Morus alba sugar transporter encoding gene MaSWEET2b and application thereof

Abstract

The application provides a mulberry sugar transport protein coding gene MaSWEET2b and application thereof, and the nucleotide sequence of the coding gene is shown as SEQ ID NO. 1. The application clones a sugar transport protein MaSWEET2b gene in a woody plant mulberry, silences the mulberry MaSWEET2b gene through a virus-induced gene silencing technology, significantly enhances the disease resistance of the plant to a mulberry bacterial wilt pathogen, and shows that the infection speed of the pathogen is slowed down and the disease index is obviously decreased. The application first clarifies the key molecular regulation mechanism of the MaSWEET2b gene in resisting the bacterial wilt of the mulberry, provides a new theoretical basis and a potential target gene for the disease resistance genetic improvement and breeding of the mulberry, can effectively enhance the disease resistance of the mulberry, helps to realize the synergistic goal of yield increase and drug reduction, and has an important application prospect in the green breeding and sustainable agricultural production of the mulberry.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a mulberry sugar transporter gene MaSWEET2b and its applications. Background Technology

[0002] Mulberry (Morus spp.) has significant application potential in sericulture, food, medicine, and ecological restoration. However, mulberry trees are susceptible to various pathogens during their growth, severely impacting yield, quality, and product safety. Among these, bacterial wilt of mulberry trees, caused by Pseudomonas spp., is widespread in major mulberry-growing areas of my country and is one of the key bacterial diseases restricting the healthy growth of mulberry trees and the sustainable development of the sericulture industry. Research indicates that the main pathogen is Pseudomonas amygdali pv. mori. This pathogen is characterized by strong host specificity, outstanding environmental adaptability, and complex pathogenic mechanisms. It can spread efficiently in mulberry orchards through wind, rain, agricultural operations, or infected seedlings, rapidly establishing a stable infection cycle. Its high infectivity and continuous reinfection ability make the disease prone to outbreaks under suitable conditions, and conventional control measures are difficult to effectively contain, seriously threatening mulberry leaf yield and quality, and consequently affecting the stable development of the sericulture industry.

[0003] Currently, bacterial wilt of mulberry trees is mainly controlled through agronomic measures and chemical methods. However, agricultural management measures have limited control efficiency, and long-term use of chemical agents easily leads to pesticide residues and other problems, seriously impacting the ecological environment, silkworm health, and the sustainable development and utilization of mulberry resources. In contrast, breeding mulberry varieties resistant to bacterial wilt is the most economical, safe, and sustainable effective control strategy. Therefore, it is extremely urgent to identify genes that play an important role in the interaction between mulberry trees and bacterial wilt pathogens and to elucidate their underlying molecular mechanisms. Summary of the Invention

[0004] Purpose of the invention: To address the shortcomings of the existing technology, this invention provides a mulberry sugar transporter encoding gene MaSWEET2b. Silencing this gene can enhance the resistance of mulberry to bacterial wilt and can be used to cultivate new mulberry varieties with resistance to bacterial wilt.

[0005] Technical solution: In order to achieve the above objectives, the present invention provides the mulberry sugar transporter encoding gene MaSWEET2b, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0006] The present invention relates to a protein encoded by the mulberry sugar transporter gene MaSWEET2b, the amino acid sequence of which is shown in SEQ ID NO.2.

[0007] The present invention encodes a protein by the mulberry sugar transporter gene MaSWEET2b, which is located in the cell membrane.

[0008] This invention is based on the gene silencing vector of the mulberry sugar transporter gene MaSWEET2b.

[0009] The vector was constructed by designing a silencing target gene sequence and its specific primers based on the mulberry sugar transporter gene MaSWEET2b, and constructing the target gene sequence into the VIGS vector pTRV2 to obtain the pTRV2-MaSWEET2b recombinant plasmid; the nucleotide sequence of the target gene is shown in SEQ ID NO.3.

[0010] The application of the mulberry sugar transporter encoding gene MaSWEET2b, the protein, or the vector described in this invention in regulating the disease resistance of mulberry trees.

