A method for constructing an ankylosing spondylitis drug screening system targeting an ALKBH5 / CircRNA_0001543 / RIP1 combination

CN122146836BActive Publication Date: 2026-09-15ANHUI UNIVERSITY OF TRADITIONAL CHINESE MEDICINE
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610269271.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-03-06
Publication Date
2026-09-15
Estimated Expiration
2046-03-06

AI Technical Summary

Technical Problem

这类方法虽能快速获得初步筛选结果,但存在显著局限性:一方面,靶点选择仅触及炎症反应的下游环节,未深入炎症发生的上游核心调控链条,导致筛选出的药物多为“对症治疗”,无法从根源阻断炎症级联反应,长期使用易引发耐药性,难以实现疾病的长期控制;另一方面,现有筛选模型多采用单一细胞(如单独的滑膜细胞或免疫细胞)进行体外培养,未能模拟AS体内“免疫细胞与滑膜细胞相互作用”的复杂炎症微环境,无法反映靶点间的协同调控关系,导致筛选效率低下,候选药物进入临床后针对性差、疗效不达预期

Benefits of technology

本发明精准模拟体内炎症微环境,解决现有模型无法反映靶点协同调控的缺陷,提升药物筛选针对性与可靠性;靶向炎症上游核心靶点组合,突破单一下游靶点局限,避免耐药性,助力长效药物研发;通过三重靶向指标与量化药效标准,形成完整筛选闭环,大幅提高筛选效率与候选药活性验证准确性。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146836B_ABST
    Figure CN122146836B_ABST
Patent Text Reader

Abstract

The present application belongs to the technical field of ankylosing spondylitis treatment drug screening, and particularly relates to a method for constructing an ankylosing spondylitis drug screening system targeting an ALKBH5 / CircRNA_0001543 / RIP1 combination, comprising the following steps: S1, building an inflammation model: co-culturing peripheral blood mononuclear cells of an ankylosing spondylitis patient with human fibroblast-like synoviocytes; S2, detecting the regulation effect of a candidate drug on a core target combination: the core target combination is ALKBH5, CircRNA_0001543 and RIP1; S3, determining the drug efficacy according to the change in cytokine content: detecting the change in the content of pro-inflammatory factors and anti-inflammatory factors in the supernatant of the co-cultured cells to determine the anti-inflammatory activity of the candidate drug. By using the method, the present application precisely simulates the in-vivo inflammatory microenvironment, solves the defect that the existing model cannot reflect the synergistic regulation of the target points, and improves the pertinence and reliability of drug screening.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of drug screening technology for the treatment of ankylosing spondylitis, and particularly relates to a method for constructing a drug screening system for ankylosing spondylitis targeting the ALKBH5 / CircRNA_0001543 / RIP1 combination. Background Technology

[0002] Ankylosing spondylitis (AS) is an immune-mediated chronic inflammatory disease characterized by inflammation of the spine and sacroiliac joints. It commonly affects young adults and is characterized by slow progression and high refractoryity. In severe cases, it can lead to spinal ankylosis and deformity, significantly reducing patients' quality of life. Current clinical treatment relies on nonsteroidal anti-inflammatory drugs (NSAIDs) and biologics, but existing drugs have limited efficacy and are prone to drug resistance. The core reason lies in the critical flaws in the drug development screening system, making it difficult to identify highly effective drugs that regulate inflammation at its root. Therefore, developing precise and efficient AS drug screening technologies is an urgent need in this field.

[0003] In the field of AS drug screening, existing technologies mainly focus on single cytokines downstream of inflammation (such as TNF-α and IL-1β) as screening targets, and judge drug efficacy by detecting the inhibitory effect of candidate drugs on single targets. Although these methods can quickly obtain preliminary screening results, they have significant limitations: On the one hand, target selection only touches the downstream links of the inflammatory response and does not delve into the upstream core regulatory chain of inflammation, resulting in most screened drugs being "symptomatic treatments" that cannot fundamentally block the inflammatory cascade response. Long-term use is prone to drug resistance, making it difficult to achieve long-term disease control. On the other hand, existing screening models mostly use single cells (such as synovial cells or immune cells) for in vitro culture, which fails to simulate the complex inflammatory microenvironment of "interaction between immune cells and synovial cells" in AS, and cannot reflect the synergistic regulatory relationship between targets, resulting in low screening efficiency and poor targeting and efficacy of candidate drugs after entering clinical trials.

[0004] In summary, existing AS drug screening technologies suffer from dispersed targets and inaccurate model simulations, making it difficult to meet the clinical demand for highly effective and fundamental therapeutic drugs. There is an urgent need in this field for a drug screening system that can target the core regulatory chain upstream of inflammation, accurately simulate the in vivo inflammatory microenvironment, and reflect the synergistic effects of targets, so as to improve the efficiency and specificity of AS drug screening and provide technical support for the development of new therapeutic drugs that address both the symptoms and the root cause. Summary of the Invention

[0005] The purpose of this invention is to provide a method for constructing a drug screening system for ankylosing spondylitis targeting the ALKBH5 / CircRNA_0001543 / RIP1 combination, in order to solve the above-mentioned problems.

[0006] To achieve the above objectives, the present invention provides the following solution: A method for constructing a drug screening system targeting the ALKBH5 / CircRNA_0001543 / RIP1 combination for ankylosing spondylitis includes the following steps: S1, establishing an inflammation model: co-culturing peripheral blood mononuclear cells from ankylosing spondylitis patients with human fibroblast-like synovial cells; S2, detecting the regulatory effect of candidate drugs on the core target combination: the core target combination is ALKBH5, CircRNA_0001543 and RIP1; S3, determining drug efficacy based on changes in cytokine levels: detecting changes in the levels of pro-inflammatory and anti-inflammatory factors in the supernatant of co-cultured cells to determine the anti-inflammatory activity of candidate drugs.

[0007] Preferably, in step S1, the co-culture ratio of peripheral blood mononuclear cells from ankylosing spondylitis patients to human fibroblast-like synovial cells is 5:1, and the co-culture time is 48 hours.

[0008] Preferably, in step S1, the co-culture is performed in a Transwell chamber, and the seeding density of peripheral blood mononuclear cells from ankylosing spondylitis patients in the upper chamber is 5 × 10⁻⁶. 5 The seeding density of human fibroblast-like synovial cells in the lower chamber was 1 × 10⁶ cells / mL. 5 The cells / mL were cultured at 37°C with 5% carbon dioxide.

[0009] Preferably, in step S2, the detection of the regulatory effect of the candidate drug on the core target combination includes the following indicators: a) detecting the inhibitory effect of the candidate drug on ALKBH5 expression; b) detecting the effect of the candidate drug on increasing the N6-adenosine methylation modification level and RNA stability of CircRNA_0001543; c) detecting the blocking effect of the candidate drug on the binding of CircRNA_0001543 to RIP1 and the inhibitory effect on the activation of the nuclear factor κB pathway.

[0010] Preferably, in indicator a), the messenger RNA expression of ALKBH5 is detected by reverse transcription real-time quantitative polymerase chain reaction, and the protein expression of ALKBH5 is detected by Western blotting; in indicator b), the N6-adenosine methylation modification level of CircRNA_0001543 is detected by methylated RNA immunoprecipitation-polymerase chain reaction, and the stability of CircRNA_0001543 is assessed by detecting the RNA half-life after incubation with actinomycin D; in indicator c), the binding blocking effect of CircRNA_0001543 to RIP1 is verified by RNA pull-down assay and RNA immunoprecipitation-polymerase chain reaction, and the distribution of p65 protein and the expression of RIP1 and IκBα proteins in the cytoplasm and nucleus are detected by Western blotting to verify the inhibitory effect of nuclear factor κB pathway activation.

[0011] Preferably, in step S3, the efficacy judgment criteria are: after intervention with the candidate drug, the content of pro-inflammatory factors decreases by ≥40% and the content of anti-inflammatory factors increases by ≥35%, which is to be judged as an effective drug with potential anti-inflammatory activity.

[0012] Preferably, the pro-inflammatory factors include interleukin-1β and tumor necrosis factor α, and the anti-inflammatory factors include interleukin-10 and interleukin-37.

[0013] Preferably, in step S3, the cytokine content is detected by enzyme-linked immunosorbent assay (ELISA). The specific operation includes: collecting the supernatant of co-cultured cells, centrifuging at 1000 rpm for 10 minutes, adding 100 μL of diluent to the ELISA plate, incubating at 37°C for 1.5 hours, measuring the absorbance at 450 nm using an ELISA reader, and calculating the cytokine concentration using a standard curve.

[0014] Preferably, serum containing Scutellaria baicalensis heat-clearing and pain-relieving capsules was used as a positive control during the screening process.

