A multiple nucleic acid detection system and method based on programmable DNA structure state machine and enzymatic clock stepping

CN122146858BActive Publication Date: 2026-08-11CHONGQING TRANSMEMBRANE BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-05-09
Publication Date
2026-08-11

AI Technical Summary

Technical Problem

[0009](4)引入 CRISPR 等正交信号系统:虽然提高了识别特异性,但急剧增加了反应体系的生物化学复杂性和酶学成本,且其最终的信号输出仍受限于相同的多色荧光染料池的物理瓶颈,无法实现高通量复用的本质突破

Benefits of technology

基于时间分辨信号转化,克服光学通道数量对多重检测通量的限制: 本发明利用时间分辨策略替代了传统多重PCR依赖多色光学通道的区分策略。通过使用长链物理底轨(第六链)将多个靶标识别区首尾串联,系统仅需配置单色荧光与单色淬灭探针。该方法以荧光信号出现的相对时间节点指示具体靶标的身份,解除了光学通道数量对检测重数的物理限制,在单管体系内实现了更高重数的靶标并发检测。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146858B_ABST
    Figure CN122146858B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biomedical detection technology, specifically relating to a multiplex nucleic acid detection system and method based on a programmable DNA structure state machine and enzyme-catalyzed clock stepping. The invention discloses a multiplex nucleic acid detection system based on a programmable DNA structure state machine and enzyme-catalyzed clock stepping, comprising equipment and detection reagents (including enzymes, signal strands, timing strands, and multiple primer pairs). The system connects multiple target recognition regions end-to-end via long-chain physical bottom rails, using only monochromatic probes. Utilizing a time-resolved strategy, the specific target identity is indicated by the relative time node of the fluorescence signal appearance, thereby overcoming the limitations of the number of traditional multicolor optical channels and achieving concurrent detection of higher multiplex targets within a single-tube system.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical detection technology, specifically relating to a multiplex nucleic acid detection system and method based on a programmable DNA structure state machine and enzyme-catalyzed clock stepping. Background Technology

[0002] In the field of modern molecular diagnostics, the ability to simultaneously, rapidly, and accurately detect multiple nucleic acid targets in a single reaction tube (i.e., "single-tube multiplexing") has significant clinical application and health economics value. An ideal multiplexing technology urgently needs to balance high throughput, high efficiency, and low cost. However, current technologies face fundamentally irreconcilable contradictions in terms of throughput limits, detection speed, and reagent costs.

[0003] Currently, mainstream multiplex detection technologies in this field, especially real-time quantitative PCR and digital PCR, have become the industry gold standard. The signal readout mechanism for multiplex detection in these systems essentially relies on the "different spectral allocations" in the optical dimension. The most typical application is the hydrolysis probe method (such as the TaqMan probe), which utilizes the exonuclease activity of DNA polymerase to cleave the probe, causing the fluorescent group and quencher group to physically separate, thereby releasing a fluorescent signal. To achieve multiplex detection, existing technologies must assign a fluorescent dye with a different emission spectrum (e.g., FAM, HEX, ROX, Cy5, etc.) to each different detection target, and use multiple sets of optical filters equipped in the instrument to capture and distinguish these different color signals separately.

[0004] However, the aforementioned strategies, which heavily rely on multicolor fluorescence dimensions, suffer from insurmountable physical drawbacks, including: (1) Physical channel limitations: Due to the excitation wavelength of the light source and the bandwidth of the filter in commercial instruments, the number of independent fluorescence channels with non-interfering spectra is extremely limited (usually only 2 to 6), which imposes a clear limit on the theoretical throughput of single-tube multiplex detection.

[0005] (2) Spectral overlap and crosstalk: As the number of reusable fluorescent dyes increases, the excitation and emission spectra of different dyes will inevitably overlap severely. The high-intensity fluorescence signal in one channel is very easy to "leak" into adjacent channels (i.e. fluorescence crosstalk), which leads to abnormally high background signal and severe data distortion, greatly reducing the system's ability to identify weak positive samples and its detection accuracy.

[0006] To overcome the aforementioned limitations in optical physics, various "remedial" strategies have been attempted in this field, but all have introduced new systemic risks or high cost burdens. For example: (1) Multiplexing strategy based on fluorescence amplitude: This method is mainly used for dPCR and attempts to distinguish targets by forming gradient fluorescence brightness by strictly controlling the concentration of different probes in the same channel. The initial optimization of this method is extremely cumbersome and the system has poor robustness. It is easily affected by fluctuations in amplification efficiency or non-specific amplification perturbations, resulting in cluster overlap and serious misjudgment.

[0007] (2) Multiplexing strategy based on melting curves: This approach attempts to differentiate between different target fragments or probes by utilizing the differences in their melting temperatures (Tm values). However, this method is severely limited by an extremely narrow effective temperature range (usually only within a limited range of tens of degrees, such as 50℃-70℃), leading to severe overlap and crowding of melting peaks of different targets as the number of targets increases. This not only greatly limits the upper limit of multiplexing (usually difficult to exceed 10 multiples), but also imposes extremely stringent requirements on the temperature control accuracy and inter-well uniformity of the instrument.

[0008] (3) Fluorescence compensation matrix strategy: This method attempts to eliminate crosstalk by establishing a complex spectral cross matrix. Essentially, this method is a "mathematical repair" of distorted signals using algorithms rather than physical eradication. While repairing a distorted signal, it often amplifies the underlying baseline noise or even introduces new systematic computational errors.

[0009] (4) Introducing orthogonal signal systems such as CRISPR: Although it improves recognition specificity, it drastically increases the biochemical complexity and enzymatic cost of the reaction system, and its final signal output is still limited by the physical bottleneck of the same multicolor fluorescent dye pool, which cannot achieve the essential breakthrough of high-throughput reuse.

[0010] In summary, existing multiplex nucleic acid detection technologies are all trapped in the physical bottlenecks of "spectral dimension (color)," "amplitude dimension (brightness)," or "temperature dimension."

[0011] There is an urgent need in this field to propose a novel nucleic acid detection strategy that breaks away from the dependence on traditional multicolor fluorescence and opens up a completely new signal encoding dimension, thereby enabling low-cost, ultra-high-throughput target differentiation within a single optical channel. Summary of the Invention

[0012] Based on this, the purpose of this invention is to provide a multiplex nucleic acid detection system and method based on a programmable DNA structure state machine and an enzyme-catalyzed clock stepping, which partially solves or alleviates the above-mentioned deficiencies in the prior art. The present invention specifically adopts the following technical solution.

[0013] The first aspect of this invention provides a multiplex nucleic acid detection system.