[0011] The regulation of mulberry disease resistance refers to enhancing the mulberry tree's resistance to bacterial wilt.

[0012] Among them, the application of silencing the mulberry sugar transporter gene MaSWEET2b in enhancing the plant's resistance to bacterial wilt pathogen was investigated.

[0013] Among these methods, silencing the mulberry sugar transport protein encoding gene MaSWEET2b in mulberry trees increases the activity of antioxidant enzymes in the plants.

[0014] The application of the mulberry sugar transporter encoding gene MaSWEET2b, the protein, or the vector described in this invention in the cultivation of transgenic mulberry plants resistant to bacterial wilt disease.

[0015] The method for cultivating transgenic mulberry plants with strong resistance to bacterial wilt is as follows:

[0016] (1) Design the silencing target gene sequence and its specific primers based on the mulberry sugar transporter gene MaSWEET2b. The nucleotide sequence of the target gene is shown in SEQ ID NO.3.

[0017] (2) The target gene sequence was constructed into the VIGS vector pTRV2 to obtain the pTRV2-MaSWEET2b recombinant plasmid;

[0018] (3) The above recombinant silencing plasmid was transferred into Agrobacterium competent cells to obtain Agrobacterium containing the mulberry MaSWEET2b gene silencing vector;

[0019] (4) The Agrobacterium described in step (3) is transferred into the mulberry tree to obtain a transgenic mulberry plant containing the mulberry MaSWEET2b gene silencing vector.

[0020] Furthermore, the method for identifying the mulberry MaSWEET2b gene as a disease resistance target gene in this invention is as follows:

[0021] (1) Designed quantitative PCR primers for mulberry sugar transporter MaSWEET2b gene and mulberry actin MaActin4 gene;

[0022] (2) Based on the wound inoculation method of Pseudomonas amygdali pv. mori infection system, Pseudomonas amygdali pv. mori strain MYC18 was cultured to OD. 600 After reaching 0.5, mulberry seedlings were inoculated using the wound inoculation method. RNA was extracted from root, stem, and leaf tissues at four time points within 0-72 hours and reverse transcribed into cDNA as a template.

[0023] (3) Further, using MaActin4 as an internal reference gene, the expression dynamics of the MaSWEET2b gene in the roots, stems, and leaves of mulberry trees at different infection times of MYC18 were detected by real-time PCR. -ΔΔCt The relative expression level was calculated, and the expression level of the MaSWEET2b gene was significantly upregulated after MYC18 infection, indicating that it may be involved in regulating the plant's defense response process.

[0024] In this invention, a MaSWEET2b gene-silencing strain was constructed using VIGS technology. After infection with MYC18, the silenced strain exhibited significantly enhanced disease resistance. The resistance mechanism was as follows: activation of the antioxidant enzyme system: under pathogen inoculation treatment, the activities of the three core antioxidant enzymes in the MaSWEET2b silenced strain were significantly higher than those in the control group.

[0025] This invention cloned a sugar transporter gene, MaSWEET2b, from the woody plant mulberry. This gene was significantly upregulated during infection with *Pseudomonas amygdali* pv. *mori*, and is a key factor in the MYC18 response to infection. Functional studies showed that MaSWEET2b is a negative regulator of mulberry resistance to *Pseudomonas amygdali*, and regulating its expression level can effectively affect the plant's susceptibility to the disease. This invention uses virus-induced gene silencing (VIGS) technology to silence the MaSWEET2b gene in mulberry, effectively weakening the pathogen *Pseudomonas amygdali* pv. *mori*'s ability to acquire sugars from the host, thereby significantly enhancing mulberry disease resistance. Furthermore, this method acts on the host's own susceptibility factors, rather than directly targeting the pathogen; therefore, its disease resistance effect is not affected by variations in the pathogen's pathogenic mechanism, exhibiting higher stability and durability. Inhibiting the expression of the MaSWEET2b gene significantly alleviated the symptoms of bacterial wilt in mulberry, confirming that MaSWEET2b is a key susceptibility gene in the interaction between mulberry and *P. amygdali* pv. *mori*, promoting disease development by negatively regulating the host immune response. This invention clarifies for the first time the function of the MaSWEET2b gene in the mulberry response to *P. amygdali* pv. *mori* infection, providing a theoretical basis and technical support for its use as a molecular breeding target.

