure 29 Graph showing the detection of L-glutamic acid content in different bacterial culture systems; Figure 30 Figure showing the effect of L-glutamate treatment on body weight loss rate in DSS-induced model mice; Figure 31Figure showing the effect of L-glutamate treatment on the disease activity index in DSS-induced model mice; Figure 32 Statistical graph of colon length and histological score in DSS-induced mice treated with L-glutamate; Figure 33 The images show the histopathological morphology and histological scoring of colon tissue in DSS-induced mice treated with L-glutamate. Figure 33 Image A shows a histopathological image of mouse colon tissue stained with hematoxylin and eosin (HE). Figure 33 Image of colonic histopathological scoring results (B); Figure 34 Figure showing the effect of L-glutamate on the ratio of neutrophils and regulatory T cells in the lamina propria of the mouse colon; Figure 34 A represents neutrophils (CD11b) in the lamina propria of the colon. + Ly6G + Flow cytometry cell gating diagram, Figure 34 B represents regulatory T cells (CD4+). + CD25 + FoxP3 + Flow cytometry cell gating diagram, Figure 34 C is a bar chart showing the percentage of neutrophils. Figure 34 D is a bar chart showing the percentage of regulatory T cells; Figure 35 L-glutamate-induced CD4 + T cells convert Foxp3 + Treg differentiation detection map, Figure 35 A is a scatter plot from flow cytometry. Figure 35 B represents the statistical results of Foxp3 after treatment with different doses of L-glutamate. + CD4 + A bar chart showing the percentage of cells. Figure 36 To study the effects of different concentrations of L-glutamate on mouse naive CD4 + The effect of T cell differentiation into regulatory T cells; Figure 37 A graph showing the number of genes involved in the KEGG pathway of amino acid metabolism in Lactobacillus johnsonii (WXY). Figure 38 Figure showing the relative expression levels of the glsA gene in different Lactobacillus strains; Figure 39 A statistical chart showing the relative abundance of Dectin-2-binding fungi at the phylum and genus level in feces of healthy individuals. Figure 39 A is a bar chart showing the relative abundance percentage at the phylum level (Ascomycota, Basidiomycota, etc.). Figure 39 B is a bar chart showing the relative abundance percentage of genera (such as Beauveria bassiana); Figure 40A statistical chart showing the relative abundance of *Pleurotus lateralis* fungi in the feces of Crohn's disease patients and healthy controls. Figure 40 A is a bar chart showing the relative abundance of *Pleurotus* fungi in the feces of healthy controls and Crohn's disease patients. Figure 40 B is a bar chart showing the relative content of a certain species of *Pleurotus* in the feces of healthy control groups and Crohn's disease patients; Figure 41 This is a statistical chart showing the relative abundance of *Paecilomyces* fungi in the feces of patients with ulcerative colitis and healthy controls. Figure 41 A is a bar chart showing the relative abundance of fungi in the genus *Pleurotus*. Figure 41 B is a bar chart showing the relative content of a certain species of the genus *Pleurotus*. Figure 42 A statistical graph showing the relative expression levels of CLEC6A, S100A8, and S100A9 genes in colon tissues of Crohn's disease patients and healthy controls. Figure 42 A is a bar chart showing the relative expression level of the CLEC6A gene. Figure 42 B is a bar chart showing the relative expression levels of the S100A8 gene. Figure 42 C is a bar chart showing the relative expression level of the S100A9 gene; Figure 43 This is a statistical graph showing the effect of α-mannan stimulation on the expression of S100A8 and S100A9 cells in human neutrophils. Figure 43 A is a bar chart showing the relative expression level of the S100A8 gene. Figure 43 B is a bar chart showing the relative expression levels of the S100A9 gene; Figure 44 α-Mannan stimulation of CD11b in the human colonic lamina propria + Statistical graph showing the effect of S100A8 and S100A9 expression in cells. Figure 44 A is a bar chart showing the relative expression level of the S100A8 gene. Figure 44 B is a bar chart showing the relative expression levels of the S100A9 gene; Figure 45 L-glutamate promotes human FOXP3 in vitro + Treg differentiation detection map, Figure 45 A is a scatter plot from flow cytometry. Figure 45 B represents FOXP3 after treatment with different doses of L-glutamate. + CD4 + A bar chart showing the percentage of cells in a given cell count; Figure 46 The supernatant of Lactobacillus johnsonii WXY culture on CD4 + The influence of Il10 and Tgfb1 gene expression in T cells. Detailed Implementation
[0034] Preferred embodiments of the present invention will now be described in detail with reference to the accompanying drawings, which form part of this application and are used together with the embodiments of the present invention to illustrate the principles of the present invention, but are not intended to limit the scope of the present invention.
[0035] All human sample experiments in the following examples were approved by the Clinical Research Ethics Committee of the First Affiliated Hospital of Sun Yat-sen University (Batch Nos.: IIT-2021-654, 2019-55), and all research subjects signed written informed consent forms. Animal experiments were approved by the Laboratory Animal Management and Use Committee of Sun Yat-sen University (Batch Nos.: 2020000113, 2021001577). 8-10 week old C57BL / 6 background male mice (provided by Sankyo Laboratory Animal Services, Japan) were used in the experiments. Unless otherwise specified, all reagents used in the examples are commercially available and standard. Experimental procedures were based on the methods described in the original research paper. The corresponding figures and source information of the experimental materials / models for each example are indicated in parentheses.