[0014] A multiplex nucleic acid detection system based on a programmable DNA structure state machine and enzyme-catalyzed clock stepping, the multiplex nucleic acid detection system includes detection reagents and detection equipment; the detection reagents include enzyme reaction reagents and nucleic acid reaction reagents, the nucleic acid reaction reagents include separately configured (a set of universal) signal strands, (shared) timing strands and primer pairs, each primer pair including a first primer and a second primer; when used for multiplex nucleic acid detection, multiple primer pairs are configured; The first primer is a forward-specific amplification strand, which amplifies the first strand; The second primer is a reverse specific amplification strand, which amplifies the second strand; The structures of the first chain and the second chain are complementary; (After PCR, the first and second primers of each layer amplify a complete and perfectly complementary double-stranded DNA structure: the first strand and the second strand.) The second chain has a nicking enzyme recognition region, which is used to release the third chain via a nicking chain replacement reaction after amplification; The first chain is provided with a gene binding region for specific binding to the target gene, a nicking enzyme recognition region and six functional regions; wherein, the first to sixth functional regions are connected end to end in sequence, and the second functional region is complementary to the sixth functional region and the third functional region is complementary to the fifth functional region, so that the third chain forms a self-locking hairpin structure in a free state. The first functional region serves as a complementary sequence to the specific foothold of the third chain; the GC content of the first functional region is 40-66%. The second functional region is a complementary sequence to the specific stem region sequence of the third strand; the GC content of the second functional region is 50-75%; The third functional region is a complementary sequence to the general stem region sequence of the third chain; the GC content of the third functional region is 17-33%. The fourth functional region is a complementary sequence to the flexible loop region of the third chain; the GC content of the fourth functional region is 60-75%. The fifth functional region serves as a complementary sequence to the third chain's universal binding anchor and the stem region sequence; the GC content of the fifth functional region is 17-33%. The sixth functional region is a complementary sequence to the specific stem region sequence of the third strand; the GC content of the sixth functional region is 50-75%; The signal chain consists of a fourth chain and a fifth chain. The fourth chain is a fluorescent signal chain with a fluorescent group labeled at its 3' end. The fifth chain is a quenching chain with a quenching group labeled at its 5' end. The third chain, after being combined with the time-series chain, has a sequence structure (also known as an exposed sequence) for combining with the fourth chain and replacing the fifth chain. The time-series strand is the sixth strand, which is a one-dimensional double-stranded DNA formed by the tandem connection of multiple units. During enzymatic digestion, the upper strand (front strand) is degraded, sequentially exposing the functional regions of the lower strand (back strand). Each unit on the sixth strand contains five functional regions: The seventh functional region is a specific foothold sequence that binds to the third chain; the GC content of the seventh functional region is 40-66%. The eighth functional region is a specific stem region sequence that binds to the third strand; the GC content of the eighth functional region is 50-75%. The ninth functional region is a universal stem region sequence that incorporates the third strand; the GC content of the ninth functional region is 17-33%. The tenth functional region is a physical buffer zone that provides physical space and reduces steric hindrance to preceding functional regions in the event of Lambda exonuclease stagnation; the GC content of the tenth functional region is 0-50%. The eleventh functional region acts as a blocking region, and after exposure, it combines with the fifth chain to perform quenching; the GC content of the eleventh functional region is 60-75%; The enzyme reaction reagent contains a Lambda exonuclease, which performs enzymatic digestion on the sixth strand. The digestion process of the Lambda exonuclease is regulated by the structure of the eleventh functional region of the sixth strand and a programmed temperature control, exhibiting a run-block-run cycle. The programmed temperature control is a high-temperature-low-temperature cycle control program.

[0015] In multiple repeating units based on the sixth strand, the arrest process of Lambda exonuclease is regulated by both the eleventh functional region sequence structure and programmed temperature control: when the reaction system is in the low-temperature phase, the eleventh functional region on each repeating unit (whose core is composed of a kinetic "roadblock" of consecutive GC bases) will cause the exonuclease to be locked for a long time, forcibly stopping its unwinding action; when the system is briefly heated to enter the high-temperature phase, the temperature will enhance the "respiration" of the DNA strand, weakening the kinetic "roadblock" composed of consecutive GC bases, and the exonuclease can continue to unwind. Then the temperature is lowered, and the exonuclease operates normally until it hits and locks the eleventh functional region of the next unit for a long time, thus completing the "arrest-roadblock" cycle that progresses rhythmically with temperature fluctuations.

[0016] Furthermore, the sixth chain is configured with multiple repeating units according to the number of weights of the target to be tested. In some specific embodiments, the sixth chain contains 68 repeating units.

[0017] Furthermore, the fourth chain is a single-chain hairpin structure, which includes a probe receiving foothold, a quenching chain bonding area, a probe strong hairpin stem structure, and a probe flexible ring area structure; the probe strong hairpin stem structure is connected to the probe flexible ring area structure (the probe strong hairpin stem structure is a two-segment symmetrical structure connected to the probe flexible ring area structure).

[0018] Furthermore, the fifth strand has a single-strand structure; the fifth strand has a sequence that is complementary to the fourth strand.

[0019] Furthermore, the enzyme reaction reagent also includes polymerase, exonuclease, strand displacement polymerase, and nick endonuclease.

[0020] Furthermore, the detection equipment of the multiplex nucleic acid detection system includes a fluorescence detection device.

[0021] In some alternatives, the present invention may also provide a time-resolved multiplex nucleic acid detection system based on a programmable DNA nanospace state machine and a programmed enzymatic clock stepping, the multiplex nucleic acid detection system comprising a first strand, a second strand, a fourth strand, a fifth strand, and a sixth strand; The first strand was amplified using forward-specific primers, and the second strand was amplified using reverse-specific primers; The second chain has a nicking enzyme recognition region, which is used to release the third chain via a nicking chain replacement reaction after amplification; The third chain, after being combined with the time-series chain, has an exposure sequence for combining with the fourth chain and replacing the fifth chain; The fourth chain is a fluorescent signal chain, and the 3' end of the fluorescent signal chain is labeled with a fluorescent group; The fifth chain is a quenching chain, and the 5' end of the quenching chain is marked with a quenching group; The sixth chain is a time-series chain; The multiplex nucleic acid detection system also includes an enzyme reaction system, which includes Lambda exonuclease. The first strand's structure includes a gene-binding region for specific binding to the target gene, a nicking enzyme recognition region, and six functional regions. The first to sixth functional regions are sequentially linked end-to-end, and the second and sixth functional regions are complementary, as are the third and fifth functional regions, allowing the amplified third strand to automatically fold under normal conditions to form a hairpin stem-loop self-locking structure. Among them, the first functional region serves as the complementary sequence (first foothold) of the specific foothold of the third chain. The second functional region is the complementary sequence of the specific stem region sequence of the third strand (first stem region). The third functional region is the complementary sequence (first stem region) of the general stem region sequence of the third chain. The fourth functional region is a complementary sequence (first ring region) of the flexible ring region of the third chain. The fifth functional region serves as a universal binding point with the third chain and a complementary sequence to the stem region sequence (the first stem region also serves as the second binding point). The sixth functional region is a complementary sequence (first stem region) that is complementary to the specific stem region sequence of the third strand. The specific base sequence of the third strand binds to the seventh functional region of the sixth strand, and the specific stem region sequence of the third strand binds to the eighth functional region of the sixth strand. Then, the general stem region sequence of the third strand binds to the ninth functional region of the sixth strand. After binding to the sixth strand, the general binding base sequence of the third strand, along with the flexible loop region sequence, binds to the fourth-fifth strand complex and replaces the fifth strand. The sixth strand is a one-dimensional double-stranded DNA formed by multiple units tandemly linked end-to-end. During enzymatic digestion, its upper strand is degraded, sequentially exposing the functional regions of the lower strand. Each unit on the sixth strand contains five functional regions: Among them, the seventh functional region is a specific foothold sequence that combines with the third chain; The eighth functional region is a specific stem region sequence that binds to the third strand; The ninth functional region is a universal stem region sequence that combines with the third chain; The tenth functional region is a physical buffer that provides physical space and reduces steric hindrance to the preceding functional region when Lambda exonuclease stagnation occurs. The eleventh functional area acts as a blocking area, and after exposure, it combines with the fifth chain to perform quenching. The Lambda exonuclease performs enzymatic digestion on the sixth strand. The operation of the Lambda exonuclease is regulated by the structure of the eleventh functional region of the sixth strand and by programmed temperature control, exhibiting an operation-repression-operation cycle.