[0026] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0027] This invention marks the first time a novel mulberry sugar transporter encoding gene, MaSWEET2b, has been cloned from mulberry trees. The MaSWEET2b gene was silenced using virus-induced gene silencing (VIGS) technology, thereby blocking the host adaptation of bacterial wilt pathogens and enhancing the resistance of mulberry trees to these pathogens. Furthermore, this method is unaffected by variations in the bacterial wilt pathogen races. The successful knockdown of the MaSWEET2b gene using VIGS technology significantly enhances the disease resistance of mulberry trees, indicating that the MaSWEET2b gene is a negative regulator of mulberry bacterial wilt resistance.

[0028] This invention reveals for the first time the important role of the MaSWEET2b gene in the resistance of mulberry to bacterial wilt, providing a theoretical basis for breeding new varieties of mulberry resistant to bacterial wilt. Attached Figure Description

[0029] Figure 1 Electrophoresis diagram of total RNA extracted from different parts of mulberry seedlings.

[0030] Figure 2 Electrophoresis diagram of the full-length amplification of the MaSWEET2b gene cDNA.

[0031] Figure 3 A map was constructed for the subcellular localization plasmid of MaSWEET2b.

[0032] Figure 4 The results of PCR detection for the positive clone of the pNC-Cam1304-MaSWEET2b recombinant plasmid are shown.

[0033] Figure 5 Subcellular localization results for MaSWEET2b amino acids.

[0034] Figure 6 The expression level of the MaSWEET2b gene in mulberry root tissue at different times of MYC18 infection.

[0035] Figure 7 The expression level of the MaSWEET2b gene in mulberry stem tissue at different times of MYC18 infection.

[0036] Figure 8 The expression level of the MaSWEET2b gene in mulberry leaf tissues at different times of MYC18 infection.

[0037] Figure 9 A map was constructed for the silenced MaSWEET2b plasmid.

[0038] Figure 10 The results are from PCR detection of a positive clone of the pTRV2-MaSWEET2b recombinant plasmid.

[0039] Figure 11 Phenotypic analysis and silencing efficiency of plants with silenced MaSWEET2b gene.

[0040] Figure 12 To determine the resistance of MaSWEET2b gene-silenced plants to MYC18 and the activity of antioxidant enzymes in vivo. Detailed Implementation

[0041] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0042] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0043] Experimental strain: Pseudomonas amygdali pv. mori Strain MYC18, the wild type of bacterial wilt pathogen of mulberry, was provided by Jiangsu University of Science and Technology.

[0044] Escherichia coli DH5α competent cells were purchased from Nanjing Novizan Biotechnology Co., Ltd., and Agrobacterium tumefaciena GV3101 (pSoup) competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd. The subcellular localization vector pNC-Cam1304-SubN was kindly provided by Dr. Yan Pu of the Chinese Academy of Tropical Agricultural Sciences (see Nimble Cloning (NC Cloning) Vector Free Sharing). The TRV-induced gene silencing vectors pTRV1 and pTRV2, and the mulberry recombinant viral vector pTRV2-MaPDS were provided by Jiangsu University of Science and Technology (A VIGS silencing system for identifying the MmPDS gene in mulberry and its construction method and application: 201710481375.8).

[0045] The mulberry tree is Fengchi mulberry: from Jiangsu University of Science and Technology / Sericulture Research Institute of Chinese Academy of Agricultural Sciences.

[0046] Reagent preparation:

[0047] Preparation of LB liquid medium: 5g yeast extract, 10g tryptone, 10g sodium chloride, bring to a final volume of 1L, and sterilize at 121℃ for 20min.