[0036] Example 1: Isolation, identification, and in vivo colonization verification of gut symbiotic fungi of the genus *Pleurotus* 1.2 Experimental Materials Experimental animals: SPF-grade C57BL / 6J wild-type mice; Core reagents: mouse Dectin-1-Fc and Dectin-2-Fc fusion proteins, magnetic bead purification kit (Thermo Fisher Scientific, USA), potato dextrose agar (PDA) medium (Solepro Science & Technology Co., Ltd., Beijing), lactic acid cotton blue staining solution (Shanghai Maclean Biotechnology Co., Ltd.), fungal 28S rDNA FISH probe (Shanghai Sangon Biotech Co., Ltd.), scanning electron microscopy sample preparation reagents (Leica Camera AG, Germany). Detection reagents: Internal Transcriptional Spacer (ITS) sequencing kit (Hangzhou Lianchuan Biotechnology Co., Ltd.), 16S rDNA sequencing kit (Hangzhou Lianchuan), flow cytometry antibodies (anti-CD11b, Ly6G, CD4, CD25, Foxp3, BioLegend, USA, catalog numbers 101216, 127606, 100411, 102015, 1264003, respectively), real-time quantitative PCR primers (Il6, Tnf, S100a8, S100a9, self-developed).
[0037] 1.3 Experimental Methods Fungal isolation: Mouse Dectin-1-Fc and Dectin-2-Fc fusion proteins were constructed, bound to mouse fecal symbiotic microorganisms, purified by magnetic beads, and the species composition of the isolated fungi was analyzed by internal transcribed spacer (ITS) sequencing. Figure 1As shown; purified Dectin-2-binding microorganisms were inoculated into PDA medium and cultured at 37°C until single colonies grew. The strain species were identified by ITS sequencing, such as... Figure 3 As shown. Morphological identification: Lactol cotton blue staining was used to observe the morphology of fungal hyphae and conidia, as shown. Figure 1 As shown. Immunological and microbial assays: Flow cytometry analysis of changes in immune cell subsets in the colonic lamina propria, such as... Figure 1 As shown, real-time quantitative PCR was used to detect the expression of pro-inflammatory factors and calprotectin-related genes in colon tissue, and 16S rDNA sequencing was used to analyze changes in the gut bacterial community structure.
[0038] 1.4 Experimental Results: Using the Decin-2-Fc fusion protein, *Engyodontium* sp. fungi from the phylum Ascomycota were isolated from mouse feces. Species abundance analysis of Decin-2-binding fungi in the mouse intestine showed that Ascomycota was the dominant phylum, and *Engyodontium* sp. was the dominant genus. Figure 2 As shown; it shares 100% homology with the fungus SM14-25-6-1 of the genus *Pleurotus*. This fungus can colonize the lumen and epithelial surface of the mouse colon, forming a reticular extracellular structure, such as... Figure 1 As shown; CD11b of the lamina propria of mouse colon after colonization by *Pleurotus lateralis* fungi. + Ly6G + Neutrophilia, CD25 + FoxP3 + Decreased regulatory T cells, IL-17 + CD4 + An increase in the number of T cells, such as Figure 1 As shown, the expression of Il6, Tnf, S100a8, and S100a9 genes and their corresponding protein levels were significantly upregulated in colon tissue; the intestinal flora was significantly dysregulated, with a decrease in Firmicutes abundance and an increase in Proteobacteria abundance, and selective depletion of Lactobacillus in Firmicutes.
[0039] Example 2: *Pleurotus lateralis* fungi exacerbate DSS-induced acute colitis via the Dectin-2-CARD9 signaling pathway. 2.2 Experimental Materials Experimental animals: C57BL / 6J wild-type mice, Clec4n - / - (Dectin-2 deficient) mice, Card9 - / - (CARD9 deficient) mice, (Clec4n) - / - and Card9 - / -Mice were constructed using CRISPR-Cpf1 technology by the Animal Disease Model Center of the Institute of Biomedical Science, Tokyo University of Science; core reagents: 1.5% sodium dextran sulfate (DSS, MP Biomedicals, France, catalog number: 9011-18-1), TRAF6 inhibitor, fluconazole (antifungal drug), α-mannan (Sigma-Aldrich, USA, catalog number: 9036-88-8); detection reagents: flow cytometry antibody (anti-IL-17A, BioLegend, USA, catalog number: 506918), real-time quantitative PCR primers ( Clec4n , Il10 , Tgfb1 , FoxP3 ), Calprotectin Assay Kit (MCE, USA, catalog number: HY-P71076).
[0040] 2.3 Experimental Methods DSS colitis model establishment: Wild-type mice were colonized with *Pleurotus lateralis* fungi and given 1.5% DSS in their drinking water for 7 days to establish an acute colitis model. The role of TRAF6 inhibitor intervention in neutrophil recruitment was verified. Figure 4 As shown. Validation in gene-deficient mice: Clec4n was tested separately. - / - Card9 - / - Mice were colonized with *Pleurotus lateralis* fungi and subjected to DSS (Diverticulum Spectrostomy) modeling. Wild-type mice served as controls. The severity of colitis and the histopathological score of colon tissue were assessed in the mice. Figure 5 , Figure 6 , Figure 7 , Figure 10 and Figure 11 As shown. Immune cell and gene detection: Flow cytometry analysis was used to analyze changes in neutrophils, regulatory T cells, and Th17 cell subsets in the lamina propria of the colon in each group of mice, such as... Figure 8 and Figure 11 As shown, real-time quantitative PCR was used to detect the expression levels of pro-inflammatory factors, anti-inflammatory factors, and calprotectin-related genes in colon tissue. Figure 9 As shown; Fungal clearance experiment: After clearing endogenous intestinal fungi in mice with fluconazole, three doses of 5×10 were administered by gavage. 8 CFU of *Cyclocarya* fungi was used to verify the retention capacity and abundance changes of fungi in the mouse intestine; CFU was used to evaluate wild-type and Clec4n fungi. - / - Card9 - / - Mice were induced to develop a colitis model via DSS after fluconazole treatment, and colitis-related markers were detected, such as... Figure 17 , Figure 13 , Figure 14 , Figure 15As shown; Calcavirin induction verification: Bone marrow-derived neutrophils were stimulated with the Decin-2 agonist α-mannan to verify its induction effect on calavirin expression, as shown. Figure 16 As shown.