[0015] Compared with the prior art, the present invention has the following advantages and technical effects: This invention accurately simulates the in vivo inflammatory microenvironment, overcoming the shortcomings of existing models that cannot reflect the synergistic regulation of targets, and improving the targeting and reliability of drug screening; it targets a combination of core upstream targets of inflammation, breaking through the limitations of a single downstream target, avoiding drug resistance, and facilitating the development of long-acting drugs; through triple targeting indicators and quantitative efficacy standards, it forms a complete screening closed loop, significantly improving screening efficiency and the accuracy of candidate drug activity verification. Attached Figure Description

[0016] Figure 1 This is a graph showing the optimal culture ratio and time for the co-culture model of AS-PBMCs and FLSs. Figure 1In the figure, A is a line graph showing the expression of inflammatory factors under different co-culture ratios (0:1, 1:1, 2.5:1, 5:1, 10:1) and times (12h, 24h, 48h), which shows the results of screening for the optimal culture ratio and time. Figure 1 B in the figure is a bar chart of cell viability levels under the optimal culture ratio (5:1) and time (48h).

[0017] Figure 2 The graph shows the transfection efficiency of siRNA interference and overexpression plasmids for ALKBH5, CircRNA_0001543, and RIP1. Figure 2 In the figure, A represents the bar chart showing the effect of various interfering fragments of si-ALKBH5 on ALKBH5 mRNA expression; Figure 2 B in the figure is a bar chart showing the effect of each interfering fragment of si-CircRNA_0001543 on the expression of CircRNA_0001543 RNA; Figure 2 In the figure, C represents the bar chart showing the effect of each si-RIP1 interference fragment on RIP1 mRNA expression; Figure 2 In the bar chart, D represents the effect of OE-ALKBH5 on ALKBH5 mRNA expression; Figure 2 In the bar chart, E represents the effect of OE-CircRNA_0001543 on CircRNA_0001543 RNA expression; Figure 2 F in the figure represents the bar chart showing the effect of OE-RIP1 on RIP1 mRNA expression.

[0018] Figure 3 This is a validation diagram of the binding relationship between CircRNA_0001543 and RIP1, in which... Figure 3 In the figure, A is a bar chart showing the content of Circ RNA_0001543 in RIP1 enrichment detected by RIP-qPCR; Figure 3 B in the image is a silver staining image of RIP1 after the RNA pull-down experiment; Figure 3 C in the diagram represents the protein expression band of RIP1.

[0019] Figure 4 The image shows the expression levels of ALKBH5 mRNA, total m6A, circRNA_0001543 RNA, and circRNA_0001543m6A in co-cultured FLSs. Figure 4 In the figure, A represents the bar chart of ALKBH5 mRNA expression level; Figure 4 B in the figure represents the overall m6A modification level in a bar chart; Figure 4 In the figure, C represents the bar chart of Circ RNA_0001543 RNA expression level; Figure 4The bar chart shows the D in the CircRNA_0001543m6A modification level.

[0020] Figure 5 This is a diagram showing the effect of ALKBH5 interference / overexpression on downstream target mRNA and protein expression in co-cultured FLSs. Figure 5 The AE in the figure represents the bar chart of expression levels of ALKBH5, CircRNA_0001543, RIP1, IκBα, and p65 mRNA; Figure 5 F in the diagram represents the protein bands of p65 in the nucleus, p65 in the cytoplasm, ALKBH5, RIP1, and IκBα. Figure 5 The GK bars in the graph represent the corresponding protein expression quantification.

[0021] Figure 6 This is a diagram showing the effect of interference / overexpression of CircRNA_0001543 on the expression of downstream target mRNA and protein in Co-cultured FLSs. Figure 6 The AD in the figure represents the bar chart of expression levels of CircRNA_0001543, RIP1, IκBα, and p65 mRNA; Figure 6 The bars E, F, H, and I in the graph represent the corresponding protein expression quantifications. Figure 6 G in the diagram represents the protein bands of p65 in the nucleus, p65 in the cytoplasm, RIP1, and IκBα.

[0022] Figure 7 This is a diagram showing the effect of RIP1 interference / overexpression on downstream target mRNA and protein expression in co-cultured FLSs. Figure 7 The AC in the figure represents the bar chart of RIP1, IκBα, and p65 mRNA expression levels. Figure 7 The DG in the graph represents the bar chart for quantifying the expression of the corresponding protein; Figure 7 The H in the diagram represents the protein bands of p65 in the nucleus, p65 in the cytoplasm, RIP1, and IκBα.

[0023] Figure 8 Line graph showing the effect of interference / overexpression of ALKBH5 on the RNA stability of CircRNA_0001543, illustrating the changes in the relative expression level of CircRNA_0001543 RNA after treatment with actinomycin D for different times (0h, 2h, 4h, 8h).

[0024] Figure 9 The figure shows the effect of ALKBH5 interference / overexpression on the proliferation and cytokine levels of co-cultured FLSs cells. Figure 9In the image, A represents EDU fluorescence staining (DAPI staining of cell nuclei, EDU-Click labeling of proliferating cells, and Merge is a merged image). Figure 9 The BE in the figure is a bar chart showing the levels of IL-1β, TNF-α, IL-10, and IL-37.

[0025] Figure 10 The figure shows the effect of interference / overexpression of Circ RNA_0001543 on the proliferation and cytokine levels of co-cultured FLS cells. Figure 10 In the image, A represents EDU fluorescence staining (DAPI staining of cell nuclei, EDU-Click labeling of proliferating cells, and Merge is a merged image). Figure 10 The BE in the figure is a bar chart showing the levels of IL-1β, TNF-α, IL-10, and IL-37.

[0026] Figure 11 The figure shows the effect of RIP1 interference / overexpression on the proliferation and cytokine levels of co-cultured FLS cells. Figure 11 In the image, A represents EDU fluorescence staining (DAPI staining of cell nuclei, EDU-Click labeling of proliferating cells, and Merge is a merged image). Figure 11 The BE in the figure is a bar chart showing the levels of IL-1β, TNF-α, IL-10, and IL-37.

[0027] Figure 12 The bar chart shows the effect of HQC-containing serum on the levels of cytokines IL-1β, TNF-α, IL-10, and IL-37 in co-cultured FLSs. Figure 12 In the figure, A represents the bar chart of IL-1β content; Figure 12 B in the chart represents the bar chart of TNF-α content; Figure 12 The bar chart with C in it represents the IL-10 content; Figure 12 The bar chart with D in it represents the IL-37 content. Detailed Implementation

[0028] Example 1: This example provides a drug screening system for AS with the "ALKBH5 / CircRNA_0001543 / RIP1 combination" as the core target, wherein: a) ALKBH5 is a demethyltransferase, and its expression inhibition can increase the N6-adenosine methylation modification and RNA stability of CircRNA_0001543; b) CircRNA_0001543 is a circular non-coding RNA that can specifically bind to RIP1; c) RIP1 is a key adaptor protein in the nuclear factor κB signaling pathway, and its activation can promote the release of pro-inflammatory factors.

[0029] The specific steps include: S1. Building a precise inflammation model Cell preparation: Peripheral blood mononuclear cells (AS-PBMCs) were extracted from peripheral blood of patients with AS damp-heat obstruction syndrome. 5 mL of blood was aseptically collected using EDTA-K2 anticoagulant tubes and separated by Ficoll density gradient centrifugation (550g×20min for stratification, followed by washing twice at 250g×10min). The cells were then cryopreserved in liquid nitrogen for later use. After resuscitation, human rational fibroblast-like synovial cells (FLSs) were expanded in DMEM medium containing 10% fetal bovine serum in a 5% CO2 incubator. When the confluence reached 70%, they were passaged at a 1:2 ratio. Construction of co-culture system: AS-PBMCs and FLSs were seeded in Transwell chambers at a cell ratio of 5:1, and AS-PBMCs (5 × 10⁶ cells / year) were added to the upper chamber. 5 FLSs (1×10⁻⁶ cells / mL) were added to the lower chamber. 5 Cells (number / mL) were co-cultured in a 37℃, 5% CO2 incubator for 48 h to construct a cell model simulating the inflammatory microenvironment in vivo for AS.

[0030] S2. Set triple screening criteria for detection. Indicator 1: ALKBH5 expression detection: ALKBH5 mRNA expression in cells was detected by RT-qPCR (primer sequences: Forward: TCTGCACTTGGTTGAGGTCT, Reverse: AGGGTGTTTGCATGAGCTTG), and ALKBH5 protein expression was detected by Western blot (primary antibody dilution ratio 1:500) to verify the inhibitory effect of candidate drugs on ALKBH5. Indicator 2: CircRNA_0001543 Regulation Detection: The m6A modification level of CircRNA_0001543 was detected by MeRIP-qPCR (primer sequences: Forward: CATTCCACCAATTCCCGTTGG (SEQ ID NO.5), Reverse: ACACTGCTGGGGTTTTCTTCT (SEQ ID NO.6)). The RNA half-life was measured after incubation with radiobin D (1 μM) for 0 h, 2 h, 4 h, and 8 h to assess stability and verify the effect of the candidate drug on increasing m6A modification and stability. Indicator 3: RIP1 binding and NF-κB pathway detection: RNA pulldown assay and RIP-qPCR were used to verify the blocking effect of candidate drugs on the binding of CircRNA_0001543 to RIP1; Western blot was used to detect the distribution of p65 protein in cytoplasm / nucleus and the expression of RIP1 and IκBα proteins (primary antibody dilution ratio 1:500) to verify the inhibitory effect on NF-κB pathway activation.