[0048] Preparation of YEB liquid culture medium: 5g peptone, 1g yeast powder, 5g beef extract, 5g sucrose, 0.49g magnesium sulfate heptahydrate, bring the volume to 1L, stir and mix well, adjust the pH to 7.0, and sterilize at 121℃ for 20min.

[0049] Preparation of KB liquid culture medium: 20g peptone, 10mL glycerol, 1.5g dipotassium hydrogen phosphate, 1.5g magnesium sulfate heptahydrate. Bring to a final volume of 1L, stir well, adjust pH to 7.0, and sterilize at 121℃ for 20min.

[0050] For the preparation of the solid culture medium corresponding to the above liquid culture medium, add 1.5% agar powder.

[0051] Preparation of 50 mg / mL kanamycin (Kana): Dissolve 0.5 g of kanamycin in 10 mL of ddH2O, then filter using an aqueous filter membrane (diameter = 0.22 μm). Store the prepared solution at -20°C.

[0052] Preparation of 100 mg / mL rifampin: Dissolve 0.5 g of rifampin in 5 mL of dimethyl sulfoxide, then filter using an organic filter membrane (diameter = 0.22 μm), and store at -20°C.

[0053] Example 1

[0054] Cloning of the mulberry sugar transporter MaSWEET2b gene

[0055] Total RNA was extracted from the root, stem, and leaf tissues of *Morus alba* using the Trizol method. 1 mL of Trizol reagent (Aikerui, Hunan) and 3 magnetic beads were added to a sterile grinding tube and pre-chilled. 100 mg of fresh plant tissue was placed in the grinding tube and thoroughly homogenized using a homogenizer (70 Hz, 120 sec). The tissue was centrifuged at 12000 rpm for 10 min at 4 °C. 800 μL of the supernatant was carefully transferred to a new enzyme-free centrifuge tube, and 200 μL of chloroform was added. The mixture was thoroughly mixed, incubated on ice for 3 min, and then centrifuged at 12000 rpm for 10 min at 4 °C. 450 μL of the colorless aqueous phase was transferred to… Add an equal volume of isopropanol to a new enzyme-free centrifuge tube, mix thoroughly, incubate on ice for 5 min, centrifuge at 12000 rpm for 8 min at 4℃; discard the supernatant (a gel-like precipitate forms on the tube wall / bottom), add 1 mL of 75% ethanol (prepared with DEPC water) to rinse the precipitate, centrifuge at 12000 rpm for 3 min at 4℃; discard the supernatant, open the tube cap, and place in a clean bench at room temperature to dry for 5-10 min until the ethanol has completely evaporated; add 50-70 μL of DEPC water to fully dissolve the precipitate; determine the RNA concentration using NanoDrop 2000 (A260 / A280 ratio should be between 1.8 and 2.0), take 1-2 μg of RNA for 1.25% agarose gel electrophoresis, and observe the integrity of the 28S / 18S rRNA bands (…). Figure 1 Finally, the Evo M-MLV reverse transcription premixed tracer kit (Aikerui, Hunan) was used to remove gDNA from the total RNA and reverse transcribe the first-strand cDNA.

[0056] Design specific primers for sequence amplification using cDNA as a template. The primer sequences are as follows:

[0057] MaSWEET2b-F: ATGACAACTGCATTGTCTTCTGTT

[0058] MaSWEET2b-R: TCACACATACGTGTCGATTAAGG

[0059] The CDS sequence of the mulberry sugar transporter MaSWEET2b gene was amplified and is shown in SEQ NO.1. Its amplification electrophoresis is shown in... Figure 2 As shown, the amino acid sequence of the encoded protein is shown in SEQ NO.2.

