Use of pub14 protein in promoting ovule development and increasing seed number

Abstract

The application discloses application of PUB14 protein in promoting ovule formation and increasing seed quantity. The application provides application of PUB14 protein or a nucleic acid molecule coding the PUB14 protein, and is applied to the following (I) and / or (II) and / or (III): (I) application in regulating seed quantity of plants; (II) application in regulating ovule quantity of plants; (III) application in regulating grain yield of plants. The application has important application value for plant breeding.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to the application of PUB14 protein in promoting ovule formation and increasing seed quantity. Background Technology

[0002] Seeds are the reproductive organs of higher plants, playing a crucial role in plant reproduction and life cycle, and determining the yield of many important food and oilseed crops. Seed occurrence and development largely determine seed quantity and yield. The ovule, the precursor to the seed, is an important reproductive organ that develops on the placenta within the pistil. Ovule occurrence and its regulatory mechanisms are among the core issues in plant reproductive development. In plants where a fruit contains multiple seeds, the initiation of ovule primordia (the number of ovule primordia) determines the maximum possible number of ovules, significantly influencing the number of seeds per fruit and thus seed yield.

[0003] Therefore, the process of ovule formation and its regulatory mechanisms have significant scientific importance and potential application value. Summary of the Invention

[0004] The purpose of this invention is to provide the application of PUB14 protein in promoting ovule formation and increasing seed quantity.

[0005] This invention provides applications of the PUB14 protein or nucleic acid molecules encoding the PUB14 protein, as follows (I) and / or (II) and / or (III): (I) Application in regulating plant seed quantity; (II) Application in regulating the number of plant ovules; (III) Application in regulating plant grain yield.

[0006] The regulation described is positive regulation. Increased PUB14 protein abundance leads to increased plant seed quantity. Increased PUB14 protein abundance leads to increased plant ovule quantity. Increased PUB14 protein abundance leads to increased plant grain yield. Decreased PUB14 protein abundance leads to decreased plant seed quantity. Decreased PUB14 protein abundance leads to decreased plant ovule quantity. Decreased PUB14 protein abundance leads to decreased plant grain yield. Increased abundance of nucleic acid molecules encoding PUB14 protein leads to increased plant seed quantity. Increased abundance of nucleic acid molecules encoding PUB14 protein leads to increased plant ovule quantity. Increased abundance of nucleic acid molecules encoding PUB14 protein leads to increased plant grain yield. Decreased abundance of nucleic acid molecules encoding PUB14 protein leads to decreased plant seed quantity. Decreased abundance of nucleic acid molecules encoding PUB14 protein leads to decreased plant ovule quantity. Decreased abundance of nucleic acid molecules encoding PUB14 protein leads to decreased plant grain yield.

[0007] This invention also protects the use of PUB14 protein or PUB14 protein-related biomaterials in the preparation of plants with increased seed quantity and / or ovule quantity and / or grain yield.

[0008] This invention also protects the use of substances that target the PUB14 protein or nucleic acid molecules encoding the PUB14 protein as inhibitory targets in the preparation of plants with reduced seed quantity and / or ovule quantity and / or grain yield.

[0009] This invention also protects a method for cultivating plants with increased seed quantity and / or ovule quantity and / or grain yield, comprising the following steps: introducing a nucleic acid molecule encoding a PUB14 protein into a recipient plant to obtain a transgenic plant with a higher seed quantity and / or ovule quantity and / or grain yield than the recipient plant. Specifically, in the method, a nucleic acid molecule encoding a PUB14 protein is introduced into the recipient plant... PUB14 Gene recombination vector. Specifically, in the method described, a gene recombinant vector is introduced into the recipient plant. PUB14 Microorganisms that regenerate genes.

[0010] The present invention also protects a method for cultivating plants with increased seed quantity and / or ovule quantity and / or grain yield, comprising the following steps: increasing the abundance and / or activity of PUB14 protein in a recipient plant to obtain a plant with a higher seed quantity and / or ovule quantity and / or grain yield than the recipient plant.