[0022] In another aspect, the present invention also provides a detection method.

[0023] A multiplex nucleic acid detection method based on a programmable DNA structure state machine and enzyme-catalyzed clock stepping, wherein the multiplex nucleic acid detection method is based on the above-mentioned multiplex nucleic acid detection system and includes the following steps: S01: Design a first primer and a second primer for the target gene to be detected. The gene binding regions of the first primer and the second primer are used to locate and amplify the target gene. When the reaction system includes multiple target genes, design multiple primer pairs. S02: DNA polymerase is added to the reaction system and amplified together with the first primer and the second primer. The amplification product is double-stranded DNA. The double-stranded DNA consists of a first strand and a second strand, and the first strand and the second strand are structurally complementary. S03: Add a single-strand-specific exonuclease to the reaction system to remove the primers; S04: Heat the aforementioned reaction system to deactivate the enzymes therein; S05: Add nick endonuclease and strand displacement polymerase to the reaction system. The nick endonuclease binds to specific regions of the first and second strands and creates a nick in the second strand. Subsequently, the strand displacement polymerase locates the nick site and synthesizes a new complementary sequence from the 5' end to the 3' end of the nick, while simultaneously displacing and releasing the old sequence: the functional region sequence of the second strand, to obtain the third strand. Then, the third strand is subjected to isothermal amplification (the nick endonuclease and strand displacement polymerase are sequentially executed again to create a nick, polymerize, and displace, thereby performing isothermal amplification of the third strand). S06: The reaction program is controlled to inactivate the endoglucanase and the chain displacement polymerase. S07: Use a pre-annealing process to hybridize the fourth chain and the fifth chain together to form a fourth chain-fifth chain complex; S08: Add the fourth-to-fifth strand complex, the sixth strand, and the Lambda exonuclease, so that the third strand in the system participates in the reaction based on the sixth strand in a sequential step; start the fluorescence detection device (place the fluorescence quantitative device and start the fluorescence quantitative device program), set the reaction conditions to dual-temperature programmed temperature cycling, and collect the fluorescence signal at low temperature; obtain the concentration of the target gene by analyzing the fluorescence signal data.

[0024] Specifically, in each cycle step of S08, the lambda enzyme digests a unit at a distance from the sixth strand, from the arrest point of the previous unit to the arrest point of the next unit. At high temperatures, the lambda enzyme overcomes the energy barrier of the arrest point and proceeds to the next unit. This exposes the complementary region of the quenching strand sequence in the bottom unit of the sixth strand. The quenching strand binds to the sequential strand, quenching the fluorescence signal of the previous unit. At low temperatures, the lambda enzyme performs normal digestion, exposing the complementary region of the specific foothold of the third strand in the bottom unit of the sixth strand. The third strand binds to the sequential strand, unwinds its stem-loop structure, and exposes the universal binding foothold of the complementary fourth strand. The fourth strand binds to the third strand, displacing the fifth strand, and a fluorescence signal is emitted. This cycle of steps produces and quenches the fluorescence signal. By analyzing the fluorescence signal data and the current step, the concentration of the corresponding target gene can be determined.

[0025] Furthermore, S01 is the PCR amplification reaction, which involves 20-25 cycles of denaturation-annealing-extension. (The reaction conditions in this method are the general PCR program, including pre-denaturation).

[0026] Furthermore, S05 is an isothermal amplification reaction, and the reaction conditions are a constant temperature reaction at 40-60℃ for 20-30 minutes for amplification.

[0027] Furthermore, S08 is a fluorescence signal and quenching reaction based on enzyme digestion, and the reaction conditions are a cyclic temperature-controlled reaction with low temperature of 4-12℃ and high temperature of 37-45℃.

[0028] Furthermore, when the reaction system includes multiple target genes, S08 analyzes (maps) and identifies the specific types (specific identities) of the multiple target genes and the detection results based on the time of fluorescence signal appearance (relative time node) or the number of temperature cycles.

[0029] Beneficial technical effects: This invention overcomes the limitation of optical channel number on multiplex detection throughput by time-resolved signal conversion: It utilizes a time-resolved strategy to replace the traditional multicolor optical channel-dependent differentiation strategy of multiplex PCR. By using a long-chain physical bottom rail (sixth strand) to cascade multiple target recognition regions end-to-end, the system only needs to be configured with monochromatic fluorescence and monochromatic quenching probes. This method indicates the identity of a specific target by the relative time node of fluorescence signal appearance, removing the physical limitation of optical channel number on detection multiplex and achieving higher multiplex target concurrent detection within a single-tube system.

[0030] By utilizing programmed temperature control and sequence retardation points, this invention achieves step-by-step synchronous calibration and zeroing of enzymatic steps: In continuous multi-step enzymatic reactions, the inherent randomness of the Poisson distribution in single-molecule catalytic kinetics easily leads to accumulated phase misalignment and temporal signal aliasing in the molecular population. This invention designs retardation points containing GC-rich sequences on the temporal chain and overcomes this problem by combining them with temperature-controlled cycling. Under low-temperature (4-12°C) steady-state conditions, the Lambda exonuclease encounters a conformational barrier, resulting in kinetic retardation and forcing asynchronously running enzyme molecules within the system to achieve physical alignment at the same site. Under high-temperature (37-45°C) pulses, the enzyme population synchronously acquires activation energy and releases it over the barrier. This mechanism achieves "temporal calibration and zeroing" of the system at each temporal node, blocking the accumulation of random errors caused by the Poisson distribution and maintaining the independence of subsequent multiple target signal peaks.

[0031] By utilizing steric hindrance and molecular conformational locking mechanisms, nonspecific background noise is reduced: During enzymatic pauses, the large Lambda exonuclease molecules bound to the bottom rails constitute steric hindrance, masking and protecting downstream functional sequences from disordered enzymatic cleavage. Simultaneously, the third strand released isothermally at the front end automatically folds into a hairpin stem-loop self-locking structure in its free state due to sequence complementarity. This self-locking mechanism only unlocks and triggers a strand displacement reaction when the corresponding bottom rail recognition region is exposed by enzymatic cleavage. This dual design of physical barriers and molecular conformational locking effectively suppresses cross-reactions and background noise within the detection system.