[0060] Primers for quantitative fluorescence analysis were designed based on the obtained gene sequence of the mulberry sugar transporter MaSWEET2b. The primer sequences are as follows:

[0061] MaSWEET2b-qF: GTGATGCTGCTGGAGTTGC

[0062] MaSWEET2b-qR: AACAGCCCCAATTGAGTTGAC

[0063] The mulberry actin gene MaActin4 (KT793030), stably expressed in mulberry trees and identified in the National Center for Biotechnology Information (NCBI) database, was used as an internal reference gene. Primers for quantitative real-time analysis were designed, and the primer sequences are as follows:

[0064] MaActin4 –qF: TGTTGCTCCACCAGAGAGAAAGTAC

[0065] MaActin4-qR:GGACAATTGATGGACCAGACTCG.

[0066] Example 2

[0067] Subcellular localization analysis of mulberry sugar transporter MaSWEET2b

[0068] The subcellular localization recombinant plasmid of the MaSWEET2b gene was constructed using the Nimble Cloning kit (catalog number: NC001, Hainan Nixing Biotechnology Co., Ltd.). Specific primers pNC-Cam1304-MaSWEET2b-F: gcatggacgagctgtacaag ATGACAACTGCATTGTCTTCTGTT and pNC-Cam1304-MaSWEET2b-R: attcgagctggtcacctcac CACATACGTGTCGATTAAGG were designed. Using the above *Malus fragilis* cDNA as a template, PCR amplification was performed using high-fidelity PCR enzyme (2×Phanta Max Master Mix P525, Novizan). Approximately 700 bp of the target gene fragment (excluding the stop codon) was recovered. The target fragment was mixed with the pNC-Cam1304-SubN vector, ligated with Nimble Mix, and the recombinant plasmid pNC-Cam1304-MaSWEET2b was obtained. Figure 3 After PCR verification of the positive clone bacterial culture, the recombinant plasmid was extracted and subjected to Sanger sequencing (Shanghai Sangon Biotech Co., Ltd.). The sequencing results showed that the recombinant plasmid contained the nucleotide sequence shown in SEQ ID NO.1 of the sequence listing. Figure 4 The PCR reaction system and NC cloning reaction system are shown below.

[0069] PCR reaction system:

[0070]

[0071] PCR amplification program: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 sec, 60℃ annealing for 15 sec, 72℃ extension for 30 sec, cycle denaturation, annealing, and extension 30 times, and final extension at 72℃ for 5 min.

[0072] NC cloning reaction system:

[0073] Components volume PCR products 10-80ng NC system expression vector 20-120ng Nimble Mix 5μL <![CDATA[ddH2O]]> Up to 10μL

[0074] Reaction procedure: Incubate at 37℃ for 45 minutes.

[0075] The recombinant plasmid was then transformed into *Agrobacterium tumefaciens* GV3101 competent cells containing the pSoup helper plasmid, with the empty plasmid pNC-Cam1304-SubN as a control. *Agrobacterium tumefaciens* was added to YEB liquid medium containing Rif (50 μg / mL) and Kan (50 μg / mL) and cultured at 28°C with a shaker at 180 rpm until OD (dose expiratory time). 600 =0.8-1.0. Collect bacterial cells by centrifugation at 5000 rpm for 10 minutes, resuspend in infection buffer (1 M MgCl2, 0.5 M MES, 100 mM acetylsylcholine), wash three times, and adjust OD. 600 =0.8, and then injected into 30-day-old Nicotiana benthamiana leaves. After culturing in a culture room for 48 hours, the leaf discs at the injection site were removed using a perforator to prepare microscopic observation slides. Fluorescence was observed at a wavelength of 514 nm using a laser confocal microscope (Nikon Eclipse Ti2, Japan).

[0076] Laser confocal microscopy revealed that EGFP-MaSWEET2b was specifically localized in the plasma membrane, while the control group signal was distributed in the cytoplasm and nucleus. Figure 5 ).