[0011] This invention also protects a method for cultivating plants with reduced seed quantity and / or ovule quantity and / or grain yield, comprising the following steps: inhibiting the expression of nucleic acid molecules encoding PUB14 protein in a recipient plant to obtain plants with lower seed quantity and / or ovule quantity and / or grain yield than the recipient plant. Inhibiting the expression of nucleic acid molecules encoding PUB14 protein in the recipient plant is specifically achieved by inhibiting the expression of nucleic acid molecules encoding PUB14 protein in the plant genome. PUB14 Gene editing is achieved through the Cas9 system. Specifically, the target sequence of the Cas9 system is located in the plant genome. PUB14 In the gene. Specifically, the target sequences of the Cas9 system are target sequence 1 (ATATCACTTGAACTGATGA) and target sequence 2 (AAGGAGCCATTGTTGATGC). Inhibition of the expression of nucleic acid molecules encoding the PUB14 protein in the recipient plant is specifically achieved by introducing a substance that targets the nucleic acid molecules encoding the PUB14 protein.

[0012] Substances that target the nucleic acid molecules encoding the PUB14 protein as inhibitors can specifically be substances from the plant genome. PUB14 A Cas9 system with the target gene as the target gene. Specifically, the target sequence of the Cas9 system is located in the plant genome. PUB14In the gene. Specifically, the target sequences of the Cas9 system are target sequence 1 (ATATCACTTGAACTGATGA) and target sequence 2 (AAGGAGCCATTGTTGATGC). Specifically, the Cas9 system is a recombinant plasmid expressing the Cas9 gene and n sgRNAs. n is a natural number. Specifically, n is 1 or 2. The target sequences of the two sgRNAs are target sequence 1 (ATATCACTTGAACTGATGA) and target sequence 2 (AAGGAGCCATTGTTGATGC), respectively. Specifically, the Cas9 system involves: using the DNA molecule shown in SEQ ID NO: 5... Bsa The recombinant plasmid was obtained by inserting the I enzyme digestion recognition sequence into the pHEE401 plasmid.

[0013] The present invention also protects a method for cultivating plants with reduced seed quantity and / or ovule quantity and / or grain yield, comprising the following steps: reducing the abundance and / or activity of PUB14 protein in a recipient plant to obtain a plant with a lower seed quantity and / or ovule quantity and / or grain yield than the recipient plant.

[0014] This invention also protects the application of any of the methods described above in plant breeding. The goal of the plant breeding is to cultivate plants with increased seed quantity and / or ovule quantity and / or grain yield. The goal of the plant breeding is also to cultivate plants with decreased seed quantity and / or ovule quantity and / or grain yield.

[0015] This invention also protects the PUB14 protein or PUB14 protein-related biological materials.

[0016] The PUB14 protein mentioned above is either (a1), (a2), (a3), or (a4) as follows: (a1) The protein shown in SEQ ID NO: 1; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) A protein obtained by substituting and / or deleting and / or adding one or more amino acid residues of (a1) and which is related to the number of seeds and / or the number of ovules and / or the yield of grains in a plant. (a4) is a protein derived from Arabidopsis thaliana, sharing more than 75% identity with (a1), and associated with the number of seeds and / or ovules and / or grain yield in plants.

[0017] The term “identity” as used herein refers to the sequence similarity to the amino acid sequence of the protein shown in SEQ ID NO: 1.

[0018] Specifically, the labels are those shown in Table 1.

[0019] Table 1. Sequence of Labels

[0020] The PUB14 protein can be synthesized artificially, or its encoding gene can be synthesized first and then expressed biologically.

[0021] The PUB14 protein-related biological material mentioned above is the PUB14 protein, a nucleic acid molecule encoding the PUB14 protein, or any of the above-mentioned PUB14 protein-related biological materials. PUB14 Genes, possess PUB14 Gene expression cassettes, with PUB14 Gene recombinant vectors or those with PUB14 Microorganisms that regenerate genes.

[0022] The PUB14 protein was obtained from Arabidopsis thaliana ( Arabidopsis thaliana ).

[0023] The nucleic acid molecule encoding the PUB14 protein is a DNA molecule or an RNA molecule.