[0031] S3. Clarify the criteria for judging drug efficacy. Cytokine detection: The levels of IL-1β, TNF-α (pro-inflammatory factor), IL-10, and IL-37 (anti-inflammatory factor) in the supernatant of co-cultured cells were detected by ELISA. The procedure was as follows: the supernatant was collected by centrifugation at 1000 rpm for 10 minutes, 100 μL of dilution buffer was added to the ELISA plate, and the plate was incubated at 37°C for 1.5 hours. The absorbance was measured at 450 nm using an ELISA reader, and the concentration was calculated using a standard curve. Judgment criteria: Using the clinically effective drug Scutellaria baicalensis Qingre Chubi Capsule (HQC) containing serum (30% concentration) as a positive control, when the candidate drug intervention simultaneously meets the following conditions, it is judged to be an effective drug with potential anti-inflammatory activity: IL-1β content decreased by ≥40%, TNF-α content decreased by ≥40%, IL-10 content increased by ≥35%, and IL-37 content increased by ≥35%. Statistical validation: Data analysis was performed using SPSS 22.0 software. The t-test or ANOVA was used for comparisons between groups. P < 0.01 was considered to be statistically significant.

[0032] The following analysis and experiments will be conducted based on the steps in Example 1. Example 1 was designed to verify the in vitro environment that most closely resembles the inflammatory environment in the screened AS patients. Examples 2-13 will verify the core target of the "ALKBH5 / CircRNA_0001543 / RIP1 combination". 1. Experimental materials used in each test case: 1.1 Cell Source AS-PBMCs were obtained from peripheral blood samples of 30 hospitalized patients with AS and damp-heat obstruction syndrome collected in Study 1. Physiological FLSs were purchased from Wuhan Pronosei Biotechnology Co., Ltd., and had STR identification reports. All subjects gave informed consent, and the study protocol was approved by the Ethics Committee of the First Affiliated Hospital of Anhui University of Traditional Chinese Medicine (Approval No.: 2023AH-52).

[0033] 2.1 Main Instruments

[0034] 1.3 Reagents

[0035] Experimental Example 1: This experimental example aims to provide a co-culture model simulating AS inflammation. The specific model construction method is as follows: S1. Extraction and separation of peripheral blood mononuclear cells (PBMCs) Five mL of venous blood was aseptically collected from healthy volunteers or patients with ankylosing spondylitis (AS) using EDTA-K2 anticoagulant tubes. Blood collection was performed strictly in accordance with biosafety protocols. The separation medium and blood sample were added sequentially to 15 mL conical centrifuge tubes at a 1:1 ratio, followed by centrifugation at 550 g for 20 minutes to achieve cell separation. After centrifugation, the ring-shaped milky-white lymphocyte layer was collected and transferred to a new centrifuge tube. 10 mL of PBS was added to mix the cells, followed by centrifugation at 250 g for 10 minutes, and the supernatant was discarded. This process was repeated twice to collect peripheral blood mononuclear cells (PBMCs), which were then aliquoted and stored in liquid nitrogen for later use.

[0036] S2. Resuscitation, passage, and cryopreservation of human fibroblast-like synovial cells (FLSs) Cell resuscitation: After being removed from the cryopreservation tubes by liquid nitrogen, they were immediately immersed in a 37°C water bath with shaking for rapid thawing. Gradient centrifugation (1500 rpm × 5 min) was used to remove any residual cryoprotectant. Cells were resuspended in DMEM medium containing 10% FBS, seeded in T25 culture flasks, and subjected to primary amplification in a 5% CO2 incubator. Cell passage: Cells were dynamically observed using an inverted microscope. When cell confluence reached 70%, the culture medium was discarded, and the cells were washed twice with PBS. Then, trypsin was added to digest the cells; when round, granular cells were observed, 2 mL of complete culture medium was added to stop the digestion. Cells were passaged at a 1:2 ratio, with a 48-hour culture medium refresh cycle. Cell cryopreservation: Centrifuge and discard the supernatant, then resuspend the cells in 4 mL of PBS. Prepare a cryopreservation solution using complete culture medium, FBS, and DMSO in a 5:4:1 ratio to resuspend the cells. When the cell count reaches 2 × 10⁵ cells / mL, aliquot the cells and incubate overnight at -80°C before transferring them to liquid nitrogen for storage.

[0037] S3, AS-PBMCs and FLSs co-culture AS-PBMCs were co-cultured with FLSs at different ratios: 0:1, 1:1, 2.5:1, 5:1, and 10:1. The effect of different quantities of AS-PBMCs on FLS cell viability was evaluated using the CCK8 assay at 12, 24, and 48 hours.

[0038] The test results are as follows Figure 1As shown, when AS-PBMCs and FLSs were co-cultured at a 5:1 ratio, the FLSs showed significantly better performance compared to other cell ratios at the same culture time, with **p<0.01. At a cell ratio of 5:1, compared to other time points, ##p<0.01. Compared to the FLSs group, **p<0.01.

[0039] Quantitative analysis based on TNF-α showed that the peak expression of inflammatory factors in the 5:1 ratio group at 48 h was significantly higher than that in other ratio groups (p<0.01). This data indicates that the pro-inflammatory effect of AS-PBMCs on FLSs is dose- and time-dependent. After comprehensive evaluation, a 5:1 cell ratio and a culture time of 48 h were determined to be the optimal interaction conditions. Subsequent experiments all used this culture ratio and time. Figure 1 (A in the text), and under this condition, the cell viability of the co-cultured cells was further detected ( Figure 1 (B in the middle).

[0040] Based on the comprehensive experimental results, the highest TNF-α content (p<0.01) was observed when AS-PBMCs and FLSs were co-cultured at a ratio of 5:1 for 48 hours, and the cell viability met the experimental requirements, thus determining it as the optimal co-culture condition.

[0041] Example 2: The purpose of this experiment is to synthesize overexpression plasmids and small interfering RNA (siRNA) targeting ALKBH5, CircRNA_0001543, and RIP1, and to detect their transfection efficiency in co-cultured cells. The aim is to screen for the tool fragment with the best regulatory effect, laying the foundation for subsequent specific regulation of core target expression and validation of target function. Specifically, this includes: S1, Synthesis of Overexpression Plasmids and Small Interfering RNA The overexpression plasmids and small interfering RNAs (siRNAs) used in this experiment were designed and synthesized by Sangon Biotech. The detailed sequences of the siRNAs are shown in the table below (some contain dT / dT chemical modifications at the 3' end and are not listed in the sequence listing):

[0042] S2, transfection with overexpression plasmid and small interfering RNA Overexpression plasmid group: Dilute 5 μL (1 mg / mL) of the overexpression plasmid and the negative control (OE-NC) separately in 250 μL of Opti-MEM medium and gently vortex to mix.

[0043] siRNA group: 100 pmol siRNA and siRNA-NC (si-NC) were treated in the same way.

[0044] Preparation of transfection reagent working solution: Mix 10 μL of Lipofectamine 2000 with 1000 μL of Opti-MEM and incubate at room temperature for 5 min.

[0045] The nucleic acid solution and transfection reagent were mixed at a volume ratio of 1:4 and allowed to stand at room temperature for 20 min to complete complex assembly. The mixed culture medium (500 μL) was added to 6-well plates and cultured for 4 hours. The culture medium was then replaced with complete medium, and the cells were cultured for another 48 hours. Cells were collected after transfection, and gene expression levels were detected by reverse transcription real-time quantitative PCR to assess transfection efficiency. The optimal interference fragment was selected for subsequent experiments based on the interference effect.

[0046] For the purposes of subsequent explanations, the overexpression plasmid and siRNA provided in this experimental example will be named as follows: ① The plasmid for ALKBH5 overexpression (OE) is called OE-ALKBH5, and the corresponding siRNAs are called si-ALKBH5-1, si-ALKBH5-2, and si-ALKBH5-3. The negative control plasmid for overexpression is named OE-NC, and the negative control plasmid for siRNA is named si-NC.

[0047] ② The overexpression plasmid for CircRNA_0001543 is named OE-CircRNA_0001543, and the corresponding siRNAs are named si-CircRNA_0001543-1, si-CircRNA_0001543-2, and si-CircRNA_0001543-3. The negative control plasmid for overexpression is named OE-NC, and the negative control plasmid for siRNA is named si-NC.

[0048] ③ The overexpression plasmid for RIP1 is called OE-RIP1, and the corresponding siRNAs are called si-RIP1-1, si-RIP1-2, and si-RIP1-3. The negative control plasmid for overexpression is named OE-NC, and the negative control plasmid for siRNA is named si-NC.