[0032] This solution simplifies the hardware requirements for fluorescence detection and reduces the system cost of multiplex detection: It transforms the parallel identification of multiple targets from spatial resolution in the optical dimension to temporal acquisition in the temporal dimension, reducing the dependence of multiplex detection on complex multicolor excitation / emission optical paths and filter components. High-multiplexity nucleic acid detection tasks can be performed using conventional single-channel or dual-channel fluorescence detection equipment with a basic temperature control module, reducing the development requirements of supporting instruments and the cost of terminal detection. Attached Figure Description

[0033] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. In all the drawings, similar elements or parts are generally identified by similar reference numerals. The elements or parts in the drawings are not necessarily drawn to scale. Obviously, the drawings described below are some embodiments of the present invention, and those skilled in the art can obtain other drawings based on these drawings without any creative effort.

[0034] Figure 1 This is a schematic diagram of the structure of the first chain shown in one embodiment of the present invention; Figure 2 This is a schematic diagram of the structure of the second chain shown in one embodiment of the present invention; Figure 3 This is a schematic diagram of the structure of the third chain shown in one embodiment of the present invention; Figure 4 This is a schematic diagram of the structure of the fourth chain shown in one embodiment of the present invention; Figure 5 This is a schematic diagram of the structure of the fifth chain shown in one embodiment of the present invention; Figure 6 This is a schematic diagram illustrating the combination of the fourth and fifth chains in one embodiment of the present invention; Figure 7 This is a schematic diagram illustrating the chain substitution / reaction of the third and fourth chains in one embodiment of the present invention; Figure 8 This is a schematic diagram illustrating the sixth-third-fourth chain substitution / reaction in one embodiment of the present invention; Figure 9 This is a schematic diagram of the structure of the sixth chain shown in one embodiment of the present invention; Figure 10 This is the fluorescence curve of the isothermal displacement reaction in one embodiment of the present invention; Figure 11 This is the confirmation result of the rate-limiting boundary of the continuous GC conformation polar nucleus in one embodiment of the present invention; Figure 12The 5s response characteristic parameters are established in one embodiment of the present invention; Figure 13 In one embodiment of the present invention, the 10s response characteristic parameters are established; Figure 14 In one embodiment of the present invention, the 15s response characteristic parameters are established; Figure 15 In one embodiment of the present invention, the 20s response characteristic parameters are established; Figure 16 In one embodiment of the present invention, the 30s response characteristic parameters are established; Figure 17 This is a comparison diagram of the displacement reaction rate of the v1 basement region (v1=2nt) in one embodiment of the present invention. Figure 18 This is a comparison diagram of the displacement reaction rate of the v1 basement region (v1=4nt) in one embodiment of the present invention. Figure 19 This is a comparison diagram of the displacement reaction rate of the v1 basement region (v1=6nt) in one embodiment of the present invention. Figure 20 This is a comparison diagram of the displacement reaction rate of the v1 basement region (v1=8nt) in one embodiment of the present invention. Figure 21 This is a comparison diagram of the reaction energy barrier v2 of the unspin stopband in one embodiment of the present invention (v2=2nt). Figure 22 This is a comparison diagram of the reaction energy barrier v2 of unspin-stopping band in one embodiment of the present invention (v2=4nt). Figure 23 This is a comparison diagram of the reaction energy barriers of unspinning stopband v2 in one embodiment of the present invention (B3); Figure 24 This is a comparison diagram of the reaction energy barriers of unspinning stopband v2 in one embodiment of the present invention (B4). Figure 25 This is a result showing that there is no nonspecific substitution between primers in one embodiment of the present invention; Figure 26 This is the result of target-specific binding and highly stable concentration in one embodiment of the present invention. Detailed Implementation

[0035] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0036] In this document, "and / or" includes any and all combinations of one or more of the listed related items.

[0037] In this article, "multiple" means two or more, that is, it includes two, three, four, five, etc.

[0038] As used in this specification, the term "about" typically means + / -5% of the value, more typically + / -4% of the value, more typically + / -3% of the value, more typically + / -2% of the value, even more typically + / -1% of the value, and even more typically + / -0.5% of the value.

[0039] In this specification, certain embodiments may be disclosed in a range-bound format. It should be understood that this "range-bound" description is merely for convenience and brevity and should not be construed as a rigid limitation on the disclosed range. Therefore, the description of a range should be considered as having specifically disclosed all possible subranges and the individual numerical values ​​within those ranges. For example, a description of the range 1-6 should be considered as having specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., and the individual numbers within those ranges, such as 1, 2, 3, 4, 5, and 6. This rule applies regardless of the breadth of the range.

[0040] The chain structure example shown in this invention includes multiple functional regions. v1, v2, c3, and c4 represent the first variable sequence region, the second variable sequence region, the third fixed sequence region, and the fourth fixed sequence region, respectively; v1', v2', c3', and c4' represent the complementary sequences of the first variable sequence region, the second variable sequence region, the third fixed sequence region, and the fourth fixed sequence region, respectively; lr represents forward direction; rl represents reverse direction. (A DNA double helix consists of a 5'-3' sequence combined with a 3'-5' sequence, so for v1 and v1' to combine, they must not only be complementary but also in opposite directions.)

[0041] Example 1 This embodiment aims to validate the physical function of a single component, detached from the complex Lambda exonuclease reaction and macroscopic isothermal cycling process. The experiment, through topological manipulation of nucleic acid structures, isolates and verifies the physical feasibility of the underlying mechanisms of "signal release gating" and "bottom-track quenching gating" within the probe system. Specifically, this includes verifying the structural topological response in the reaction components under isothermal conditions (a constant 12°C). The structural topological response is a sequence substitution achieved through the secondary and primary structures of the sequence. The secondary and primary structures refer to the secondary hairpin structure and the primary sequence structure, respectively.

[0042] Basic experimental information: Testing equipment: Bio-Rad C1000 Touch qPCR instrument; Optical path: FAM (excitation 494 nm / emission 518 nm); Reaction volume: 20 μL / well; 10× Isothermal Buffer Formulation: 500 mM Tris-HCl (pH 8.0), 100 mM MgCl2, 500 mM NaCl. The final concentration in the reaction system is 1× (i.e., 50 mM Tris-HCl, 10 mM Mg²⁺). + 50 mM Na + ).

[0043] HPLC purification standards were used for the synthesis of all single-stranded nucleic acids.

[0044] Experimental group information: (Note: The c4 polar ring region described in this embodiment corresponds to the eleventh functional area / blocking area in the claims; the v7 interval region corresponds to the tenth functional area / physical buffer in the claims.)

[0045] Control group A (resting baseline): Contains only the [fourth chain / fifth chain] composite probe. Used as a system baseline noise control to quantify the background leakage rate of the probe lock-in state.