[0024] Specifically, the nucleic acid molecule encoding the PUB14 protein is PUB14 Gene.

[0025] The PUB14 The gene is the gene that encodes the PUB14 protein.

[0026] Specifically, the aforementioned PUB14 The gene is (b1) or (b2) or (b3) or (b4): (b1) A DNA molecule with a coding region as shown in SEQ ID NO:2; (b2) The DNA molecule shown in SEQ ID NO:3; (b3) DNA molecules derived from Arabidopsis thaliana and having more than 75% identity with (b1) or (b2); (b4) DNA molecules that hybridize with (b1) or (b2) under strict conditions.

[0027] The term “identity” as used herein refers to the sequence similarity of the nucleotide sequence to the DNA molecule shown in SEQ ID NO:2 or SEQ ID NO:3.

[0028] Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0029] Specifically, the 75% or higher degree of identity means 80% or higher. Specifically, the 75% or higher degree of identity means 85% or higher. Specifically, the 75% or higher degree of identity means 90% or higher. Specifically, the 75% or higher degree of identity means 91% or higher, 92% or higher, 93% or higher, 94% or higher, 95% or higher, 96% or higher, 97% or higher, 98% or higher, or 99% or higher.

[0030] Specifically, having PUB14 The gene recombination vector is the insertion of the gene into a plant expression vector. PUB14 Recombinant plasmids obtained from genes. Specifically, they have... PUB14 The recombinant vector for the gene is the plasmid shown in SEQ ID NO:4.

[0031] Specifically, having PUB14 Recombinant microorganisms are those that introduce the gene into the starting microorganism. PUB14 Recombinant microorganisms derived from genes. Specifically, they possess... PUB14 Recombinant microorganisms are those that introduce the aforementioned gene into the starting microorganism. PUB14 Recombinant microorganisms obtained from gene recombination vectors. Specifically, the starting microorganism is Agrobacterium, such as Agrobacterium GV3101.

[0032] For example, the number of seeds is the number of seeds in the silique. For example, the number of seeds is the number of seeds in the plant. For example, the number of ovules is the number of ovules in the pistil. For example, the number of ovules is the number of ovules in the plant.

[0033] Any of the above-mentioned plants may be monocotyledonous or dicotyledonous. Any of the above-mentioned plants may be plants of the Brassicaceae family. Any of the above-mentioned plants may be plants of the genus *Arabidopsis*. Any of the above-mentioned plants may be *Arabidopsis*, such as the Colombian ecotype *Arabidopsis*.

[0034] The inventors of this invention have experimentally confirmed the presence of PUB14 protein and PUB14 Gene function. Overexpression in plants. PUB14 Genetically modified plants, compared to wild-type plants, exhibit increased ovule and seed counts. This is related to the genetic makeup of the plant genome. PUB14 Gene editing produces gene-edited plants, which, compared to wild-type plants, have fewer ovules and fewer seeds.

[0035] This invention has important application value for plant breeding. Attached Figure Description

[0036] Figure 1Photograph of silique phenotype (bar=2mm).

[0037] Figure 2 This is a statistical result of the number of seeds in a single silique.

[0038] Figure 3 Examples of photographs showing the rosette leaf phenotype during the vegetative growth stage and examples of photographs showing the full plant phenotype in real time during flowering (bar=2cm).

[0039] Figure 4 This is a microscopic photograph of the pistil (bar=100μm).

[0040] Figure 5 This is a statistical result of the number of ovules in a single row.

[0041] Figure 6 for PUB14 The relative expression level of genes. Detailed Implementation

[0042] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0043] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. Unless otherwise specified, the quantitative experiments in the following examples are all performed in triplicate, and the results are averaged. The PUB14 protein in Arabidopsis thaliana is shown in SEQ ID NO: 1. Arabidopsis thaliana cDNA contains... PUB14 The gene coding frame is shown in SEQ ID NO: 2. (The gene coding frame is from the Arabidopsis thaliana genomic DNA.) PUB14 The gene is shown in SEQ ID NO: 3. The wild-type Arabidopsis thaliana in this example is the Colombian ecotype, denoted as Col-0 or WT. Unless otherwise specified, the culture conditions for Arabidopsis thaliana were: temperature 22°C, photoperiod 16 h / 8 h dark. Unless otherwise specified, the pH of the 1 / 2 MS solid medium was 5.7.