[0049] The test results are as follows Figure 2 As shown, the results indicated that compared with si-NC, the expression levels of si-ALKBH5 (1, 2, 3), si-CircRNA_0001543 (1, 2, 3), and si-RIP1 (1, 2, 3) were all decreased (p < 0.01), with the most significant decreases observed in the si-ALKBH5-2, si-CircRNA_0001543-3, and si-RIP1-3 groups (p < 0.01). Figure 2Since the expression of OE-ALKBH5-2, si-CircRNA_0001543-3, and si-RIP1-3 was higher than that of OE-NC, the expression of OE-ALKBH5, OE-CircRNA_0001543, and OE-RIP1 was increased (p<0.01). Figure 2 (DF in the text).

[0050] The above experiments show that the overexpression plasmids and siRNAs were successfully constructed and transfected. The interference efficiency of si-ALKBH5-2, si-CircRNA_0001543-3, and si-RIP1-3 was the most significant (p<0.01), and the overexpression efficiency of OE-ALKBH5 / OE-CircRNA_0001543 / OE-RIP1 was significant (p<0.01), and they were selected as tools for subsequent experiments.

[0051] Example 3: This experiment aims to screen and specifically validate downstream proteins that can bind to CircRNA_0001543, clarifying the "functional partner" of CircRNA_0001543 in exerting its anti-inflammatory effect, and providing direct evidence for further elucidating the target interaction mechanism. Specifically, it includes: S1. Probe Synthesis The positive and negative (NC) biotin-labeled probes were synthesized by Guangzhou Bosun Biotechnology Co., Ltd. The synthesized probe sequences were verified by sequencing. The probe primer sequences are as follows:

[0052] S2, RNA pull-down experiment The steps for performing a pull-down experiment using the RNA pull-down kit are as follows: (1) Extraction of total cell protein: Wash the cell suspension with PBS at pH 7.4, remove the culture medium, add 1.7 mL RIP buffer and 17 μL protease inhibitor, shake on ice for 10 minutes, vortex to mix, freeze at -80℃ for 10 minutes, thaw on ice and centrifuge for 15 minutes, and transfer the supernatant to a new RNase-free centrifuge tube. (2) Removal of nucleic acid and pre-washing of protein samples: Add 20 μL LDNase and 8.5 μL LDNase salt solution to the above protein samples and incubate at 25°C for 1 hour; add 40 μL agarose beads, 8.5 μL LEDTA, 3.4 μL LEGTA and 17 μL LDT, and rotate at 4°C for 30 minutes; centrifuge at 5000g for 1 minute at room temperature and collect the supernatant; take 100 μL of supernatant as the Input group, and divide the remaining supernatant into RPD and NC tubes at 0.8 mL / tube, and store at -80°C. (3) Constructing RNA secondary structure: Take the corresponding RNA probe and NC probe according to the length mass ratio of 1μg / 1000nt, add RNase-free water to make up to 30 μL, incubate at 90℃ for 2 minutes; incubate on ice for 2 minutes; add 50 μL RNA structure buffer and 20 μL RNase-free water; incubate at room temperature for 20 minutes. (4) Preparation of probe-magnetic bead complex: Take 40 μL of streptavidin magnetic beads and place them in two RNase-free centrifuge tubes. Add 1 mL of 1×TES buffer to wash the magnetic beads, let stand for 1 minute, and remove the TES washing buffer. Add 100 μL of RNA probe, 100 μL of RNase-free water, and 200 μL of 2×TES to the magnetic beads, incubate at 25℃ for 30 minutes, let stand for 1 minute, and remove the supernatant. Add 0.5 mL of 1×TES to wash the magnetic beads, let stand for 1 minute, and remove the washing buffer. Repeat the operation once. (5) RNA pull-down: The probe-magnetic bead complex was mixed with the cell extract, and 5 μL of RNase inhibitor and 5 μL of yeast tRNA were added respectively. The mixture was kept at room temperature (25°C) for 2 hours. After standing for 1 minute, the magnetic beads were collected and the supernatant was removed. 1 mL of ice-cold NT2 buffer was added, and the mixture was washed at 4°C for 5 minutes. After standing for 1 minute, the magnetic beads were collected and the supernatant was removed. This process was repeated 4 times. (6) Elution of protein products: For RPD and NC group magnetic beads, add 60 μL of protein elution buffer and 0.6 μL of LTT respectively, incubate at 37℃ for 2 hours, let stand for 1 minute to collect the magnetic beads; store protein samples at -80℃. Specific reagents are as follows:

[0053] S3, Protein Silver Staining Detection The specific steps for performing silver staining experiments on proteins using a rapid silver staining kit are as follows: (1) Prepare SDS-PAGE gel according to the following standards:

[0054] (2) Sample loading and electrophoresis: Protein samples were loaded onto SDS-PAGE gel wells. Separating gel voltage was 120 volts for 1 hour; stacking gel voltage was 80 volts for 30 minutes. (3) Fixation steps: After electrophoresis, the gel is peeled off, rinsed with water, and deionized water is added. Shake at room temperature for 5 minutes; deionized water is added, fixative is added, and shake at room temperature for 30 minutes; fixative is removed, 100 ml of 30% ethanol is added, and shake at room temperature for 10 minutes; 30% ethanol is removed, 200 ml of deionized water is added, and shake at room temperature for 10 minutes.

[0055] (4) Sensitization step: Pour out the water, add 100 ml of silver staining sensitization solution, shake at room temperature for 2 minutes; discard the original solution, add 200 ml of deionized water, shake at room temperature for 1 minute. (5) Silver staining steps: Pour out the water, add 100 ml of silver solution, shake at room temperature for 10 minutes, and set the speed to 65 rpm; discard the original solution, add 100 ml of deionized water, and shake at room temperature for 1.3 minutes. (6) Color development process: Discard the water, add 100 ml of silver staining solution, shake at room temperature for 5 minutes until the ideal protein band is formed. (7) Termination steps: Pour out the silver staining developer, add 100 ml of silver staining termination solution, and shake at room temperature for 10 minutes; discard the silver staining termination solution, add 100 ml of deionized water, and shake at room temperature for 5 minutes. (8) The shooting record is available for inspection.

[0056] S4, Western blot verification (1) Prepare SDS-PAGE gels using the same standards as S3; (2) Sample loading: Protein samples are loaded into the SDS-PAGE gel wells. Separating gel voltage is 120V for 1 hour; stacking gel voltage is 80V for 30 minutes. (3) Transfer membrane: Immerse filter paper and PVDF membrane of the same size as the gel strip in transfer buffer for 5 minutes; turn on the power and transfer membrane at a constant current of 300mA. (4) Blocking: After the transfer is complete, place the protein membrane in Western blotting buffer and rinse for 5 minutes. Remove the transfer buffer. Add 5% skim milk powder Western blocking buffer and block at room temperature for 2 hours. (5) Primary antibody incubation: Dilute the primary antibody at a ratio of 1:1000 according to the instructions; incubate overnight at 4°C, then wash with washing solution for 10 minutes each time, for a total of 3 washes.

[0057] (6) Secondary antibody incubation: Dilute the secondary antibody at a ratio of 1:5000 according to the instructions; incubate at room temperature for 2 hours, then wash with washing solution for 10 minutes each time, for a total of 3 washes.

[0058] (7) Protein detection: In a dark room, mix ECLA solution and ECLB solution in a centrifuge tube at a 1:1 ratio. Place the PVDF membrane protein side up in the center of the exposure plate, add the mixed ECL solution, and react for 1-2 minutes.

[0059] In the early stages, bioinformatics predictions were made using the RPISeq database (website: http: / / pridb.gdcb.iastate.edu / RPISeq) to predict the binding of CircRNA_0001543 to RIP1, showing a probability value of 0.85, indicating a strong interaction between CircRNA_0001543 and RIP1.

[0060] Then, in this experimental case, the RNA pull-down assay confirmed that RIP1 is the downstream target gene of CircRNA_0001543. Figure 3 (BC in CircRNA_0001543). The experimental results show that RIP1 is a specific downstream binding protein of CircRNA_0001543, and no other non-specific binding proteins are significantly enriched.

[0061] Example 4: The purpose of this example is to verify the specific binding relationship between CircRNA_0001543 and the target protein (RIP1) through reverse validation, eliminate interference from non-specific binding, further confirm the authenticity of their interaction, and enhance the reliability of the target interaction mechanism. Specifically, this includes: S1, RIP experiment (1) Cell lysis: Wash 2×10⁷ cell samples with 4 mL of PBS, centrifuge at 1000 rpm for 5 minutes at room temperature, and discard the supernatant. Add 1.7 mL of lysis buffer, 17 µL of protease inhibitor, and 7.5 µL of LRNase inhibitor to the cell pellet, place on ice for 10 minutes, vortex mix and freeze at -80°C for 5 minutes, and thaw at room temperature.