[0046] Experimental Group B (Single Signal Measurement): Contains [Fourth / Fifth Strand] probe + Third Strand (messenger) + truncated Sixth Strand base strand' (without C4 polar ring and V7 spacer). This verifies whether the Third Strand can be unlocked by the Sixth Strand base strand', and whether TMSD (strand displacement) can occur at its exposed specific foothold to strip away the Fifth Strand, triggering a fluorescence jump.

[0047] Experimental Group C (Cascaded Quenching): Contains [Fourth / Fifth Chain] probe + Third Chain + Complete Sixth Chain Base Chain (with C4 polar ring and V7 spacer). This verifies that after the C4 region of the sixth chain base chain is pre-filled and blocked by the fifth chain (carrying BHQ1), when the third and fourth chains (carrying FAM) assemble at the base rail, the released FAM fluorescence is rapidly pulled closer to the pre-placed BHQ1 through spatial conformational rearrangement of the complex, achieving efficient re-quenching of the fourth chain.

[0048] The specific sequences involved in this embodiment are as follows.

[0049] Third chain (SEQ ID NO.1): TTGCGGCGCTAACAACAACCCGCAGTTGTTAGCG.

[0050] Fourth strand (SEQ ID NO. 2): AACAACTGCGGGTTCGCGGCGCGTGCACATGCACGCGCCGCG-3'-FAM.

[0051] Fifth Chain: 5'-BHQ1-AACCCGCA.

[0052] The sixth chain bottom chain (SEQ ID NO.3): GTTGTTAGCGCCGCAA.

[0053] Sixth chain bottom chain (SEQ ID NO.4): TGCGGGTTATGTGTTGTTAGCGCCGCAA.

[0054] Reaction procedure steps: 1. Standardized implementation of reagent preparation and annealing Step 1. Preparation of single-chain stock solution Preparation: Take all synthesized nucleic acid dry powders (third strand, fourth strand, fifth strand, sixth strand base strand, and sixth strand base strand'), centrifuge them, and add the corresponding volume of 1×TE Buffer to dissolve them thoroughly. Prepare a 100 μM high-concentration stock solution (it is recommended to aliquot and store at -20°C protected from light).

[0055] Step 2. Preparation of independent working solution For the third, sixth, and sixth chain bottoms: take 100 μM of the corresponding stock solution and dilute with 1×TE at a ratio of 1:100 to prepare 1 μM independent single-chain working solutions. (Note: For the fourth and fifth chains, use the 100 μM stock solution directly for high-concentration annealing preparation).

[0056] Step 3. Probe annealing and chassis pre-sealing assembly Annealing sample preparation: Take stock solutions of the fourth chain (100 μM) and the fifth chain (100 μM), and prepare them using 1×TE and Buffer at a molar ratio of 1:1.2. Adjust the volume to ensure that the equivalent concentration of the fourth chain in the annealing system is 10 μM and that of the fifth chain is 12 μM (the trace overload of the fifth chain is used not only for complete quenching but also as a filler for the subsequent sixth chain void). Thermodynamic annealing procedure: Place in a thermal cycler and set uniformly to 95°C for 5 minutes, then allow to cool naturally to room temperature.

[0057] Pre-sealing assembly of the chassis (a crucial incubation step): After annealing, the fourth / fifth chain composite probe solution is placed in a light-protected ice bath for later use. Subsequent chassis pre-sealing will be performed in the sample wells (see Table 1). This is achieved by adding the probe solution and the sixth chain working solution together to the bottom of the well and incubating in a light-protected ice bath or at 12°C for 10-15 minutes. This operation aims to allow any excess free fifth chain molecules to preemptively fill the reserved C4 position of the sixth chain base chain for sealing. After all the components at the bottom of the wells have incubated, the third chain is then added to the tube wall.

[0058] 2. System configuration and sampling matrix table Final concentrations of each nucleic acid component in the terminal reaction system: 2000 nM for the fourth strand, 2400 nM for the fifth strand, 200 nM for the third strand, and 200 nM for the sixth strand. Add the components sequentially in an ice bath according to the volume matrix below (total volume 20 μL). Table 1 System Configuration 3. Continuous acquisition and evaluation of dynamic parameters Step 1. Run the program control on the computer. Temperature control: Disable all types of thermal cycling parameter changes, and lock the ambient temperature at a constant 12°C for all time. Cyclic program: Set to 250 cycles, each cycle: maintain constant temperature at 12°C for 10 s → acquire fluorescence signal. Total runtime is approximately 2500 s (≈42 minutes).

[0059] Step 2. High-resolution optical acquisition configuration Optical channel: FAM channel (excitation 494 nm / emission 518 nm), fluorescence data is automatically collected once at the end of each cycle.

[0060] Step 3. Steady-state data evaluation benchmark analysis Initial phase baseline calibration region (0~5 minutes): This segment is considered the system's internal energy physical self-calibration peak region. Steady-state test comparison area (5~42 minutes): Group B Action Judgment: Monitor the irreversible fluorescence signal growth caused by the continuous stripping of the fifth strand, until the slope eventually converges to the saturation maximum threshold. Group C sealing efficacy determination: The core is to use an excess of the fifth strand to preemptively occupy the c4 region of the bottom rail to simulate the state of the region being blocked by the quenched strand in the real enzyme digestion cycle; then observe the signal quenching trend caused by the reduction of spatial distance when the third strand normally targets and binds to the bottom rail and captures the fourth strand, and the subsequent slow steady-state trend caused by the spatial rearrangement of the huge three-dimensional complex. Results and data: See results Figure 10 .

[0061] Result judgment: Group A (blue line): The signal is closely aligned with the flat baseline, with no spontaneous drift or uphill climbing throughout the entire route.

[0062] Group B (red line): The optical signal jumps rapidly and reaches a relatively balanced upper steady-state range. This indicates that the 14bp TMSD unidirectional substitution driven by the third chain has completely occurred, successfully releasing a readable fluorescence signal.

[0063] Group C (green line): After being placed on the instrument, it began to slowly decrease and eventually reached a steady state of about 1400 RFU, forming an extremely flat and super-stable period.

[0064] Experimental results show that the surge fluorescence trajectory of group B and the decrease fluorescence trajectory of group C, under purely static isothermal conditions (12°C) completely detached from the enzymatic reaction, confirm the physical feasibility of the mechanisms of the two core components of the probe system. Achieving "signal gating": The early fluorescence surge directly reveals the response of the structural topology network from "opening from a closed state" to "displacement and fluorescence release".

[0065] Confirmation of "bottom rail gating": the signal can be quenched and no further upward fluctuations occur, and it enters a solid equilibrium ground state.

[0066] Example 2 This embodiment aims to verify the stepping characteristics of molecular logic gate mechanisms. This experimental system investigates the blocking effect of the c4 continuous GC length, which serves as the rate-limiting region, on Lambda Exo (at 12°C). Simultaneously, a time-gradient thermal pulse (45°C) is applied to calibrate the continuous GC length threshold and the effective duration of thermal shock that enables the enzyme complex to overcome the stagnation barrier.