[0044] Example 1: Preparation of overexpression plants I. Construction of overexpression plasmids An overexpression plasmid, also known as the recombinant plasmid UBQ10:PUB14-mCherry, was prepared. The recombinant plasmid UBQ10:PUB14-mCherry is a circular plasmid, and its full sequence is shown in SEQ ID NO: 4. In SEQ ID NO: 4, nucleotides 6-1589 constitute the hygromycin resistance gene, nucleotides 10040-10675 constitute the UBQ10 promoter, and nucleotides 10688-12583 constitute... PUB14 Gene.

[0045] II. Preparation of Transgenic Plants 1. Take wild-type Arabidopsis seeds, sterilize them with 2% sodium hypochlorite solution, and then wash them with sterile water.

[0046] 2. Take the seeds obtained in step 1 and place them on 1 / 2 MS solid medium containing 1.5g / 100mL sucrose and 0.75g / 100mL agar. Vernalize them at 4℃ for 2 days, then culture them for 7 days. Finally, transfer the seedlings to soil for cultivation.

[0047] 3. The overexpression plasmid was introduced into Agrobacterium GV3101 to obtain recombinant Agrobacterium.

[0048] 4. Take the recombinant Agrobacterium obtained in step 3 and use the floral dip method (Floral dip: a simplified method for...). Agrobacterium -mediated transformation of Arabidopsis thaliana . Plant . J . 16, 735-743 (1998)) Genetically transform the plants from step 2, then cultivate the plants and harvest the seeds from the plants, which are the T0 generation seeds.

[0049] 5. Place T0 generation seeds on 1 / 2 MS solid medium containing 3 mg / 100 mL hygromycin and culture for 10 days. Select hygromycin-resistant seedlings, i.e., T1 generation resistant plants. Transfer T1 generation resistant plants to soil for further culture, self-pollinate, and harvest seeds from the plants, which are the T1 generation seeds.

[0050] 6. Place T1 generation seeds on 1 / 2 MS solid medium containing 3 mg / 100 mL hygromycin and culture for 10 days. Select hygromycin-resistant seedlings, i.e., T2 generation resistant plants. Transfer T2 generation resistant plants to soil for further culture, self-pollinate, and harvest seeds from the plants, which are the T2 generation seeds.

[0051] 7. Take T2 generation seeds (randomly sampled) and place them on 1 / 2 MS solid medium containing 3 mg / 100 mL hygromycin for 10 days to screen for hygromycin-resistant seedlings, i.e. T3 generation resistant plants.

[0052] For a certain T2 generation resistant plant, if the T3 generation plants obtained by self-pollination are all hygromycin resistant plants, the T2 generation plant is a homozygous transgenic plant, and the self-pollination offspring of the T2 generation plant are homozygous transgenic lines.

[0053] Two transgenic lines were obtained (both have been sequenced and the sequencing results show that they are homozygous transgenic). PUB14 The two gene lines were named UBQ10:PUB14-mCherry and UBQ10:PUB14-mCherry2, respectively.

[0054] III. Preparation of empty control plants Compared to overexpression plasmids, the only difference in empty vector plasmids is the absence of [a specific expression element]. PUB14 Gene.

[0055] Replace the overexpression plasmid with an empty vector plasmid and follow the steps in step two to obtain an empty vector control line.

[0056] Example 2: Preparation of gene-edited plants I. Constructing gene-editing plasmids choose PUB14 The following two target sequences in the gene: Target sequence 1: ATATCACTTGAACTGATGA; Target sequence 2: AAGGAGCCATTGTTGATGC.

[0057] The DNA molecule shown in SEQ ID NO: 5 was used with Bsa The I enzyme digestion recognition sequence is inserted into the pHEE401 plasmid (Addgene, Plasmid #71286) to obtain the recombinant plasmid, which is the gene editing plasmid.