[0062] (2) DNA removal: Add 8.5 μL of DNase salt stock solution and 20 μL of DNase to cell lysis buffer and incubate at 37°C for 10 minutes; place on ice and add 9 μL of 0.5M EDTA, 3.6 μL of EGTA and 17 μL of DTT; centrifuge at 16,100 g for 10 minutes at 4°C, and transfer the supernatant to a new RNase-free centrifuge tube.

[0063] (3) Balance protein A / G magnetic beads: Prepare 40 µL of protein A / G beads, add 0.5 mL of lysis buffer to the magnetic beads, mix 10 times, collect the magnetic beads and discard the supernatant; add another 0.5 mL of lysis buffer, mix 10 times, collect the magnetic beads and discard the supernatant; add 40 µL of lysis buffer, and the magnetic beads are now balanced.

[0064] (4) Immunoprecipitation: Cell lysate samples were divided into three aliquots: IP, IgG, and Input. The Input sample was stored at -80℃ for later use. 3µg of RIP1 antibody and 3µg of IgG antibody were added to the IP and IgG samples, respectively, and incubated at 4℃ for 16 hours. 40 µL of protein A / G magnetic beads were evenly distributed to the IP and IgG samples, and incubated at 4℃ for 1 hour. The magnetic beads were collected and the supernatant was discarded. 0.5 mL of washing buffer 1 and 5 µL of DTT were added to the IP and IgG samples, respectively, and the samples were washed 3 times. The samples were incubated at 4℃ for 5 minutes, and the magnetic beads were collected and the supernatant was discarded. 0.5 mL of washing buffer 2 and 5 µL of DTT were added to the two samples, respectively, and the samples were washed 2 times. The samples were incubated at 4℃ for 5 minutes, and the magnetic beads were collected and the supernatant was discarded. 200 µL of elution buffer and 2 µL of DTT were added to the two samples, and 100 µL of elution buffer and 2 µL of DTT were added to the Input sample. The samples were incubated at 55℃ for 1 hour, and the magnetic beads were collected. The supernatant was transferred to a new RNase-free centrifuge tube. (5) RNA extraction: Add 600 µL Trizol to the supernatant, mix IP, IgG and Input samples for 15 seconds, and lyse at 4°C for 30 minutes; add 200 µL chloroform, mix for 15 seconds, centrifuge at 13000g at 4°C for 10 minutes, collect the upper aqueous phase and transfer to a new RNase-free centrifuge tube; add 1 µL glycogen, 10 µL sodium acetate and 500 µL 100% ethanol, mix thoroughly; precipitate the RNA sample at -80°C overnight; centrifuge at 16,100g at 4°C for 30 minutes, discard the supernatant; add 1 mL pre-cooled 80% ethanol, centrifuge at 16,100g at 4°C for 10 minutes, discard the supernatant, dry the RNA at room temperature and precipitate; add 15 µL RNase-free water to dissolve the RNA, and store at -80°C. The specific reagents used are as follows:

[0065] S2, reverse transcription (1) Add total RNA (1 µg) to a 0.5 mL EP tube, followed by adding the reactants in the following order:

[0066] (2) After the reaction solution is thoroughly mixed, it is centrifuged, then heated at 42°C for 2 minutes on a PCR instrument, and immediately subjected to an ice bath for 1 minute. (3) Extract cDNA from the above reaction solution and store it at -20℃ for later use.

[0067] S3, Real-time PCR reaction (1) Take out cDNA as the template for the quantitative fluorescence reaction, and prepare the reaction system as follows:

[0068] (2) Specific reaction conditions: Pre-denaturation at 95℃ for 1 minute, repeated once.

[0069] Denaturation at 95℃ for 20 seconds, annealing at 60℃ for 45 seconds, repeated 40 times.

[0070] The test results are as follows Figure 3 As shown, from Figure 3 The results of experiment A in this study show that, through RIP-qPCR, the content of CircRNA_0001543 in the RIP1 enrichment was significantly increased. Figure 3 The results in A) further confirm that RIP1 is a specific downstream binding protein of CircRNA_0001543, with no other non-specific binding proteins significantly enriched.

[0071] Example 5: This example aims to precisely quantify the specific content of m6A modification on CircRNA_0001543, clarify its methylation modification status, and provide direct data support for verifying the mechanism by which ALKBH5 affects CircRNA stability by downregulating this m6A modification. Specifically, it includes: S1, RNA extraction First, collect the cell pellet, add 1 mL of Trizol lysis buffer; add 0.2 mL of chloroform, vortex for 15 seconds, and incubate at room temperature for 5 minutes; centrifuge at 12,000 rpm for 10 minutes at 4°C, and transfer the supernatant to another EP tube; add 0.5 mL of pre-chilled isopropanol to the supernatant, mix well, and incubate on ice for 30 minutes; centrifuge at 12,000 rpm for 15 minutes at 4°C, and discard the supernatant; add 1 mL of pre-chilled 75% ethanol, centrifuge at 12,000 rpm for 5 minutes at 4°C, and discard the supernatant; dry the RNA pellet at room temperature, add 40 μL of DEPC water, and store at -80°C for later use.

[0072] S2, Immune capture and lysis Add the corresponding reagents to a 0.2 mL PCR tube according to the instructions to prepare the immunocapture solution. Mix thoroughly and vortex at room temperature for 90 minutes. Then, add 10 µL NDE and 2 µL CEM to each tube and incubate at room temperature for 4 minutes. Place the tubes on a magnetic rack until the solution becomes clear, and discard the supernatant. Keep the PCR tubes on the magnetic rack and wash each reaction tube three times with 150 µL washing buffer, and then wash once more with 150 µL PDB.

[0073] S3. RNA enrichment and release / recovery Prepare a protein digestion solution by mixing Proteinase K and PDB at a 1:10 ratio. Add 20 µL of the protein digestion solution to each sample and negative control, and incubate at 55°C for 15 minutes. Place the tubes on a magnetic rack. After the solution clarifies, transfer each sample solution to a new PCR tube. Add 20 µL of RPS to each sample and negative control tube, followed by 160 µL of anhydrous ethanol; add 25 µL of RPS to the input tube, followed by 200 µL of anhydrous ethanol. Add 2 µL of RNA binding beads to each tube and mix thoroughly at least 10 times. Incubate at room temperature for 5 minutes. Place the PCR tubes on a magnetic rack until the solution is clear, and discard the supernatant. Place the PCR tubes on a magnetic rack and add 150 µL of freshly prepared 90% ethanol, repeating once to complete two washes. Resuspend the beads in 13 µL of elution buffer and incubate at room temperature for 5 minutes to release RNA. Place the tubes on a magnetic rack to capture the beads until the solution is completely clear. Transfer 13 µL of each sample to a new 0.2 mL PCR tube and use or store at -20°C as needed.

[0074] S4, reverse transcription reaction (1) Add the reactants in the following order:

[0075] (2) After gentle mixing, centrifuge. Set the PCR instrument to react at 42°C for 20 minutes, then continue reacting at 75°C for 5 minutes.

[0076] (3) Extract cDNA from the above reaction solution and store at -20℃ for later use.

[0077] S5, Real-time PCR reaction (1) Take out cDNA as the template for the quantitative fluorescence reaction. The reaction system is as follows:

[0078] (2) Specific reaction conditions: Pre-denaturation at 95℃ for 1 minute, repeated once.

[0079] Denaturation at 95℃ for 20 seconds, annealing at 60℃ for 45 seconds, repeated 40 times.

[0080] (3) Primers used for detection indicators:

[0081] The test results are as follows Figure 4As shown in D, Experiment 5 demonstrated that the m6A modification level of CircRNA_0001543 was significantly lower in the Model group of PBMCs+FLSs co-cultured by AS patients compared with that in the Control group of PBMCs+FLSs co-cultured by normal individuals (p<0.01), confirming the abnormal downregulation of m6A modification of CircRNA_0001543 in the AS inflammation model. Experiment 6 will be set up below to supplement the completeness of the conclusion.

[0082] Experimental Example 6 The purpose of this experiment is to quantify the total amount of m6A modification in all RNAs in the cell, reflecting the global methylation regulatory state, complementing the m6A level of a single circRNA_0001543, to verify the global regulatory role of ALKBH5 in m6A modification, and to refine the mechanism verification logic. Specifically, this includes: S1. Preparation of starting materials: Add 200 ng of total RNA to an EP tube.

[0083] S2, Buffer and Solution Preparation (1) Original reagent list

[0084] (2) Buffer preparation: 1×WashBuffer: Add 13 mL of WB to 117 mL of distilled water. Diluted CA solution: Dilute CA by adding 1 µL of CA to 1000 µL of WB at a ratio of 1:1000. Approximately 50 µL of diluted CA is needed per well. Diluted DA solution: Dilute DA by adding 1 µL of DA to 2000 µL of WB at a ratio of 1:2000. Approximately 50 µL of diluted DA is needed per well. Diluted ES solution: Dilute ES by adding 1 µL of ES to 5000 µL of WB at a ratio of 1:5000. Approximately 50 µL of diluted ES is needed per well.