[0041] 2.4 Experimental Results: Colonization by *Pleurotus* fungi alone could not induce colitis, but it significantly aggravated DSS-induced weight loss, diarrhea, bloody stools, and colonic shortening in mice. TRAF6 inhibitors could completely block this effect. Figure 4 As shown; Clec4n - / - Card9 - / - Mice were protected from exacerbations of colitis mediated by *Pleurotus lateralis* fungi, with significantly reduced colonic tissue inflammation and immune cell infiltration, decreased proportion of neutrophils and increased proportion of regulatory T cells in the colonic lamina propria, such as... Figure 12 As shown; the expression of pro-inflammatory factors is suppressed, while the expression of anti-inflammatory genes such as Il10, Tgfb1, and Foxp3 is upregulated. Figure 5 , Figure 6 , Figure 7 , Figure 10 , Figure 11 As shown; after fluconazole cleared the fungus, the severity of DSS-induced colitis in wild-type mice was significantly reduced, while that induced by Clec4n was significantly reduced. - / - Card9 - / - Mice showed no additional protective effect, confirming that fungal exacerbation of colitis depends on the Dectin-2-CARD9 signaling pathway, such as... Figure 17 , Figure 13 , Figure 14 , Figure 15 As shown; fungi of the genus *Pleurotus* can continuously activate neutrophils through the Dectin-2-CARD9 pathway, inducing the production of calprotectin (S100A8 / A9), such as... Figure 16 As shown.
[0042] Example 3: Isolation, identification, and verification of the protective effect against colitis against Lactobacillus johnsonii WXY 3.1 Experimental Materials Experimental animals: C57BL / 6J wild-type mice, Clec4n - / - Mice, Card9 - / -Mice (Animal Disease Model Center, Institute of Biomedical Science, Tokyo University of Science); Core reagents: Antibiotic cocktail (400 mg kanamycin, 35 mg gentamicin, 57 mg colistin, 215 mg metronidazole, 45 mg vancomycin, and 10 mg erythromycin added to 1 L of drinking water, Shanghai Maclean Biotechnology Co., Ltd.), MRS agar medium containing 50 μg / mL neomycin, MRS liquid medium (Beijing Solarbio Science & Technology Co., Ltd.); Detection reagents: 16S rDNA amplification primers (forward: TGGAAACAGRTGCTAATACCG; reverse: GTCCATTGTGGAAGATTCCC), whole genome sequencing kit (Shenzhen BGI Genomics), KEGG pathway analysis kit (Shanghai OY Biotechnology Co., Ltd.), L-glutamate detection kit (Thermo Fisher Scientific, USA).
[0043] 3.2 Experimental Methods Strain isolation: Take Clec4n - / - Mouse fecal samples were inoculated onto MRS agar medium containing neomycin and anaerobically cultured at 37°C for 2 days. Single colonies were picked and expanded, and genomic DNA was extracted from the strains. 16S rDNA PCR amplification and sequencing were used to identify the strain species. Figure 18 As shown; Validation of the protective effect of the strain: Wild-type mice treated with antibiotics were colonized with Lactobacillus johnsonii WXY strain and modeled by DSS. PBS and Escherichia coli control groups were set up. Changes in mouse body weight, disease activity index (DAI), colon length, histopathological damage, and Foxp3 in the colonic lamina propria were measured. + Changes in regulatory T cells, such as Figure 19 , Figure 20 , Figure 21 , Figure 23 , Figure 26 As shown; Metabolite-mediated validation: Supernatant of *Lactobacillus johnsonii* WXY culture was prepared, and its anti-inflammatory effect was validated using DSS modeling. Metabolomics analysis was performed on the metabolite profiles of the supernatant and the colonized mouse intestines, as shown in the figure. Figure 27 , Figure 28 As shown.
[0044] 3.3 Experimental Results: From Clec4n - / - A dominant lactobacillus strain was isolated from mouse feces and identified as *Lactobacillus johnsonii* by 16S rDNA sequencing. It was named *Lactobacillus johnsonii* WXY. Figure 18 As shown; mice colonized with Lactobacillus johnsonii WXY showed a significant reduction in the severity of DSS-induced colitis, and Foxp3 in the colonic lamina propria. + The number of regulatory T cells increased significantly, such as Figure 19 , Figure 20 , Figure 21 , Figure 23 , Figure 26 As shown; the anti-inflammatory effect of *Lactobacillus johnsonii* WXY is mediated by its secreted metabolites, and the calprotectin (S100A8 / A9) induced by *Pleurotus lateralis* fungi can directly inhibit the growth of *Lactobacillus johnsonii* WXY in vitro, such as... Figure 25 As shown; the culture supernatant significantly alleviated colitis, and metabolomics analysis revealed enrichment of intestinal amino acid-related pathways, such as... Figure 28 As shown.
[0045] Example 4: Verification of the mechanism by which L-glutamate amplifies Tregs by enhancing the IL-2 receptor signaling pathway 4.1 Experimental Materials Experimental animals: C57BL / 6J wild-type mice, Clec4n - / - Mice; Core reagents: L-glutamic acid (99% purity, Shanghai Aladdin Biochemical Technology Co., Ltd.), stachydrine (Shanghai Maclean), anti-CD25 antibody (BioLegend, USA, catalog number: 102015); Detection reagents: flow cytometry antibody (anti-IFN-γ, BioLegend, USA, catalog number: 505806), real-time quantitative PCR primers (Il2ra, Il17a, self-developed).