[0067] "Enzyme cleavage arrest-thermal shock barrier" dual-mode time-stepping mechanism: Under a 12°C isothermal environment, a highly rigid thermodynamic barrier mechanically blocks the unwinding wedge structure of the Lambda exonuclease, causing it to be stably trapped at the C4 front end and enter a "kinetic standby" state. This physically locks the downstream target trigger region to achieve zero background leakage (conformational retardation state). Subsequently, a transient 45°C thermal pulse is applied to locally soften the double strands, giving the exonuclease the microscopic gap to cross the energy barrier, allowing it to rapidly resume efficient hydrolysis upon returning to 12°C (phase transition unlocking state). At the end of this degradation process, the specially designed 15bp space-occupying region (sp) at the very end of the structure plays a crucial role in supporting the physical double strands, preventing the enzyme from prematurely slipping off due to the loss of its attachment base. This ensures the complete degradation of the core capping layer, ultimately achieving complete exposure of the bottom target region and eliciting an irreversible displacement fluorescence peak.

[0068] Reaction procedure steps: Basic experimental information: Testing equipment: Bio-Rad C1000 Touch qPCR instrument; Optical path: FAM (excitation 494 nm / emission 518 nm); Reaction volume: 20 μL / well; 10× Working Buffer Formulation: 500 mM Tris-HCl (pH 8.0), 100 mM MgCl2, 500 mM NaCl. The final concentration in the reaction system is 1× (i.e., 50 mM Tris-HCl, 10 mM Mg²⁺). + 50 mM Na + ).

[0069] Operating standards: The configuration must be placed in a harsh ice bath at 0~4°C to prevent non-specific assembly activation leakage.

[0070] HPLC purification standards were used for the synthesis of all single-stranded nucleic acids.

[0071] Experimental group information: (Note: The c4 rate limiting area / continuous GC area mentioned in this embodiment corresponds to the eleventh functional area / blocking area in the claim.)

[0072] Experiment 2A: Sequence Combination Limitation Performance Test The study investigated the ability of constituents with different continuous GC lengths to maintain degradation inhibition under long-term isothermal conditions, as well as the minimum physical parameter boundary for forming an effective thermodynamic barrier: test group A (4nt), test group B (5nt), test group C (6nt), and test group D (8nt).

[0073] Experiment 2B: Transient Thermal Pulse Release Response Test Independent and fixed test group B (5nt) was used to investigate the heating time gradient, aiming to define the time domain windows of insufficient heat input, efficient cross-border switching state, and long-term exposure leading to overall collapse and degradation: test group E (5s), test group F (10s), test group G (15s), test group H (20s), and test group I (30s).

[0074] The specific sequences involved in this embodiment are as follows.

[0075] Test group A (4nt continuous GC): Third chain (SEQ ID NO.5): TTGCGGCGCTAACAACAATCCGCAGTTGTTAGCG.

[0076] Fourth chain (SEQ ID NO.6): AACAACTGCGGATTCGCGGCGCGTGCACATGCACGCGCCGCG-3'-FAM.

[0077] Fifth Chain: 5'-BHQ1-AATCCGCA.

[0078] The sixth chain top chain (SEQ ID NO.7): 5'-p-ACATAATCCGCATTGCGGCGCTAACAACACTCAACTTCACTCA.

[0079] The sixth chain bottom chain (SEQ ID NO.8): TGAGTGAAGTTGAGTGTTGTTAGCGCCGCAATGCGGATTATGT.

[0080] Test group B (5nt continuous GC): Third chain (SEQ ID NO.9): TTGCGGCGCTAACAACAACCCGCAGTTGTTAGCG.

[0081] Fourth chain (SEQ ID NO.10): AACAACTGCGGGTTCGCGGCGCGTGCACATGCACGCGCCGCG-3'-FAM.

[0082] Fifth Chain: 5'-BHQ1-AACCCGCA.

[0083] The sixth chain top chain (SEQ ID NO.11): 5'-p-ACATAACCCGCATTGCGGCGCTAACAACACTCAACTTCACTCA.

[0084] The sixth chain bottom chain (SEQ ID NO.12): TGAGTGAAGTTGAGTGTTGTTAGCGCCGCAATGCGGGTTATGT.

[0085] Test group C (6nt continuous GC): Third chain (SEQ ID NO.13): TTGCGGCGCTAACAACACCCCGCAGTTGTTAGCG.

[0086] Fourth chain (SEQ ID NO.14): AACAACTGCGGGGTCGCGGCGCGTGCACATGCACGCGCCGCG-3'-FAM.

[0087] Fifth Chain: 5'-BHQ1-ACCCCGCA.

[0088] The sixth chain top chain (SEQ ID NO.15): 5'-p-ACATACCCCGCATTGCGGCGCTAACAACACTCAACTTCACTCA.

[0089] The sixth chain bottom chain (SEQ ID NO.16): TGAGTGAAGTTGAGTGTTGTTAGCGCCGCAATGCGGGGTATGT.

[0090] Test group D (8nt continuous GC): Third chain (SEQ ID NO.17): TTGCGGCGCTAACAACGCGCCGCGTGTTAGCG.

[0091] Fourth chain (SEQ ID NO.18): AACAACCGCGGCGCCGCGGCGCGTGCACATGCACGCGCCGCG-3'-FAM.

[0092] Fifth Chain: 5'-BHQ1-GCGCCGCG.

[0093] The sixth chain top chain (SEQ ID NO.19): 5'-p-ACATGCGCCGCGTTGCGGCGCTAACAACACTCAACTTCACTCA.

[0094] The sixth chain bottom chain (SEQ ID NO.20): TGAGTGAAGTTGAGTGTTGTTAGCGCCGCAACGCGGCGCATGT.

[0095] 1. Standardized implementation of reagent preparation and annealing Step 1. Preparation of single-chain stock solution Preparation: Take all synthesized nucleic acid dry powders (third, fourth, fifth, sixth top strand, and sixth bottom strand), centrifuge them, and add the corresponding volume of 1×TE Buffer to dissolve them thoroughly. Prepare a 100 μM high-concentration stock solution (it is recommended to aliquot and store at -20°C in the dark).

[0096] Step 2. Preparation of independent working solution Third chain: Take 100 μM stock solution and dilute it with 1×TE at a ratio of 1:100 to prepare 1 μM independent single-chain working solution.

[0097] (Note: Since the top / bottom chains of the fourth, fifth, and sixth chains need to be assembled into bichain complexes separately, 100 μM stock solution is directly drawn for the next annealing preparation and no separate pre-dilution is required.)

[0098] Step 3. Modular annealing and assembly of the composite Annealing sample preparation: 1. Fourth-Phase Complex: Directly extract the stock solutions of the fourth and fifth chains (100 μM) and mix them at a molar ratio of 1:1.2 (a small overload of the fifth chain is used to completely suppress background fluorescence leakage). Dilute with 1×TE to bring the volume up to an equivalent working concentration of 10 μM for the fourth chain in the complex system. 2. Sixth-chain double-chain chassis: Directly extract the stock solutions of the sixth-chain top chain (100 μM) and bottom chain (100 μM), mix them at a 1:1 molar ratio, and dilute to volume with 1×TE to make the equivalent working concentration of the double chain in the system 1 μM.