[0085] S3, RNA binding Remove any excess ELISA plates and store them at 4°C for later use. Add 80 µL of BS to each well. Add 2 µL of negative control (NC), 2 µL of diluted positive control (PC), and 250 ng RNA to each well, gently shaking the plate to ensure thorough mixing and uniform coverage of the bottom of the wells to maintain consistent results. Cover the plate with a plate sealer or M membrane and incubate at 37°C for 90 minutes. Then, remove the BS and wash each well with 150 µL of diluted Western blotting (WB), finally removing the WB. Repeat the washing step twice, for a total of three washes.

[0086] S4, m6A RNA capture Add 50 µL LCA to each well, then cap and incubate at room temperature for 60 minutes. During washing, remove the CA, wash each well with 150 µL diluted Western blotting (WB), and finally remove the WB. Repeat this step twice, for a total of three washes. Next, add 50 µL LDA to each well, cap and incubate at room temperature for 30 minutes. After removing the DA, add 50 µL LES to each well sequentially, cap and incubate at room temperature for 30 minutes, and finally remove the ES.

[0087] S5, Signal Detection Add 100 µLDS to each well and incubate at room temperature in the dark for 10 minutes, monitoring the color of the sample and control wells. At an appropriate m6A concentration, the DS solution is blue; when the color of the positive control well turns medium blue, add 100 µLDS to each well to stop the enzyme reaction; after adding SS, the color turns yellow, and the absorbance is read at 450 nm using a microplate reader within 2-15 minutes.

[0088] The test results are as follows Figure 4 As shown in B, compared with the Control group, the total amount of m6A modification in the total RNA of cells in the Model group was significantly reduced (p<0.01), which is consistent with the trend of m6A modification in CircRNA_0001543, suggesting that ALKBH5 has a global regulatory effect on intracellular m6A modification.

[0089] Experimental Example 7 This study aims to quantify the mRNA expression levels of core targets such as ALKBH5, CircRNA_0001543, and RIP1, as well as downstream genes, to clarify the expression changes and regulatory relationships of each target at the transcriptional level, providing gene-level evidence for target function validation. Specifically, it includes: S1, RNA extraction Cell pellets were collected from each experimental group, and 1 mL of Trizol lysis buffer was added. Then, 0.2 mL of chloroform was added, and the mixture was vigorously vortexed for 15 seconds and incubated at room temperature for 5 minutes. The pellets were centrifuged at 12,000 rpm for 10 minutes at 4°C, and the supernatant was collected and transferred to another EP tube. 0.5 mL of pre-chilled isopropanol was added, and the mixture was gently mixed and incubated on ice for 30 minutes. The pellets were centrifuged at 12,000 rpm for 15 minutes at 4°C, and the supernatant was discarded. This process was repeated twice, adding 1 mL of pre-chilled 75% ethanol, centrifuging at 12,000 rpm for 5 minutes at 4°C, and the supernatant was discarded. Finally, the RNA pellets were dried at room temperature, added to 40 μL of DEPC water, and stored at -80°C for later use.

[0090] S2, reverse transcription (1) Add total RNA (1µg) to a 0.2 mL EP tube, then add the reaction components in the following order, mix gently and then centrifuge briefly.

[0091]

[0092] (2) Heat at 42°C for 2 minutes on a PCR instrument, then immediately place on an ice bath for 1 minute.

[0093] (3) Add the corresponding reactants into the EP tube in the following order:

[0094] (4) Incubate the reaction system at 37°C for 15 minutes; then treat it at 85°C for 5 seconds. (5) After the reaction is complete, take out the above reaction solution to obtain cDNA, and store it at -20℃ for later use.

[0095] S3, Real-time PCR reaction (1) Take out cDNA as the template for real-time PCR, and prepare the reaction system as follows:

[0096] (2) Specific reaction conditions Pre-denaturation at 95℃ for 1 minute, repeated once.

[0097] Denaturation at 95℃ for 20 seconds, annealing at 60℃ for 45 seconds, repeated 40 times.

[0098] (3) Specific primers used:

[0099] S4. Result Calculation Using β-actin as an internal reference gene, through 2 -ΔΔCt The method assesses the relative expression level of the target gene.

[0100] The test results are as follows Figure 4 A, C, Figure 5 AE in Figure 6 AD in Figure 7 As shown in AC: 1. Baseline differences between the model group and the control group: Compared with the control group, the model group showed a significant increase in ALKBH5 mRNA and a significant decrease in CircRNA_0001543 RNA (p<0.01). Figure 4 (A, C) 2. Interference / overexpression of ALKBH5: Compared with the si-NC group, the si-ALKBH5 group showed a significant increase in CircRNA_0001543 mRNA and a significant decrease in ALKBH5, RIP1, IκBα, and p65 mRNA (p<0.01); compared with the OE-NC group, the OE-ALKBH5 group showed the opposite ( Figure 5 (AE in the text) 3. Interference / overexpression of CircRNA_0001543: Compared with the si-NC group, the si-CircRNA_0001543 group showed a significant decrease in CircRNA_0001543 mRNA and a significant increase in RIP1, IκBα, and p65 mRNA (p<0.01); compared with the OE-NC group, the OE-CircRNA_0001543 group showed the opposite ( Figure 6 (AD in the middle) 4. Interference / overexpression of RIP1: Compared with the si-NC group, the si-RIP1 group showed a significant decrease in RIP1, IκBα, and p65 mRNA (p<0.01); compared with the OE-NC group, the OE-RIP1 group showed the opposite ( Figure 7 AC in the middle.

[0101] Experimental Example 8 The purpose of this experiment is to quantify the expression levels of core target proteins (ALKBH5, RIP1, etc.) and downstream pathway proteins (p65, IκBα, etc.), while simultaneously determining the activation status (nuclear translocation) of key proteins (such as p65), verifying post-transcriptional protein-level functional changes, and refining the evidence chain for target regulation. Specifically, this includes: S1, Total Cell Protein Extraction After collecting the cells, 100 μL of RIPA cell lysis buffer (containing 1 mM PMSF) was added to each 6-well plate, and the cells were lysed on ice for 30 minutes. Then, the cells were centrifuged at 12,000 rpm for 15 minutes, and the supernatant was collected for subsequent analysis.

[0102] S2, electrophoresis (1) Preparation of SDS-PAGE gel

[0103] (2) Sample preparation: Add 5X SDS-PAGE protein loading buffer to the collected protein sample at a ratio of 1:4. Then, heat it in a boiling water bath for 10 minutes to ensure that the protein is fully denatured.

[0104] (3) Sample loading and electrophoresis: After the samples have cooled to room temperature, the protein samples are loaded directly into the wells of the SDS-PAGE gel. 30 micrograms of sample are added to each well. For the stacking gel, the voltage is 80 volts for 30 minutes; while for the separating gel, the voltage is set to 120 volts for 1 hour.

[0105] S3, Transfer Film Immerse pre-cut filter paper and PVDF membrane (soaked in methanol for 3 minutes) to the same size as the adhesive strip in the transfer buffer for 5 minutes. The assembly sequence of the transfer apparatus is: anode plate, three layers of filter paper, PVDF membrane, gel, three layers of filter paper again, and cathode plate. Ensure precise alignment of the filter paper, gel, and PVDF membrane, and remove air bubbles at each step. Connect the power supply and perform a constant current transfer of 300 mA.

[0106] S4, Closed After the transfer is complete, immediately place the protein membrane in the prepared Western blotting buffer (PBST buffer) and rinse for 5 minutes to remove the transfer buffer from the membrane. Next, add Western blotting buffer (5% skim milk powder; note: for phosphorylated proteins, use 5% BSA for blocking), and gently shake on a shaker at room temperature for 2 hours.

[0107] S5, primary antibody incubation According to the instructions for use of the primary antibody, dilute it with an appropriate dilution buffer and incubate overnight at 4°C with gentle shaking. Then, add washing buffer (PBST) and wash for 10 minutes each time, for a total of 3 washes.

[0108]

[0109] S6, Second Antibiotic Incubation According to the instructions for use of the secondary antibody, the horseradish peroxidase (HRP)-labeled secondary antibody was diluted with secondary antibody dilution buffer at a ratio of 1:10000 and incubated at room temperature for 2 hours. Then, washing buffer (PBST) was added, and each wash lasted 10 minutes, for a total of 3 washes.

[0110] S7, Protein Detection Mix ECLA and ECLB solutions in a 1:1 ratio in a centrifuge tube. Place the PVDF membrane, protein side up, in the center of the exposure plate of an automatic exposure unit. Add the mixed ECL solution to ensure a complete reaction. The reaction time is 1 to 2 minutes. Then remove excess liquid and adjust the exposure conditions according to different luminescence intensities.

[0111] S8. Result Interpretation The ImageJ software was used to analyze the stripes.