[0046] 4.2 Experimental Methods In vivo anti-inflammatory validation of L-glutamate: A DSS model was established in mice after rectal administration of L-glutamate, and changes in colitis markers and immune cells were detected, such as... Figure 30 , Figure 31 , Figure 32 and Figure 33 As shown; IL-2 receptor pathway verification: Clec4n - / - Mice were induced to develop colitis by DSS after administration of anti-CD25 antibody, and colitis markers and Treg counts were detected.
[0047] 4.3 Experimental Results: L-glutamate significantly alleviated DSS colitis, reduced neutrophil infiltration, and increased Foxp3 levels. + The number of Tregs, and the dose-dependent promotion of in vitro CD4 + T cells differentiate into Tregs, such as Figure 35 and Figure 36 As shown; L-glutamate upregulates Il2ra (CD25) expression, enhances the IL-2 receptor signaling pathway, and inhibits IL-17 production, such as Figure 34 As shown; anti-CD25 antibody can completely eliminate Clec4n - / - The number of Tregs was significantly reduced in mice to increase their resistance to colitis.
[0048] Example 5: Verification of the mechanism by which Lactobacillus johnsonii WXY regulates regulatory T cells via the glsA gene-mediated L-glutamate pathway. 5.1 Experimental Materials Experimental animals: C57BL / 6J wild-type mice, Clec4n - / - Mice (Animal Disease Model Center, Institute of Biomedical Science, Tokyo University of Science); Core reagents: L-glutamate, stachydrine reagent, anti-CD25 antibody (BioLegend, USA), Lactobacillus johnsonii WXY, NBRC13952, and Lactobacillus gasseri LG21 strains (in-house developed).
[0049] 5.2 Experimental Methods In vivo anti-inflammatory validation of L-glutamate: Wild-type mice were induced to develop a colitis model by DSS administration of L-glutamate to the rectum. Control groups were set up with stachydrine and PBS. Colitis-related indicators and changes in immune cells of the colonic lamina propria were detected. Figure 30 , Figure 31 , Figure 32 , Figure 33 As shown; In vitro immunomodulatory validation of L-glutamate: In vitro cultured CD4 + T cells were treated with different doses of L-glutamate, and Foxp3 was detected by flow cytometry. + Regulatory T cell differentiation ratio, and related gene expression detected by real-time quantitative PCR, such as... Figure 31 , Figure 33 , Figure 34 As shown; to verify the regulatory effect of L-glutamate on IL-2 receptor (CD25) expression and its influence on IL-17 and IFN-γ production, as shown. Figure 32 As shown; Validation of the molecular mechanism of glutamate production: Whole-genome sequencing and KEGG pathway analysis were performed on *Lactobacillus johnsonii* WXY to verify the enrichment characteristics of the glutamate metabolic pathway; The expression of the glsA gene and the L-glutamate production capacity of different *Lactobacillus* strains were detected, such as... Figure 29 , Figure 38 As shown; IL-2 receptor pathway validation: for Clec4n - / - Mice were treated with anti-CD25 antibody and then subjected to DSS modeling. Colitis-related indicators and changes in the number of regulatory T cells were detected.
[0050] 5.3 Experimental Results L-glutamate can significantly alleviate DSS-induced colitis, reduce colonic neutrophil infiltration, and increase Foxp3 levels. + The number of regulatory T cells was increased, and CD4+ was promoted in vitro in a dose-dependent manner. + T cells convert Foxp3 +Regulatory T cell differentiation, such as Figure 28 , Figure 29 , Figure 22 , Figure 30 , Figure 31 , Figure 33 , Figure 34 As shown; L-glutamate can upregulate Il2ra (CD25) expression, enhance the IL-2 receptor signaling pathway, and inhibit CD4. + T cells produce IL-17, which has no significant effect on IFN-γ, consistent with the STAT5-STAT3 competitive regulatory mechanism. Figure 32 As shown, *Lactobacillus johnsonii* WXY exhibits a significantly enriched glutamate metabolism pathway, converting L-glutamine to L-glutamate through high expression of the glutaminase-encoding gene glsA. Its glutamate production capacity is significantly higher than that of *Lactobacillus gasseri* LG21. Figure 29 , Figure 37 and Figure 38 As shown; anti-CD25 antibody can completely eliminate Clec4n - / - The resistance of mice to colitis confirms that the L-glutamate-driven IL-2 receptor signaling pathway is key to regulatory T cell-mediated protection against colitis.
[0051] Example 6: Conservation of the Dectin-2 axis in *Dectin* fungi in human IBD samples 6.1 Experimental Materials Human samples: fecal and colon tissue samples from 65 patients with CD, 25 patients with UC, and 95 healthy controls (The First Affiliated Hospital of Sun Yat-sen University); Core reagents: Dectin-2-Fc fusion protein (self-developed), α-mannan (Sigma-Aldrich, catalog number: 9036-88-8); Detection reagents: human peripheral blood CD4 + T-cell isolation kit (StemCell Technologies, USA), flow cytometry antibodies (anti-human CD4, CD25, FOXP3, BioLegend, USA), immunohistochemistry reagents (anti-human Dectin-2, S100A8, S100A9, Jiangsu Aibixin, catalog numbers: DF10182, DF6556, DF7596), LC-MS / MS metabolomics analysis reagents (Agilent Technologies, USA).