[0058] II. Preparation of Gene-Edited Plants 1. Take wild-type Arabidopsis seeds, sterilize them with 2% sodium hypochlorite solution, and then wash them with sterile water.

[0059] 2. Take the seeds obtained in step 1 and place them on 1 / 2 MS solid medium containing 1.5g / 100mL sucrose and 0.75g / 100mL agar. Vernalize them at 4℃ for 2 days, then culture them for 7 days. Finally, transfer the seedlings to soil for cultivation.

[0060] 3. Gene editing plasmids were introduced into Agrobacterium GV3101 to obtain recombinant Agrobacterium.

[0061] 4. Take the recombinant Agrobacterium obtained in step 3 and use the floral dip method (Floral dip: a simplified method for...). Agrobacterium -mediated transformation of Arabidopsis thaliana . Plant . J . 16, 735-743 (1998)) Genetically transform the plants from step 2, then cultivate the plants and harvest the seeds from the plants, which are the T0 generation seeds.

[0062] 5. Place T0 generation seeds on 1 / 2 MS solid medium containing 3 mg / 100 mg hygromycin and culture for 10 days to screen for hygromycin-resistant seedlings, i.e., T1 generation resistant plants.

[0063] 6. Transfer the T1 generation resistant plants to soil for further culture, extract total DNA from leaves, and amplify the total DNA using it as a template. PUB14 Gene sequencing was performed. Total DNA from wild-type Arabidopsis leaves was used as a template to amplify... PUB14 Genes were sequenced, and the sequencing results were used as a reference sequence. If the sequencing results of a certain T1 generation resistant plant are two different, one of which is the same as the reference sequence and the other is different from the reference sequence, then the T1 generation resistant plant is a heterozygous gene-edited plant.

[0064] 7. T1 generation heterozygous gene-edited plants were self-pollinated, and seeds were obtained from these plants; these are the T1 generation seeds. The T1 generation seeds were cultured on 1 / 2 MS solid medium for 10 days to obtain T2 generation plants. The T2 generation plants were then transferred to soil for further culture. Total DNA was extracted from leaves and amplified using the total DNA as a template. PUB14 Gene sequencing was performed. If the sequencing result of a T2 generation plant is identical and differs from the reference sequence, then the T2 generation plant is a homozygous gene-edited plant.

[0065] 8. Seeds obtained from self-pollination of homozygous gene-edited plants are called T2 generation seeds.

[0066] The self-crossed offspring of homozygous gene-edited plants are homozygous gene-edited lines.

[0067] Two gene-edited lines were obtained and named PUB14 CRISPR and PUB14 CRISPR2, respectively.

[0068] Compared with the wild-type Arabidopsis genome PUB14 Compared to genes, the PUB14 CRISPR strain has lower genomic DNA. PUB14The gene underwent the following mutation: "ATATCACTTGAACTGATGA" was changed to "ATATCACTTGAACTGAATGA" (i.e., one nucleotide was inserted), while the rest of the sequence remained unchanged. This mutation caused premature termination.

[0069] Compared with the wild-type Arabidopsis genome PUB14 Compared to other genes, the PUB14 CRISPR2 strain has higher genomic DNA. PUB14 The gene underwent the following mutation: "AAGGAGCCATTGTTGATGC" was changed to "AAGGAGCCATTGTTGTGC" (i.e., 1 nucleotide was deleted), while the rest of the sequence remained unchanged. This mutation caused premature termination.

[0070] Example 3: Phenotypic Comparison and Statistical Analysis of Traits Test seeds: wild-type Arabidopsis thaliana seeds, T2 generation seeds of UBQ10:PUB14-mCherry strain, T2 generation seeds of UBQ10:PUB14-mCherry2 strain, T2 generation seeds of empty control strain, T2 generation seeds of PUB14 CRISPR strain, and T2 generation seeds of PUB14 CRISPR2 strain.

[0071] Take the test seeds, vernalize them at 4℃ for 2 days, then place them on 1 / 2 MS solid medium and culture them for 10 days. Then transfer them to soil and continue to culture them until they flower and bear fruit.