[0112] The test results are as follows Figure 5 FK in Figure 6 EI in Figure 7 As shown in DH, the experimental results illustrate: 1. Interference / overexpression of ALKBH5: Compared with the si-NC group, the si-ALKBH5 group showed increased cytoplasmic p65 and decreased nuclear p65, and significantly decreased ALKBH5, RIP1, and IκBα proteins (p<0.01); compared with the OE-NC group, the OE-ALKBH5 group showed the opposite. Figure 5 (FK in the middle) 2. Interference / overexpression of CircRNA_0001543: Compared with the si-NC group, the si-CircRNA_0001543 group showed decreased cytoplasmic p65, increased nuclear p65, and significantly increased RIP1 and IκBα proteins (p<0.01); compared with the OE-NC group, the OE-CircRNA_0001543 group showed the opposite ( Figure 6 (EI in the middle) 3. Interference / overexpression of RIP1: Compared with the si-NC group, the si-RIP1 group showed increased cytoplasmic p65, decreased nuclear p65, and significantly decreased RIP1 and IκBα proteins (p<0.01); compared with the OE-NC group, the OE-RIP1 group showed the opposite. Figure 7 (DH in the middle).

[0113] Experimental Example 9 This experiment aims to directly verify the regulatory role of ALKBH5 on the stability of CircRNA_0001543 RNA by blocking the synthesis of new RNA and tracking the degradation rate of CircRNA_0001543, thus clarifying the association between m6A modification and RNA stability. Specifically, it includes: In each group of cells, actinomycin D (1 μM) was added and incubated for 0 h, 2 h, 4 h, and 8 h, respectively. Total RNA was extracted from cells at different time points, and mRNA expression was detected using RT-qPCR. The amount of RNA obtained was then calculated. -ΔΔCt Values ​​are used to plot the fitted curve.

[0114] The test results are as follows Figure 8 As shown in the figure, the results indicate that after radiobinin D blocks the synthesis of new RNA, CircRNA_0001543 has stronger stability in cells that silence ALKBH5; after overexpression of ALKBH5, the half-life of CircRNA_0001543 mRNA is shortened and its stability is significantly reduced (p<0.01), confirming that ALKBH5 inhibits the stable expression of CircRNA_0001543 by downregulating the methylation level of CircRNA_0001543 m6A.

[0115] Experimental Example 10 The purpose of this study is to evaluate the viability of co-cultured cells under different treatment conditions (such as target regulation and drug intervention), verify the impact of target regulation or drugs on cell survival, and provide a basic reference for subsequent screening of drug safety and efficacy. Specifically, this includes: S1 and CCK8 assays for cell viability assessment After co-culturing AS-PBMCs and FLSs, FLSs were seeded at a density of 1×10⁵ cells / mL into 96-well plates, with 6 replicates per group, and incubated overnight. After 48 hours of incubation, 100 μL of CCK-8 solution was added to each well according to the CCK-8 reagent instructions, and incubated for 1 hour. Separate blank culture medium groups and separate CCK-8 solution groups were also prepared.

[0116] Finally, the absorbance of each well was measured at a wavelength of 450 nm using an ELISA reader.

[0117] The test results are as follows Figure 4 As shown, under the optimal co-culture conditions (5:1 ratio, 48h), the co-cultured cells (Co-cultured FLSs) exhibited normal viability and no excessive apoptosis. Compared with the FLSs group alone, the cell viability of the co-culture group was statistically significant (p<0.01), validating the effectiveness of the model construction.

[0118] Experimental Example 11 This study aims to detect changes in the proliferative capacity of co-cultured cells after regulation by core targets, clarify the effects of ALKBH5, CircRNA_0001543, and RIP1 on the proliferation of AS inflammation-related cells, and provide a basis for screening effective drugs that "inhibit the proliferation of inflammatory cells." Specifically, it includes: S1 and EDU-labeled cells After removing the treated cells from the 6-well plate, aspirate half of the old culture medium from each well, then add half a volume of 10µm MEDU solution and continue culturing for 6 hours.

[0119] S2, Cell fixation and permeabilization After removing the culture medium, add 4% formaldehyde PBS to each well and incubate at room temperature for 15 minutes, then remove the fixative; next, wash the cells three times with 3% BSA PBS for 5 minutes each time; after removing the supernatant, add 0.3% Triton-X-100 PBS and incubate at room temperature for 20 minutes.

[0120] S3, fluorescent labeling (1) Add the components in the following order to prepare the Click-iT reaction mixture (500 µL / well):

[0121] (2) Discard the supernatant and wash the cells three times with PBS containing 3% BSA for 5 minutes each time.

[0122] (3) Add 500 µL of Click-iT reaction mixture to each well and gently shake to ensure that the reaction solution evenly covers the cells. Incubate at room temperature in the dark for 30 minutes. Then remove the reaction mixture and wash the cells three times with 1 mL of PBS containing 3% BSA for 5 minutes each time.

[0123] S4, DNA staining Add 500 µL LDAPI to each well for nuclear staining.

[0124] S5, photography Observe and photograph the image using an inverted fluorescence microscope with an appropriate filter.

[0125] The test results are as follows Figure 9 A in Figure 10 A in Figure 11 As shown in A, it indicates that: 1. Interference with ALKBH5 reduced the relative number of EDU positive cells; overexpression of ALKBH5 increased the number of positive cells (p<0.01). Figure 9 (A in the middle) 2. Silencing circRNA_0001543 increased the number of positive cells; overexpressing circRNA_0001543 decreased the number of positive cells (p<0.01). Figure 10 (A in the middle) 3. Interference with RIP1 decreased the number of positive cells; overexpression of RIP1 increased the number of positive cells (p<0.01). Figure 11 The results (A) indicate that ALKBH5 and RIP1 promote the proliferation of co-cultured cells, while CircRNA_0001543 inhibits proliferation.

[0126] Experimental Example 12 The purpose of this experiment is to quantitatively detect the levels of pro-inflammatory factors (IL-1β, TNF-α) and anti-inflammatory factors (IL-10, IL-37) in the supernatant of co-cultured cells, directly reflecting changes in inflammation levels and providing core indicators for assessing the anti-inflammatory effects of target regulation or drugs. Specifically, this includes: S1. Enzyme-linked immunosorbent assay (ELISA) for cytokine detection. The experiments were conducted according to the operating instructions of the IL-1β, TNF-α, IL-10, and IL-37 kits provided by Quanzhou Ruixin Biotechnology Co., Ltd. First, the supernatant of the co-cultured cells was collected and centrifuged at 1000 rpm for 10 minutes.

[0127] Next, the ELISA plate was removed, and 100 μL of diluent was added to each well. The plate was then incubated at 37°C for 1.5 hours. Finally, the absorbance was measured at 450 nm using an ELISA reader. The specific levels of IL-1β, TNF-α, IL-10, and IL-37 were calculated by comparing with a standard curve.

[0128] The test results are as follows Figure 9 BE in Figure 10 BE in Figure 11 As shown in BE, it indicates that: 1. Interference with ALKBH5 decreased IL-1β and TNF-α, while increasing IL-10 and IL-37 (p<0.01); overexpression of ALKBH5 had the opposite effect. Figure 9 (BE in the text) 2. Overexpression of CircRNA_0001543 decreased IL-1β and TNF-α, while increasing IL-10 and IL-37 (p<0.01); interference had the opposite effect. Figure 10 (BE in the text) 3. Interference with RIP1 decreased IL-1β and TNF-α, while increasing IL-10 and IL-37 (p<0.01); overexpression of RIP1 had the opposite effect. Figure 11 (BE in the middle) In the above experimental examples 1-12, statistical analysis and graphical visualization were performed using software such as SPSS 22.0, GraphPad Prism 8, and Adobe Illustrator 2023. For measurement data conforming to the assumptions of normal distribution or homogeneity of variance, the data were presented as mean ± standard deviation. Comparisons between two groups were performed using unpaired t-tests, while comparisons between multiple groups were conducted using one-way ANOVA, with pairwise comparisons of the means between groups. For measurement data not conforming to normal distribution, the data were presented in the form of quartiles [M(Q25, Q75)], and nonparametric tests were used for analysis. A p-value less than 0.05 was considered statistically significant.

[0129] The above experimental examples 1-12 have demonstrated that, through model construction, tool molecule preparation, target interaction verification, modification level detection, and functional phenotypic analysis, the intrinsic regulatory logic and detectability of the triple screening indicators of "inhibiting ALKBH5 expression → increasing m6A modification and RNA stability of CircRNA_0001543 → blocking the binding of CircRNA_0001543 to RIP1 and inhibiting NF-κB pathway activation" have been systematically confirmed. This lays the core experimental foundation for the AS drug screening system targeting the "ALKBH5 / CircRNA_0001543 / RIP1 combination".