[0052] 6.2 Experimental Methods Fungal and strain abundance detection: Dectin-2-binding fungi were isolated from the feces of healthy individuals using the Dectin-2-Fc fusion protein, and analyzed by ITS sequencing, such as... Figure 37 As shown; Real-time quantitative PCR was used to detect the abundance and correlation of *Pleurotus lateralis* fungi and *Lactobacillus johnsonii*, as shown. Figure 40 , Figure 41 , Figure 45 As shown. Gene and protein expression detection: Whole transcriptome RNA sequencing was used to detect the expression of CLEC6A and S100A8 / A9 in colon tissue, as shown. Figure 38 , Figure 39 , Figure 45 As shown, immunohistochemistry verified the co-localization of Dectin-2 and calprotectin, as follows. Figure 43 As shown; α-Mannan stimulates human neutrophils, and the production of calprotectin is detected, such as... Figure 41 , Figure 42 As shown. Metabolite and immune cell validation: LC-MS / MS was used to detect fecal L-glutamate levels and analyze their correlation with Lactobacillus johnsonii abundance, such as... Figure 44 As shown; in vitro verification of the effect of L-glutamate on human FOXP3 + The promoting effect of Treg differentiation.
[0053] 6.3 Experimental Results: In the feces of healthy individuals, the dominant genera of the Dectin-2 fused fungi were *Pleurotus*, such as... Figure 37 As shown; the abundance of *Laminaria japonica* fungi in the feces of patients with CD and UC was significantly increased (CD increased 18-fold), while the abundance of *Lactobacillus johnsonii* was significantly decreased (CD decreased 23-fold), and the two were negatively correlated. Figure 40 , Figure 41 As shown; the expression of CLEC6A and S100A8 / A9 was elevated in the patient's colon tissue, and DECTIN-2 co-localized with calprotectin, as shown. Figure 40 , Figure 43 As shown; patients' fecal L-glutamate levels were decreased and positively correlated with Lactobacillus johnsonii abundance. L-glutamate can promote human FOXP3. + Treg differentiation, such as Figure 44 As shown.
[0054] Example 7: Preparation of a composition based on Lactobacillus johnsonii WXY / L-glutamic acid 7.1 Experimental Materials Core ingredient: Logarithmic growth phase Lactobacillus johnsonii WXY bacterial culture (live count ≥ 1 × 10¹) 0 CFU / mL), L-glutamic acid powder (purity ≥99%, pharmaceutical grade, Shanghai Aladdin); Prebiotics and excipients: fructooligosaccharides, inulin, galactooligosaccharides (purity ≥95%, prebiotics), microcrystalline cellulose, mannitol, sodium carboxymethyl starch, magnesium stearate (pharmaceutical grade, Anhui Shanhe Pharmaceutical Excipients Co., Ltd.), gelatin capsule shells (Jiangsu Chenxing Pharmaceutical Co., Ltd.), freeze-drying protectant (10% skim milk + 5% mannitol, self-developed); Test reagents: Live bacteria count test kit (Beijing Luqiao Technology Co., Ltd.), L-glutamic acid content test kit (Thermo Fisher Scientific, USA) 7.2 Experimental Methods 7.2.1 Preparation of live Lactobacillus johnsonii WXY preparation Live bacteria powder: Centrifuge the logarithmic growth phase Lactobacillus johnsonii WXY bacterial suspension (8000 rpm, 10 min, 4℃), collect the bacterial cells, wash twice with sterile PBS, and resuspend in sterile lyophilization protectant; vacuum freeze-dry to prepare bacterial powder (viable count ≥ 1 × 10¹¹ CFU / g); mix the bacterial powder with fructooligosaccharides at a mass ratio of 1:1, grind thoroughly and evenly, and dispense to obtain live bacteria powder, controlling the viable count of the finished product to be 1 × 10¹¹ CFU / g. 9 ~1×10¹ 0 CFU / g. Live bacteria capsules: Mix the above-mentioned freeze-dried bacterial powder with inulin at a mass ratio of 2:1, add an appropriate amount of microcrystalline cellulose as a filler, and mix evenly; quantitatively fill the mixture into gelatin capsule shells, each capsule containing 0.1g of bacterial powder, with a live bacteria count ≥1×10⁻⁶. 9 CFU / granule compound prebiotic granules: Freeze-dried bacterial powder, galactooligosaccharides, and maltodextrin are mixed in a mass ratio of 1:3:2, and an appropriate amount of purified water is added to form a soft mass, which is then granulated through a 20-mesh sieve. The wet granules are dried at 60℃ until the moisture content is ≤5%, granulated, and packaged. The viable count of the finished product is ≥5×10⁻⁶. 8 CFU / g.
[0055] 7.2.2 Preparation of L-Glutamic Acid Composition Oral powder: Mix L-glutamic acid powder and inulin at a mass ratio of 7:3, grind thoroughly until the particle size is ≤100 mesh; after mixing evenly, package into 5g packets, each containing 3.5g of L-glutamic acid. Tablets: Weigh L-glutamic acid powder, microcrystalline cellulose, and sodium carboxymethyl starch and mix at a mass ratio of 8:1:1, add an appropriate amount of purified water to form a soft mass, granulate through a 20-mesh sieve; dry the wet granules at 55℃ with forced air until the moisture content is ≤3%, granulate, add 0.5% magnesium stearate, mix evenly, and compress into tablets; control each tablet to weigh 0.5g, containing 0.4g of L-glutamic acid. Oral solution: Take 800mL of purified water, heat to 50℃, add 50g of L-glutamic acid and 100g of oligofructose, and stir until completely dissolved; after cooling to room temperature, add purified water to make up to 1000mL, adjust the pH to 6.0~7.0, filter through a 0.22μm microporous membrane for sterilization; aseptically dispense into oral solution bottles, each bottle containing 10mL and 0.5g of L-glutamic acid.