[0072] During plant cultivation, mature siliques are taken, dissected, photographed, and the number of seeds in each silique is counted. Figure 1 It is a silique phenotype. Figure 2 The statistical results for the number of seeds per silique are given, with data values ​​representing the mean ± SE (n=15). Lowercase letters indicate significant differences between different stages (one-way ANOVA, P<0.05). Compared with wild-type Arabidopsis, there was no significant difference in the number of seeds in the empty control lines. Compared with wild-type Arabidopsis, the number of seeds in the UBQ10:PUB14-mCherry and UBQ10:PUB14-mCherry2 lines was significantly increased. Compared with wild-type Arabidopsis, the number of seeds in the UB14CRISPR and PUB14CRISPR2 lines was significantly decreased. There was no significant difference in the number of siliques among the different lines.

[0073] Figure 3Examples of photographs showing the rosette leaf phenotype during vegetative growth and the whole plant phenotype at flowering and fruiting stages are provided (bar=2cm). Compared to wild-type Arabidopsis, there were no significant differences in the rosette leaf phenotype during vegetative growth and the whole plant phenotype at flowering and fruiting stages in the control line. Compared to the UBQ10:PUB14-mCherry line, there were no significant differences in the rosette leaf phenotype during vegetative growth and the whole plant phenotype at flowering and fruiting stages in the UBQ10:PUB14-mCherry2 line. Compared to the PUB14 CRISPR line, there were no significant differences in the rosette leaf phenotype during vegetative growth and the whole plant phenotype at flowering and fruiting stages in the PUB14 CRISPR2 line.

[0074] During plant culture, pistils were taken from flowers that had developed to the 10th stage, dissected, and then placed in 20 μL of chloral hydrate solution (composed of 8 parts chloral hydrate, 3 parts H2O, and 1 part glycerol) until the pistils became transparent. They were then observed under a microscope equipped with DIC optical elements. Figure 4 This is a photograph of the pistil under a microscope, showing the ovules on both sides of the placenta. Figure 5 The statistical results for ovule count are presented in single-column format. Data values ​​are mean ± SE (n=25), with lowercase letters indicating significant differences between different stages (one-way ANOVA, P<0.05). There was no significant difference in ovule count between the wild-type Arabidopsis and the empty control lines. Compared with wild-type Arabidopsis, the UBQ10:PUB14-mCherry and UBQ10:PUB14-mCherry2 lines showed significantly increased ovule counts (no significant difference between the two overexpression lines). Compared with wild-type Arabidopsis, the PUB14 CRISPR and PUB14 CRISPR2 lines showed significantly decreased ovule counts (no significant difference between the two gene-edited lines).

[0075] The pistils of plants grown for 50 days were collected, total RNA was extracted, and cDNA was obtained through reverse transcription. Using the cDNA as a template and the ACTIN gene as an internal reference gene, detection was performed. PUB14 Relative gene expression levels. Used for detection. PUB14 Primers for the gene: PUB14-RT-F: ATTGTTGTTCCCACGAGGAG; PUB14-RT-R: TCGAAGAAAGGGCTGAGAAG. Primers for detecting the internal reference gene: ACTIN-RT-F: CCGGTATTGTGCTCGATTCTG; ACTIN-RT-R: TTCCCGTTCTGCGGTAGTGG. Figure 6 for PUB14Relative gene expression levels were obtained from three biological replicates. Lowercase letters indicate significant differences between different stages (one-way ANOVA, P < 0.05). Compared with wild-type Arabidopsis, the expression levels of the empty-label control lines were significantly lower. PUB14 There was no significant difference in the relative gene expression levels. Compared with wild-type Arabidopsis, the UBQ10:PUB14-mCherry and UBQ10:PUB14-mCherry2 lines showed no significant difference in gene expression levels. PUB14 The relative expression levels of both genes were significantly increased (no significant difference between the two overexpression lines). Compared with wild-type Arabidopsis, the PUB14 CRISPR and PUB14 CRISPR2 lines showed significantly increased expression levels. PUB14 The relative expression levels of the genes were significantly reduced (there was no significant difference between the two gene-edited lines).