[0099] 3. Third-chain error prevention system: A separate 1 μM self-contained single-chain working fluid system is provided. Thermodynamic annealing procedure: Place the three sets of independent solution tubes in a thermal circulator and uniformly set them to 95°C for 5 minutes, then allow them to cool naturally to room temperature. This procedure ensures precise coordination and assembly of the double-chain components, while simultaneously promoting the high-energy disintegration and correct re-entanglement of the hairpin structure within the third chain.

[0100] Low-temperature curing and storage: After annealing and cooling, all discrete product liquids should be immediately transferred to a strict ice bath at 0~4°C for constant temperature storage and reserve, and it is strictly necessary to prevent non-specific activation or coordination leakage of the system before mixing.

[0101] 2. System configuration and sampling matrix table Table 2 System Configuration 3. Continuous acquisition and evaluation of dynamic parameters Program A (corresponding to Experimental Channel 2A): 12°C, 10s, take a picture, repeat 60 times.

[0102] Program B (corresponding to Experiment 2B): Implemented by five different independent programs: (1) 12°C, 5 minutes.

[0103] (2) 45°C, variables (5s, 10s, 15s, 20s, 30s).

[0104] (3) 12°C, 10s, take a picture, repeat 50 times.

[0105] Results and data: See Figures 11-16 .

[0106] Figure 11 The results showed that Test group A (blue line 4nt): Isothermal experimental data showed that the peak started from the 18th cycle, and the exonuclease was blocked for about 3 minutes.

[0107] Test group B (red line 5nt): Isothermal experimental data showed that the peak started from the 36th cycle, and the exonuclease was blocked for about 6 minutes.

[0108] Test group C (green line 6nt): Isothermal experimental data showed that the peak started from 50 cycles, and the exonuclease was blocked for about 8 minutes.

[0109] Test group D (purple line 8nt): No peak was observed.

[0110] Experimental results show that continuous GC can effectively block the sliding of exonuclease, mainly by effectively blocking the exonuclease from unwinding dsDNA.

[0111] Figures 12-16 The results showed that Test group E (blue line 5s): Heating to 45 degrees Celsius for 5s accelerated the exonuclease's unwinding speed of the continuous GC region of dsDNA, and the peak started from the 25th cycle.

[0112] Test group F (red line 10s): Heating to 45 degrees Celsius for 10s accelerated the exonuclease's unwinding speed of the continuous GC region of dsDNA, and the peak started from 10 cycles.

[0113] Test group G (green line 15s): Heating to 45 degrees Celsius for 15s. During the heating process, the exonuclease completed the unwinding of the continuous GC region of dsDNA.

[0114] Test group H (purple line 20s): The temperature was increased to 45 degrees for 20s. During the heating period, the exonuclease completed the unwinding of the continuous GC region of dsDNA.

[0115] Test group I (yellow line 30s): The temperature was increased to 45 degrees Celsius for 30 seconds. During the heating period, the exonuclease completed the unwinding of the continuous GC region of dsDNA.

[0116] Experimental results show that a heating time of 15-20 seconds is appropriate for unwinding a continuous GC region of 5 nt.

[0117] Example 3 This embodiment aims to reveal the most crucial first-level kinetic reaction control (first-level target unlocking) in multiplex array biochemical nucleic acid computation. The experiment precisely modulates the geometric parameters of the foothold-mediated strand substitution reaction between the messenger molecule (third strand) and the specific recognition base rail (sixth strand), measuring and comparing the effect of the nucleotide scale ratio of v1 to v2 on the target reaction rate. Under isolated conditions, eliminating interference from other free probes and isothermal exonucleases in the cascade system, this experiment uses dynamic scanning curves to verify how the system maintains the stability of the internal hairpin structure at 12°C and triggers a rapid strand substitution reaction upon encountering the target, thus confirming the optimal matching extreme ratio of v1=6nt / v2=4nt.

[0118] Reaction mechanism: To facilitate direct time-domain fluorescence detection, the two ends of the third chain in this embodiment were modified (the 5' end was modified with a FAM fluorescent group, and the 3' end was modified with a BHQ1 quencher group). When it presents a closed conformation, the luminescence is quenched, and fluorescence is released after the all-transformed single chain is unwound (when the v1 length is 8nt, there will be background leakage, but it does not change the final fluorescence release amount). The third strand relies on internal v2 and c3, and stably connects the inverse complementary segments c3' and v2' through the inner loop region, forming a closed conformation with a hairpin-stopping region. When the complementary region v1' on the sixth strand (also known as the sixth target strand) encounters the free single strand v1 (foothold) of the third strand and binds, branching migration is triggered by self-heating mechanics. The subsequent hybridization front sequentially unfolds the intrinsic v2 / v2' and constant segments c3 / c3' of the third strand, breaking the hairpin and straightening it out.

[0119] Reaction procedure steps: Basic experimental information: Detection equipment: Bio-Rad C1000 Touch qPCR instrument (or equivalent real-time fluorescence quantitative instrument); Optical channel: FAM (excitation 494 nm / emission 518 nm); Total reaction volume: 20 μL / well; Operating standards: The configuration must be placed in a harsh ice bath at 0~4°C to prevent non-specific assembly activation leakage.

[0120] HPLC purification standards were used for the synthesis of all single-stranded nucleic acids.

[0121] Experimental group information: (Note: In this embodiment, the foothold v1 corresponds to the specific foothold in the claim; v2 corresponds to the first specific hairpin stem region; and c3 corresponds to the general hairpin stem region.)

[0122] Experiment 3A: Adjust the length of v1, fix the length of v2 at 4nt, and shorten or lengthen the size of the front foothold v1: Test group A1 (2nt), Test group A2 (4nt), Test group A3 (6nt), Test group A4 (8nt).

[0123] Experiment 3B: Adjust the length of v2, fix the length of v1 at 6nt, and adjust the pairing length of v2 in the inner area of ​​the hairpin: test group B1 (2nt), test group B2 (4nt), test group B3 (6nt), test group B4 (8nt).

[0124] The specific sequences involved in this embodiment are as follows.

[0125] Test group A1 (v1 = 2nt): Third chain (SEQ ID NO.21): 5'-FAM-GGCGCTAACAACAACCCGCAGTTGTTAGCG-BHQ1-3'.

[0126] Sixth chain target (SEQ ID NO.22): TGAGTGAAGTTGAGTGTTGTTAGCGCC.

[0127] Test group A2 (v1 = 4nt): Third chain (SEQ ID NO.23): 5'-FAM-GCGGCGCTAACAACAACCCGCAGTTGTTAGCG-BHQ1-3'.

[0128] Sixth chain target (SEQ ID NO.24): TGAGTGAAGTTGAGTGTTGTTAGCGCCGC.