[0077] Example 3

[0078] Expression level of the mulberry MaSWEET2b gene after MYC18 infection

[0079] The bacterial wilt pathogen MYC18 of mulberry was inoculated using the wound inoculation method. Glycerol suspension of MYC18, previously stored in the laboratory at -80°C, was streaked onto KB plates and incubated at 28°C for 48 hours. Subsequently, single colonies were picked and inoculated into KB liquid medium and incubated at 28°C and 220 rpm for 12–16 hours. Bacterial cells were collected (5000 rpm, 5 min), resuspended in sterile water, and adjusted to OD0.05. 600The concentration was increased to 0.5. The suspension (100 μL) was inoculated onto 5-week-old mulberry seedlings and simultaneously sprayed evenly on both sides of the mulberry leaves, ensuring the droplets adhered but did not drip. A control group was also established, treating mulberry seedlings with an equal volume of sterile water. Throughout the treatment, all experimental seedlings maintained consistent abiotic conditions (temperature, light intensity, photoperiod, and humidity) (culture room temperature 25±2°C, humidity 75%, 16h light / 8h dark). Samples were taken at 0, 24, 48, and 72h after pathogen infection. Samples were immediately frozen in liquid nitrogen and stored at -80°C for subsequent RNA extraction (method as in Example 1). Quantitative real-time PCR was used, with the mulberry actin MaActin4 gene as an internal control, to determine the expression level of the MaSWEET2b gene after MYC18 infection of mulberry seedlings.

[0080] The expression levels of the MaSWEET2b gene in mulberry trees at different time points and in different parts of the plant after infection with bacterial wilt fungus showed that in root tissue, the expression level of this gene was lower than that in the uninfected control group at 24 h (0.6-fold), 48 h (0.6-fold), and 72 h (0.8-fold) after infection, but the differences were not statistically significant. Figure 6 In stem tissue, the expression level significantly increased to 54-fold of the control group at 24 h, decreased to 24-fold at 48 h, and remained at 4-fold at 72 h. Figure 7 In leaf tissues, the expression level increased to 1.9-fold at 24 h, decreased to 0.2-fold at 48 h, and recovered to 2.3-fold at 72 h. Figure 8 The expression of MaSWEET2b in stem tissues showed a significant upregulation in the early stage of infection (24 h), with a significantly higher response amplitude than that in roots and leaves, indicating that this gene has a specific and strong response to MYC18 infection in the stem. This demonstrates that the expression level of MaSWEET2b can effectively affect the susceptibility of plants to bacterial wilt, and that the MaSWEET2b gene is a key regulatory factor in the resistance of mulberry to bacterial wilt.

[0081] Example 4

[0082] Construction of the mulberry MaSWEET2b gene silencing vector

[0083] A 300 bp fragment (SEQ ID NO.3) from the mulberry MaSWEET2b gene was designed to construct the pTRV2-MaSWEET2b recombinant vector. Specific primers pTRV2-MaSWEET2b-F:gtgagtaaggttaccgaattc GTGATGCTGCTGGAGTTGC (EcoRI) and pTRV2-MaSWEET2b-R:gggacatgcccgggcctcgag AACAGCCCCAATTGAGTTGAC (XhoRI) were designed. PCR amplification was performed using the above *Malus fengchiense* cDNA as a template (high-fidelity PCR enzyme 2×Phanta Max Master Mix P525, Novizan), yielding a PCR amplification product of approximately 300 bp. Fragment 1 (approximately 300 bp) was recovered. The plant expression vector pTRV2 (TaKaRa) was digested with restriction endonucleases EcoRI and XhoRI to recover approximately 9.6 kb of the vector backbone 2. Homologous recombination (using the DLV201 Trelief Seamless Cloning Kit, Daling Biotechnology) was used to ligate fragment 1 and vector backbone 2, resulting in the recombinant plasmid pTRV2-MaSWEET2b (…). Figure 9 After PCR verification of the positive clone bacterial culture, the recombinant plasmid was extracted and subjected to Sanger sequencing (Shanghai Sangon Biotech Co., Ltd.). The sequencing results showed that the recombinant plasmid contained the nucleotide sequence shown in SEQ ID NO.3 of the sequence listing. Figure 10 The PCR reaction system, double enzyme digestion reaction system, and homologous recombination system are shown below.