[0130] Experimental Example 13 This study aims to use serum containing the clinically effective traditional Chinese medicine compound Huangqin Qingre Chubi Capsules (HQC) as a positive control. The regulatory effects of HQC on IL-1β, TNF-α, IL-37, and IL-10 in co-cultured cell supernatant were detected by ELISA to clarify the proportion of cytokine changes corresponding to the effective drug. This will establish the efficacy criteria for screening AS drugs targeting the ALKBH5 / CircRNA_0001543 / RIP1 combination, specifically including: S1. Preparation of drug-containing (HQC) serum: Experimental animal grouping: 20 SPF-grade male SD rats (6-8 weeks old, weighing 180±20g) were randomly divided into a normal serum group and an HQC-containing serum group, with 10 rats in each group, and were acclimatized for 1 week; Gavage administration: The normal serum group was administered 0.9% saline by gavage at a dose of 2 mL / 100g, while the drug-containing serum group was administered HQC suspension by gavage at 20 times the clinical equivalent dose of HQC calculated from the human and rat body surface areas (0.648g / 100g), once daily for 7 consecutive days. Serum collection and processing: Two hours after the last administration, rats were anesthetized with sodium pentobarbital (50 mg / kg), blood was collected from the abdominal aorta, the serum was separated by centrifugation at 3000 rpm for 15 minutes, inactivated by water bath at 56℃ for 30 minutes, sterilized by 0.2 μm filter membrane, and stored at -80℃ for later use.

[0131] The HQC drug-containing serum contains active ingredients derived from Scutellaria baicalensis heat-clearing and pain-relieving capsules. These capsules are composed of five Chinese herbs—Scutellaria baicalensis, Gardenia jasminoides, Coix lacryma-jobi, Clematis chinensis, and Prunus persica—in a ratio of 10:9:30:10:5. The core active ingredients are baicalin, geniposide, amygdalin, and coixol (which have been identified by UHPLC-MS / MS technology).

[0132] S2. Establish efficacy assessment criteria using intervention data from HQC-containing serum: Experimental groups: Three cell models were set up: ① Control group (co-culture of normal human PBMCs and normal human FLSs); ② Model group (co-culture of AS patient PBMCs and normal human FLSs at a ratio of 5:1 for 48 h); ③ HQC-containing serum intervention group (10%, 20%, and 30% HQC-containing serum were added to the Model group, and cultured for 48 h). ELISA assay procedure: The experiment was conducted according to the instructions for the IL-1β, TNF-α, IL-10, and IL-37 kits provided by Quanzhou Ruixin Biotechnology Co., Ltd. First, the supernatant of co-cultured cells from each group was collected and centrifuged at 1000 rpm for 10 minutes. Next, the microplate was removed, and 100 μL of diluent was added to each well, and the plates were incubated at 37°C for 1.5 hours. Finally, the absorbance was measured at 450 nm using a microplate reader, and the specific levels of IL-1β, TNF-α, IL-10, and IL-37 were calculated by comparing with a standard curve. Judgment criteria established: The threshold for determining efficacy is defined based on the "proportion of significant changes in cytokines after intervention with clinically effective drugs (HQC)".

[0133] The test results are as follows Figure 12 As shown, compared with the Control group, the Model group showed significantly increased levels of IL-1β and TNF-α (p<0.001) and significantly decreased levels of IL-10 and IL-37 (p<0.001). Compared with the Model group, the 10%, 20%, and 30% HQC-containing serum groups all reduced IL-1β and TNF-α levels and increased IL-10 and IL-37 levels (p<0.05 or p<0.01), with the 30% HQC-containing serum group (optimal concentration) showing the most significant regulatory effect: IL-1β levels decreased by approximately 54%, TNF-α levels decreased by approximately 44%, IL-10 levels increased by approximately 37%, and IL-37 levels increased by approximately 37.5% (all p<0.001).

[0134] Based on the above results, the efficacy criteria for screening AS drugs targeting the ALKBH5 / CircRNA_0001543 / RIP1 combination were established as follows: after intervention with the candidate drug, the content of pro-inflammatory factors (IL-1β, TNF-α) in the supernatant of co-cultured cells decreased by ≥40% and the content of anti-inflammatory factors (IL-10, IL-37) increased by ≥35%, which was considered an effective drug with potential anti-inflammatory activity.

Claims

1. A method for constructing a drug screening system for ankylosing spondylitis targeting the ALKBH5 / CircRNA_0001543 / RIP1 combination, characterized in that, Includes the following steps: S1. Establishing an inflammation model: peripheral blood mononuclear cells from patients with ankylosing spondylitis were co-cultured with human fibroblast-like synovial cells; S2. Detect the regulatory effect of candidate drugs on the core target combination: the core target combination is ALKBH5, CircRNA_0001543 and RIP1; S3. Determine drug efficacy based on changes in cytokine levels: Detect changes in the levels of pro-inflammatory and anti-inflammatory factors in the supernatant of co-cultured cells to determine the anti-inflammatory activity of candidate drugs; In step S2, the detection of the regulatory effect of the candidate drug on the core target combination includes the following indicators: a) To detect the inhibitory effect of candidate drugs on ALKBH5 expression; b) Detect the effect of candidate drugs on increasing the N6-adenosine methylation modification level and RNA stability of CircRNA_0001543; c) Detect the blocking effect of candidate drugs on the binding of CircRNA_0001543 to RIP1 and the inhibitory effect on the activation of the nuclear factor κB pathway.

2. The method for constructing a drug screening system for ankylosing spondylitis targeting the ALKBH5 / CircRNA_0001543 / RIP1 combination according to claim 1, characterized in that: In step S1, the co-culture ratio of peripheral blood mononuclear cells from patients with ankylosing spondylitis to human fibroblast-like synovial cells was 5:1, and the co-culture time was 48 hours.

3. The method for constructing a drug screening system for ankylosing spondylitis targeting the ALKBH5 / CircRNA_0001543 / RIP1 combination according to claim 1, characterized in that: In step S1, co-culture was performed in a Transwell chamber, with the seeding density of peripheral blood mononuclear cells from ankylosing spondylitis patients in the upper chamber being [missing information]. The seeding density of human fibroblast-like synovial cells in the lower chamber was [number] cells / mL. The cells / mL were cultured at 37°C with 5% carbon dioxide.

4. The method for constructing a drug screening system for ankylosing spondylitis targeting the ALKBH5 / CircRNA_0001543 / RIP1 combination according to claim 1, characterized in that: In indicator a), the expression of messenger ribonucleic acid of ALKBH5 was detected by reverse transcription real-time quantitative polymerase chain reaction, and the protein expression of ALKBH5 was detected by Western blotting. In indicator b), the N6-adenosine methylation modification level of CircRNA_0001543 was detected by immunoprecipitation-polymerase chain reaction of methylated RNA, and the stability of CircRNA_0001543 was assessed by detecting the RNA half-life after incubation with actinomycin D. In indicator c), the binding blocking effect of CircRNA_0001543 to RIP1 was verified by RNA pull-down assay and RNA immunoprecipitation-polymerase chain reaction. The distribution of p65 protein and the expression of RIP1 and IκBα protein in the cytoplasm and nucleus were detected by Western blotting to verify the inhibitory effect on nuclear factor κB pathway activation.

5. The method for constructing a drug screening system for ankylosing spondylitis targeting the ALKBH5 / CircRNA_0001543 / RIP1 combination according to claim 1, characterized in that: In step S3, the efficacy judgment criteria are: after intervention with the candidate drug, if the content of pro-inflammatory factors decreases by ≥40% and the content of anti-inflammatory factors increases by ≥35%, it is judged as an effective drug with potential anti-inflammatory activity.

6. The method for constructing a drug screening system for ankylosing spondylitis targeting the ALKBH5 / CircRNA_0001543 / RIP1 combination according to claim 1, characterized in that: The pro-inflammatory factors include interleukin-1β and tumor necrosis factor α, and the anti-inflammatory factors include interleukin-10 and interleukin-37.

7. The method for constructing a drug screening system for ankylosing spondylitis targeting the ALKBH5 / CircRNA_0001543 / RIP1 combination according to claim 1, characterized in that: In step S3, the cytokine content is detected by enzyme-linked immunosorbent assay (ELISA). The specific operation includes: collecting the supernatant of co-cultured cells, centrifuging at 1000 rpm for 10 minutes, adding 100 μL of dilution to the ELISA plate, incubating at 37°C for 1.5 hours, measuring the absorbance at 450 nm using an ELISA reader, and calculating the cytokine concentration using a standard curve.

8. The method for constructing a drug screening system for ankylosing spondylitis targeting the ALKBH5 / CircRNA_0001543 / RIP1 combination according to claim 1, characterized in that: Serum containing Scutellaria baicalensis heat-clearing and pain-relieving capsules was used as a positive control during the screening process.

Citation Information

Patent Citations

  • Application of methylation modification of circular RNA

    CN117298134A

  • Application of circular RNA hsacirc0001543 in diagnosis and treatment of ankylosing spondylitis

    CN117965721A