[0056] 7.3 Experimental Results: The prepared Lactobacillus johnsonii WXY live bacteria powder, capsules, and granules were all uniform in appearance, without clumping, and had good flowability. After being stored at 4℃ in a sealed container for 3 months, the survival rate of live bacteria was still ≥80%. The combination of prebiotics and bacterial powder did not affect the activity of the strains and could promote their intestinal colonization. The prepared L-glutamic acid powder, tablets, and oral liquid all met the basic requirements for pharmaceutical dosage forms, with good solubility and disintegration (tablet disintegration time ≤15min). After being stored at room temperature in a sealed container for 3 months, the content did not change significantly, and related substances were ≤0.5%. The addition of prebiotics could improve the taste of L-glutamic acid and synergistically regulate the intestinal microecology.
[0057] Example 8: Validation of the efficacy of a single-component composition against DSS-induced acute colitis. 8.1 Experimental Materials: Experimental Animals: 40 SPF-grade C57BL / 6J wild-type mice; Core Reagent: Lactobacillus johnsonii WXY live bacteria capsules (1×10⁻⁶) prepared in Example 7. 9 CFU / capsule), L-glutamic acid tablets (0.4g / tablet), 1.5% DSS (MP Biomedicals, France, catalog number: 9011-18-1), sterile PBS; diagnostic reagents: Disease Activity Index (DAI) scoring criteria, colon tissue pathology section preparation reagent, flow cytometry detection antibodies (anti-CD4, CD25, Foxp3, BioLegend, USA), real-time quantitative PCR primers (Il6, Tnf, S100a8, S100a9).
[0058] 8.2 Experimental Methods Experimental Grouping: Forty mice were randomly divided into four groups of ten each: blank control group (normal diet and water, no modeling, administered PBS by gavage), model control group (DSS modeling, administered PBS by gavage), WXY group (DSS modeling, administered Lactobacillus johnsonii WXY live bacteria capsules by gavage), and L-glutamate group (DSS modeling, administered L-glutamate tablets by gavage). Modeling and Drug Administration: The model group and the drug administration group were given 1.5% DSS in their drinking water for 7 days, followed by normal drinking water for 2 days to establish an acute colitis model. Drug administration was performed by gavage once daily at a volume of 0.2 mL / day. Mice weighing 10g were administered medication starting from day 1 of modeling and continuing for 9 days. The WXY group received one capsule's contents each time, the L-glutamate group received 0.25 tablets (containing 0.1g of L-glutamate) each time, and the blank control and model control groups received an equal volume of sterile PBS by gavage. Daily monitoring included changes in body weight, fecal characteristics, and fecal hemorrhage, and calculation of daily diastolic acid (DAI). All mice were sacrificed on day 9 of modeling, and colon length was measured. Mid-colon tissue was collected for pathological sections, stained with hematoxylin and eosin (HE), and histopathologically scored. Flow cytometry was used to detect Foxp3 in the colonic lamina propria. +The proportion of regulatory T cells (Tregs); the expression levels of pro-inflammatory factors and calprotectin-related genes in colon tissue were detected by real-time quantitative PCR.
[0059] 8.3 Experimental Results: DAI and body weight changes: In the blank control group, mice showed stable weight gain and a DAI of 0; in the model control group, mice showed significant weight loss and a peak DAI score ≥6; in the WXY and L-glutamate groups, the weight loss was significantly reduced, and the peak DAI score was ≤3, showing highly significant differences compared to the model control group (P<0.01); Colon length and pathological damage: In the model control group, colon length was ≤7cm and pathological score was ≥7; in the WXY and L-glutamate groups, colon length recovered to over 8cm, pathological score was ≤3, colonic epithelial damage was mild, and inflammatory infiltration was limited to the area around the crypts, showing highly significant differences compared to the model control group (P<0.01); Immune cells and gene expression: In the model control group, Foxp3 in the lamina propria of the colon... + The proportion of Treg cells was less than 5%, but increased to more than 12% in the WXY group and L-glutamate group (P<0.01). Compared with the model control group, the gene expression levels of Il6, Tnf, S100a8 and S100a9 in the colon tissue of the WXY group and L-glutamate group were significantly downregulated (P<0.01).
[0060] Example 9: Synergistic efficacy verification of the composition in combination with a Dectin-2 / CARD9 pathway inhibitor 9.1 Experimental Materials Experimental animals: 30 SPF-grade C57BL / 6J wild-type mice.
[0061] 9.2 Experimental Methods Experimental grouping: Thirty mice were randomly divided into three groups of 10 each: single-drug group (DSS modeling + Lactobacillus johnsonii WXY live bacteria capsules by gavage), combination group 1 (DSS modeling + Lactobacillus johnsonii WXY live bacteria capsules + anti-Dectin-2 antibody intraperitoneal injection), and combination group 2 (DSS modeling + L-glutamate tablets + TRAF6 inhibitor by gavage). Dosage regimen: Lactobacillus johnsonii WXY and L-glutamate were administered at the same dosages as in Example 8; anti-Dectin-2 antibody was administered intraperitoneally at 100 μg / mouse / day; TRAF6 inhibitor was administered by gavage at 50 mg / kg body weight once daily. All medications were administered starting from day 1 of modeling and continued for 9 consecutive days. Indicator detection: Daily DAI and body weight changes were recorded. Mice were sacrificed on day 9 of modeling, and colon length, histopathological score, and Foxp3 levels were measured. + The proportion of Treg cells, the expression levels of pro-inflammatory factors and calprotectin genes were measured; the abundance of Lactobacillus johnsonii and the level of L-glutamate in mouse feces were also detected.