[0084] PCR reaction system:

[0085] Components Volume (μL) 2 × Phanta Max Master Mix (Dye Plus) 15 Upstream primer (10 μM) 1 Downstream primer (10 μM) 1 template cDNA 1 <![CDATA[ddH2O]]> 12

[0086] PCR amplification program: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 sec, 60℃ annealing for 15 sec, 72℃ extension for 30 sec, cycle denaturation, annealing, and extension 30 times, and final extension at 72℃ for 5 min.

[0087] Double enzyme digestion reaction system:

[0088]

[0089] Double enzyme digestion procedure: Incubate at 37℃ for 15 min.

[0090] Homologous recombination system:

[0091]

[0092] *Refer to the instruction manual to calculate the volume of the target fragment and the linearized carrier.

[0093] Homologous recombination procedure: react at 50℃ for 15 min.

[0094] Example 5

[0095] Phenotypic analysis and silencing efficiency of the MaSWEET2b gene in plants

[0096] The vector plasmid constructed in Example 3 was transformed into Agrobacterium competent cells (GV3101) using the freeze-thaw method. The Agrobacterium culture was then streaked onto YEB plates containing both Rif (50 μg / mL) and Kan (50 μg / mL) antibiotics and incubated at 28°C for 48 h. Single colonies were selected and incubated overnight at 28°C in 2 mL of YEB liquid medium containing the corresponding antibiotics. Subsequently, PCR detection was performed to confirm the correct strain. Then, 250 μL of the culture was inoculated into 25 mL of YEB liquid medium containing the corresponding antibiotics and incubated overnight at 28°C. The cultured culture was centrifuged at 6000 rpm for 5 min, the supernatant was discarded, and the cells were resuspended in infection solution (final resuspension concentration: 10 mM MgCl2, 10 mM MES, and 150 μM AS, pH=5.6). After washing three times, the OD was adjusted. 600 =0.8, after vortexing, let stand at room temperature in the dark for 2.5 h. Take equal volume of Agrobacterium resuspension of pTRV1 and pTRV2-MaPDS as positive control group, take equal volume of Agrobacterium resuspension of pTRV1 and pTRV2 as empty control group, take equal volume of Agrobacterium resuspension of pTRV1 and pTRV2-MaSWEET2b as experimental group, and mulberry seedlings without any treatment as blank control group.

[0097] Mulberry seedlings with fully expanded cotyledons, sprouted first pair of true leaves, and unopened second pair of true leaves were selected for inoculation. Using a sterile syringe, 1 mL of the resuspended bacterial solution was injected into the lower epidermis of the cotyledons, thoroughly saturating the leaves. After incubation in the dark for 24 hours, the treated plants were then introduced to normal light. Approximately 12 days after Agrobacterium infection, the leaves of the positive control group (MaPDS silenced group) showed a distinct whitening phenotype. Figure 11 A). Fourteen days after Agrobacterium infection, RNA was extracted from newly grown young leaves of CK, TRV, and MaSWEET2b-silenced plants (same as in Example 1). The expression level of the MaSWEET2b gene was detected by real-time quantitative qRT-PCR using the mulberry actin MaActin4 gene as an internal control to assess the silencing efficiency. The results showed that, compared with the control group, the expression level of MaSWEET2b in the leaves of silenced plants was significantly reduced by approximately 70% and 31%, respectively, compared to the CK and TRV groups. Figure 11 B).

[0098] Example 6

[0099] Assay of resistance to bacterial wilt and antioxidant enzyme activity in MaSWEET2b gene-silenced plants

[0100] The TRV (empty vector control) and TRV-MaSWEET2b (gene silenced) lines were inoculated with pathogens using the wound inoculation method (same as in Example 3). The results showed that the MaSWEET2b silenced lines exhibited significantly enhanced disease resistance. Ten days after inoculation with pathogen strain MYC18, control plants showed signs of leaf chlorosis, typical localized nearly circular lesions, and curling and wrinkling of the top leaves towards the back. In contrast, the silenced lines showed no obvious pathological symptoms other than mechanical damage. Figure 12 A).