[0076] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. The application of the PUB14 protein or the nucleic acid molecule encoding the PUB14 protein, as follows (I) and / or (II) and / or (III): (I) Application in regulating plant seed quantity; (II) Application in regulating the number of plant ovules; (III) Application in regulating plant grain yield; The PUB14 protein is one of the following (a1), (a2), (a3), or (a4): (a1) The protein shown in SEQ ID NO: 1; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) A protein obtained by substituting and / or deleting and / or adding one or more amino acid residues of (a1) and which is related to the number of seeds and / or the number of ovules and / or the yield of grains in a plant. (a4) is a protein derived from Arabidopsis thaliana, sharing more than 75% identity with (a1), and associated with the number of seeds and / or ovules and / or grain yield in plants.

2. Application of PUB14 protein or PUB14 protein-related biomaterials in the preparation of plants with increased seed quantity and / or ovule quantity and / or grain yield; The PUB14 protein-related biomaterials are nucleic acid molecules encoding the PUB14 protein. PUB14 Genes, possess PUB14 Gene expression cassettes, with PUB14 Gene recombinant vectors or those with PUB14 Recombinant microorganisms; The PUB14 protein is the PUB14 protein as described in claim 1; The PUB14 The gene is the gene that encodes the PUB14 protein.

3. The application of a substance that targets the PUB14 protein or a substance that targets the nucleic acid molecule encoding the PUB14 protein in the preparation of plants with reduced seed quantity and / or ovule quantity and / or grain yield; wherein the PUB14 protein is the PUB14 protein as described in claim 1.

4. A method for cultivating plants with increased seed quantity and / or ovule quantity and / or grain yield, comprising the following steps: introducing a nucleic acid molecule encoding a PUB14 protein into a recipient plant to obtain a transgenic plant with a higher seed quantity and / or ovule quantity and / or grain yield than the recipient plant; wherein the PUB14 protein is the PUB14 protein as described in claim 1.

5. A method for cultivating plants with increased seed quantity and / or ovule quantity and / or grain yield, comprising the following steps: increasing the abundance and / or activity of PUB14 protein in a recipient plant to obtain a plant with a higher seed quantity and / or ovule quantity and / or grain yield than the recipient plant; wherein the PUB14 protein is the PUB14 protein as described in claim 1.

6. A method for cultivating plants with reduced seed quantity and / or ovule quantity and / or grain yield, comprising the following steps: inhibiting the expression of a nucleic acid molecule encoding a PUB14 protein in a recipient plant to obtain a plant with a lower seed quantity and / or ovule quantity and / or grain yield than the recipient plant; wherein the PUB14 protein is the PUB14 protein as described in claim 1.

7. A method for cultivating plants with reduced seed quantity and / or ovule quantity and / or grain yield, comprising the steps of: reducing the abundance and / or activity of PUB14 protein in a recipient plant to obtain a plant with a lower seed quantity and / or ovule quantity and / or grain yield than the recipient plant; wherein the PUB14 protein is the PUB14 protein as described in claim 1.

8. A protein, named PUB14 protein, is as follows (a1) or (a2) or (a3) ​​or (a4): (a1) The protein shown in SEQ ID NO: 1; (a2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein described in (a1); (a3) A protein obtained by substituting and / or deleting and / or adding one or more amino acid residues of (a1) and which is related to the number of seeds and / or the number of ovules and / or the yield of grains in a plant. (a4) is a protein derived from Arabidopsis thaliana, sharing more than 75% identity with (a1), and associated with the number of seeds and / or ovules and / or grain yield in plants.

9. PUB14 protein-related biomaterials; wherein the PUB14 protein-related biomaterials are nucleic acid molecules encoding the PUB14 protein, PUB14 Genes, possess PUB14 Gene expression cassettes, with PUB14 Gene recombinant vectors or those with PUB14 Recombinant microorganisms of the gene; the PUB14 protein is the PUB14 protein as described in claim 1; PUB14 The gene is the gene that encodes the PUB14 protein.

10. The application of the method according to any one of claims 4 to 7 in plant breeding.

Images