[0062] 9.3 Experimental Results Synergistic anti-inflammatory effect: The peak DAI score of both combination groups 1 and 2 was ≤1.5, significantly lower than that of the single-drug group (≤3); the colon length was 9.8±0.5cm and 9.5±0.6cm, respectively, and the histopathological scores were 1.2±0.3 and 1.5±0.4, respectively, both significantly better than those of the single-drug group (P<0.05). Immune cell regulation: Foxp3 in combination groups 1 and 2... + The proportions of Treg cells reached 15.8±1.5% and 14.6±1.3%, respectively, which were higher than those in the single-drug group. The expression levels of pro-inflammatory factors and calprotectin genes were significantly downregulated (P<0.05). Microbiome and metabolite regulation: The abundance of *Lactobacillus johnsonii* in the feces of mice in the combination group was ≥2-fold higher than that in the single-drug group, and the L-glutamate level was significantly increased and returned to normal mouse levels, confirming that the pathway inhibitor could relieve the inhibition of *Lactobacillus johnsonii* by calprotectin, promoting its colonization and L-glutamate production.
[0063] Example 10: Stability and in vivo safety verification of the composition 10.1 Experimental Materials: Experimental Animals: 50 SPF-grade ICR mice (half male and half female, commercially available); Core Reagents: Various dosage form compositions prepared in Example 7 (Lactobacillus johnsonii WXY live bacteria preparation, L-glutamic acid composition); Detection Reagents: Live Bacteria Count Detection Kit, L-Glutamic Acid Content Detection Kit, Complete Blood Count and Blood Biochemistry Detection Kits (ALT, AST, BUN, Cr, etc.), Reagents for Preparing Pathological Sections of Mouse Heart, Liver, Spleen, Lung, Kidney, and Colon Tissues.
[0064] 10.2 Experimental Methods 10.2.1 Stability verification: The compositions of each dosage form were stored at 4℃, 25℃ (relative humidity 60%±5%), and 37℃ (relative humidity 75%±5%), and samples were taken for testing at 0, 1, 3, and 6 months. The viable count and survival rate of the live bacteria preparation were tested, and the L-glutamic acid content and related substances of the L-glutamic acid preparation were tested to evaluate the storage stability of each dosage form.
[0065] 10.2.2 In vivo safety verification Experimental grouping: Fifty ICR mice were randomly divided into 5 groups of 10 mice each: blank control group (administered PBS by gavage), low / high dose WXY group (administered Lactobacillus johnsonii WXY powder by gavage, 1×10⁻⁶). 8 1×10¹ 0(CFU / kg body weight) and low / high dose groups of L-glutamic acid (administered L-glutamic acid, 500 and 2000 mg / kg body weight by gavage); Administration and observation: administered once daily by gavage for 30 consecutive days, during which the general condition, diet, water intake, and weight changes of mice were observed; Indicator detection: after administration, mice were sacrificed, and blood routine and blood biochemical indicators were detected; heart, liver, spleen, lung, kidney, and colon tissues of mice were taken to prepare pathological sections, stained with hematoxylin and eosin (HE), and the histomorphological changes were observed.
[0066] 10.3 Experimental Results: Stability: After storage at 4℃ for 6 months, the viable bacterial count of the live bacterial preparation was ≥70%, the content of L-glutamic acid showed no significant change, and related substances were ≤0.5%; after storage at 25℃ for 3 months, all indicators met the pharmaceutical requirements and demonstrated good storage stability; after storage at 37℃ for 1 month, no significant changes were observed, meeting the requirements for transportation and short-term storage; Safety: Mice in all treatment groups were in good general condition during the administration period, with normal diet and water intake, stable weight gain, and no obvious abnormal reactions; blood routine and blood biochemical indicators were all within the normal range, and there was no obvious damage to the pathological sections of various organs and colon tissues, and no inflammatory reaction in the colonic mucosa, confirming that the composition of the present invention has no obvious toxicity within the experimental dosage range, good biocompatibility, and high safety for in vivo application.
[0067] Example 11: Application of Lactobacillus johnsonii WXY in maintaining intestinal immune homeostasis 11.1 Experimental Materials The *Lactobacillus johnsonii* WXY strain prepared in Example 3 was freeze-dried for later use. The health food matrix consisted of unsweetened yogurt base, whole wheat bread flour, and a solid beverage base (fructooligosaccharides + maltodextrin, mass ratio 1:1), all of which met food production hygiene standards and were free of antibacterial components.
[0068] Experimental animals: 40 male SPF-grade C57BL / 6J wild-type mice, aged 8-10 weeks, were housed in the SPF environment facility of Sun Yat-sen University. They were provided with gamma-ray irradiated feed, acidified water (0.002N HCl, pH 2.5), and autoclaved bedding. The experiment was approved by the Experimental Animal Management and Use Committee of Sun Yat-sen University (approval number: 2021001577).
[0069] 11.2 Experimental Methods (I) Preparation of health foods containing Lactobacillus johnsonii WXY Probiotic yogurt: Add Lactobacillus johnsonii WXY freeze-dried starter culture powder at a ratio of 1×10 9 Add CFU / 100g to the sterilized and cooled yogurt base, ferment at 37℃ for 4 hours, store at 4℃, and check for viable bacteria count ≥8×10⁻⁶. 8CFU / 100g. Probiotic solid beverage: Lactobacillus johnsonii WXY bacterial powder is mixed with a solid beverage base at a mass ratio of 1:5, ground evenly, and packaged into 5g / bags. The viable count of the finished product is ≥1×10⁻⁶. 8 CFU / bag
[0070] (II) Experimental Grouping and Intervention Program Forty mice were randomly divided into four groups of 10 each, with an intervention period of four weeks: blank control group: normal diet and water, without probiotics; regular yogurt control group: given regular unsweetened yogurt (1 mL / 10 g body weight) daily; probiotic yogurt group: given probiotic yogurt containing Lactobacillus johnsonii WXY (1 mL / 10 g body weight) daily; probiotic solid beverage group: given probiotic solid beverage dissolved in sterile water by gavage daily (1 mL / 10 g body weight, with the same bacterial count as the yogurt group).