[0101] The activities of antioxidant enzymes in mulberry trees infected with pathogens were determined using catalase (CAT), peroxidase (POD), superoxide dismutase (SOD), and malondialdehyde (MDA) kits (CAT and POD kits were purchased from Nanjing Jiancheng Bioengineering Institute, and SOD and MDA kits were purchased from Beijing Solarbio Science & Technology Co., Ltd., following the instructions). The results showed that the activities of the three main antioxidant enzymes were significantly upregulated in the MaSWEET2b silent strain group after pathogen inoculation compared to the control group. Specifically, the basal activity of CAT in the silent strain was approximately 21.3% higher than that in the control group. Figure 12 B), POD activity was increased by approximately 26.5% compared to the control group ( Figure 12 C), SOD activity increased by approximately 26% ( Figure 12 D), while the content of malondialdehyde (MDA) did not differ significantly between the two groups ( Figure 12 E). The above experimental results clearly demonstrate that silencing the MaSWEET2b gene significantly activates the antioxidant defense system in mulberry trees, particularly promoting the synergistic expression of key antioxidant enzymes such as SOD, POD, and CAT. This systemic enhancement of antioxidant capacity effectively eliminates excess reactive oxygen species (ROS) accumulated during pathogen infection, maintains cellular redox homeostasis, and thus significantly reduces the plant's sensitivity to strain MYC18, thereby enhancing the plant's resistance to bacterial wilt pathogens.

Claims

1. A mulberry sugar transporter encoding gene MaSWEET2b, characterized in that, The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. A protein encoded by the mulberry sugar transporter gene MaSWEET2b, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO.

2.

3. The mulberry sugar transporter encoding gene MaSWEET2b according to claim 2, characterized in that, The protein is located in the plasma membrane of plant cells.

4. A gene silencing vector based on the mulberry sugar transporter encoding gene MaSWEET2b as described in claim 1.

5. The gene silencing vector according to claim 4, characterized in that, The vector was constructed by designing a silencing target gene sequence and its specific primers based on the mulberry sugar transporter encoding gene MaSWEET2b, and constructing the target gene sequence into the VIGS vector pTRV2 to obtain the pTRV2-MaSWEET2b recombinant plasmid; the nucleotide sequence of the target gene is shown in SEQ ID NO.

3.

6. The application of the mulberry sugar transporter encoding gene MaSWEET2b as described in claim 1, or the protein as described in claim 2, or the vector as described in claim 4, in regulating the disease resistance of mulberry trees, wherein the disease resistance is to enhance the resistance of mulberry trees to bacterial wilt.

7. The application according to claim 6, characterized in that, Application of optimizing the silencing gene MaSWEET2b, which encodes the mulberry sugar transporter in mulberry trees, to enhance the plant's resistance to Pseudomonas amygdali pv. mori.

8. The application according to claim 6, characterized in that, The activity of antioxidant enzymes in mulberry plants was enhanced by silencing the gene encoding the mulberry sugar transporter MaSWEET2b.

9. The application of the mulberry sugar transporter encoding gene MaSWEET2b as described in claim 1, or the protein as described in claim 2, or the vector as described in claim 4, in the cultivation of transgenic mulberry plants resistant to bacterial wilt disease.

10. The application according to claim 9, characterized in that, The method for cultivating transgenic mulberry plants with strong resistance to bacterial wilt is as follows: (1) Design the silencing target gene sequence and its specific primers based on the mulberry sugar transporter encoding gene MaSWEET2b. The nucleotide sequence of the target gene is shown in SEQ ID NO.

3. (2) The target gene sequence was constructed into the VIGS vector pTRV2 to obtain the pTRV2-MaSWEET2b recombinant plasmid; (3) The above recombinant silencing plasmid was transferred into Agrobacterium competent cells to obtain Agrobacterium containing the mulberry MaSWEET2b gene silencing vector; (4) The Agrobacterium described in step (3) is transferred into the mulberry tree to obtain a transgenic mulberry plant containing the mulberry MaSWEET2b gene silencing vector.

Images