[0071] 11.3 Experimental Results Effects on gut microbiota regulation: The relative abundance of Lactobacillus in the feces of mice in the probiotic yogurt group and the solid beverage group was ≥20 times higher than that in the blank control group (P<0.01), the Shannon diversity index of the microbiota was significantly improved (P<0.05), and the Firmicutes / Bacteroidetes ratio was maintained in the healthy range of 1.2~1.5. There was no significant change in the ordinary yogurt control group.
[0072] Increased L-glutamate levels: The L-glutamate content in the cecal contents of mice in the probiotic intervention group reached (125.6±15.8) μg / g, which was about 3 times higher than that in the blank control group (41.2±8.5) μg / g (P<0.01), consistent with the mechanism of Lactobacillus johnsonii WXY secreting L-glutamate through the glsA gene.
[0073] The proportion of Treg increases: such as Figure 35 As shown, flow cytometry analysis revealed that CD4+ in the lamina propria of the colon in the probiotic yogurt group... + CD25 in T cells + FoxP3 + The proportion of Tregs reached (18.2±2.3)%, which was approximately 1.1 times higher than that of the blank control group (8.5±1.6)% (P<0.01). Figure 46 The results of Treg differentiation induced by the supernatant of Lactobacillus johnsonii WXY culture shown are consistent. Figure 36 As shown, L-glutamate, a metabolite of Lactobacillus johnsonii WXY, can significantly upregulate CD62L. + naive CD4 + Foxp3 cells differentiated from T cells + The mRNA expression of Il10 and Tgfb1 genes in Treg cells increased in a dose-dependent manner.
[0074] Safety verification: During the intervention period, the mice in the probiotic intervention group had stable weight gain, normal fecal characteristics, no diarrhea or abnormal reactions, and no significant difference in dietary intake compared with the control group, indicating that the health food containing Lactobacillus johnsonii WXY is safe.
[0075] 11.4 Experimental Conclusions Lactobacillus johnsonii WXY can be effectively added as a probiotic to everyday health foods such as yogurt and solid beverages. It works by stably colonizing the intestines, secreting L-glutamate, regulating the intestinal flora structure, and increasing CD25. + FoxP3 + It increases the proportion of Tregs and enhances intestinal barrier function, effectively maintaining intestinal immune homeostasis. It also has good compatibility with food dosage forms and high safety, making it suitable for promotion and application as a daily health food ingredient.
[0076] The above description is merely a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention.
Claims
1. A composition for the prevention or treatment of inflammatory bowel disease, characterized in that: The composition includes Lactobacillus johnsonii strain WXY ( Lactobacillus johnsonii The Lactobacillus johnsonii strain WXY has the accession number CGMCC No. 37794.
2. The composition for the prevention or treatment of inflammatory bowel disease according to claim 1, characterized in that: The composition further includes L-glutamic acid, wherein the L-glutamic acid in the composition comprises 5% to 95% by mass.
3. The composition for the prevention or treatment of inflammatory bowel disease according to claim 1, characterized in that, The composition further includes one or more of the following: an anti-Dectin-2 antagonistic antibody, an antagonistic ligand of Decin-2, a small molecule inhibitor of Decin-2, a CARD9 antagonistic antibody, a small molecule inhibitor, and a Clec4n / CLEC6A gene silencing agent; the composition also includes compounds that kill or inhibit fungal growth, including fluconazole, flucytosine, amphotericin B, nystatin, erythromycin, mepramycin, or itraconazole.
4. The composition for the prevention or treatment of inflammatory bowel disease according to claim 1, wherein the inflammatory bowel disease includes Crohn's disease and ulcerative colitis.
5. The use of the composition according to claim 1 in maintaining intestinal immune homeostasis.
6. The use of the composition according to any one of claims 1 to 4 in the preparation of a medicament for the prevention or treatment of inflammatory bowel disease, the medicament being used to achieve stable colonization of Lactobacillus johnsonii WXY strain in the intestine or effective supplementation of L-glutamate in the intestine.
7. The application according to claim 6, characterized in that, The drug includes a targeting agent, which is an agent that inhibits the Dectin-2 / CARD9 signaling pathway; and / or, the targeting agent is a probiotic strain, metabolite, or antimicrobial peptide modulator.
8. The use of a composition according to any one of claims 1 to 4 in the preparation of a medicament for the auxiliary diagnosis of inflammatory bowel disease.
9. A method for constructing a mouse model for research on the prevention or treatment of inflammatory bowel disease, characterized in that, Includes one of the following steps: A mouse model of acute colitis was established by constructing a Dectin-2 / CARD9 signaling pathway defective mouse and inducing acute colitis in drinking water using sodium dextran sulfate (DSS). An acute colitis model was established in mice by inducing the growth of *Pleurotus lateralis* fungi in drinking water. Alternatively, an acute colitis model can be established in mice after antibiotic treatment to clear bacteria and colonization with Lactobacillus johnsonii strain WXY, using sodium dextran sulfate in drinking water.
10. The application of a mouse model constructed using the construction method according to claim 9 in screening targeted reagents for the prevention or treatment of inflammatory bowel disease.