[0129] Test group A3 (v1 = 6nt): Third chain (SEQ ID NO.25): 5'-FAM-TTGCGGCGCTAACAACAACCCGCAGTTGTTAGCG-BHQ1-3'.

[0130] Sixth chain target (SEQ ID NO.26): TGAGTGAAGTTGAGTTGTTGTTAGCGCCGCAA.

[0131] Test group A4 (v1 = 8nt): Third chain (SEQ ID NO.27): 5'-FAM-AATTGCGGCGCTAACAACAACCCGCAGTTGTTAGCG-BHQ1-3'.

[0132] Sixth chain target (SEQ ID NO.28): TGAGTGAAGTTGAGTTGTTGTTAGCGCCGCAATT.

[0133] Test group B1 (v2 = 2nt): Third chain (SEQ ID NO.29): 5'-FAM-TTGCGGCTAACAACAACCCGCAGTTGTTAG-BHQ1-3'.

[0134] Sixth chain target (SEQ ID NO.30): TGAGTGAAGTTGAGTTGTTGTTAGCCGCAA.

[0135] Test group B2 (v2 = 4nt): Third chain (SEQ ID NO.31): 5'-FAM-TTGCGGCGCTAACAACAACCCGCAGTTGTTAGCG-BHQ1-3'.

[0136] Sixth chain target (SEQ ID NO.32): TGAGTGAAGTTGAGTTGTTGTTAGCGCCGCAA.

[0137] Test group B3 (v2 = 6nt): Third chain (SEQ ID NO.33): 5'-FAM-TTGCGGCGCGCTAACAACAACCCGCAGTTGTTAGCGCG-BHQ1-3'.

[0138] Sixth chain target (SEQ ID NO.34): TGAGTGAAGTTGAGTTGTTGTTAGCGCGCCGCAA.

[0139] Test group B4 (v2 = 8nt): Third chain (SEQ ID NO.35): 5'-FAM-TTGCGGCCGCGCTAACAACAACCCGCAGTTGTTAGCGCGGC-BHQ1-3'.

[0140] Sixth chain target (SEQ ID NO.36): TGAGTGAAGTTGAGTGTTGTAGCGCGGCCCGCAA.

[0141] 1. Standardized implementation of reagent preparation and annealing Step 1. Preparation of single-chain stock solution Preparation: Take all synthesized nucleic acid dry powders and add 1×TE Buffer to each to a concentration of 10 μM.

[0142] Step 2. Preparation of independent working solution To accurately achieve the rapid collisional dynamic load gradient of the target sixth chain 20 nM and the messenger third chain 200 nM in the final reaction volume (20 μL), the working solution was diluted according to the following specifications. Target sixth strand: Take a sample from the corresponding 10 μM stock solution and dilute it 100 times with 1×TE Buffer to 100 nM single-strand working solution. Messenger third strand: Take a sample from the corresponding 10 μM stock solution and dilute it with 1×TE Buffer to a high concentration of 800 nM single-stranded working solution.

[0143] Step 3. Static deployment of the reaction substrate Pre-dilute 10× isothermal reaction buffer into the chassis: Draw 4 μL of the prepared 100 nM sixth-strand working solution, 2 μL of 10× isothermal buffer, and 9 μL of nuclease-free water for premixing.

[0144] A base physical reference phase with a total volume of 15 μL per well was pre-loaded inside the optical plate and allowed to stand stably in an ice bath.

[0145] 2. System configuration and sampling matrix table This test completely eliminates the use of external enzymes; the final reaction relies entirely on the autonomous collision and release of the free probe. The sample spotting plan follows the following matrix volume.

[0146] Table 3 System Configuration 3. Continuous acquisition and evaluation of dynamic parameters Step 1. Run the program control on the computer. Reaction temperature: Maintained at 12℃ isothermally throughout the process.

[0147] Fluorescence sampling: The FAM channel fluorescence was read once every 10 seconds (10s / cycle), and this was performed continuously for 60 cycles, for a total monitoring time of 10 minutes.

[0148] Step 2. Data Acquisition and Post-processing Export real-time relative fluorescence intensity (RFU) data and construct reaction kinetic rate evaluation curves with time as the horizontal axis and RFU as the vertical axis for different combinations.

[0149] Results and data: See Figures 17-24 .

[0150] A1 (v1=2nt): Due to the short base point, the reaction dissociation rate is low. The fluorescence intensity was relatively high. No significant increase in fluorescence signal was observed over time, indicating that the displacement reaction was extremely difficult to occur under these conditions.

[0151] A2 (v1=4nt): The fluorescence signal shows a slow upward trend, the reaction takes a long time to reach the plateau phase, and the replacement rate is low.

[0152] A3 (v1=6nt): It exhibits a rapid rise in fluorescence signal with a large slope, and reaches the plateau phase of maximum fluorescence intensity in a short time, indicating that the displacement reaction rate is extremely high.

[0153] A4 (v1=8nt): Its kinetic curves are similar to those of group A3 (v1=6nt), with no significant increase in reaction rate. This verifies the saturation of the foothold effect, indicating that the optimal thermodynamic driving efficiency of the system has been achieved in the 6nt configuration.

[0154] B1 (v2=2nt): The system already exhibited high background fluorescence before the target was added. This indicates that the internal hairpin structure is unstable, producing significant non-specific luminescence (false positives) and no effective conformational blocking effect.

[0155] B2 (v2=4nt): Same as A3.

[0156] B3: The elongated base pairing in the hairpin structure enhances internal resistance, increases the chain-opening activation energy, significantly hinders the substitution reaction, and significantly prolongs the time to reach the plateau phase.

[0157] B4: The internal pairing of up to 8nt forms a stable structure with an extremely high energy barrier. The driving force for branch migration is insufficient to overcome this barrier, and the decomposition reaction is almost completely suppressed. The signal only exhibits a horizontal noise floor.

[0158] Extreme value establishment and parameter conclusions: Experimental data from this invention demonstrate that v1[6nt]:v2[4nt] is the preferred configuration ratio. Based on experimental verification combining the pairing potential energy saturation law and the upper limit of the branch migration energy barrier: simply increasing the length of the foothold v1 (e.g., 8nt) cannot break through the kinetic upper limit caused by potential energy saturation, nor can it overcome the excessively high system unwinding barrier caused by v2 (e.g., 8nt). Therefore, the combination of v1 6nt and v2 4nt constitutes a set of optimal physicochemical parameter boundaries that balance reaction rate and specificity (signal intensity and background suppression).

[0159] Example 4 This embodiment aims to verify the specificity of the system for multiplex amplification and time-series detection under 68-target parallel detection conditions. The experiment used 18 sets of primers targeting the pET-22b(+) plasmid as standard references, combined with 50 sets of virtual matrix-free primers targeting specific targets, to perform co-amplification and detection within a single system. The cross-interference rate and relative quantitative accuracy of the system were evaluated using the timing and quantitative signals generated by the plasmid.

[0160] Multiple competitive validation principle: The system contains a target plasmid and a mixture of 68 primers. The aim is to verify that 18 target primers achieve specific amplification, while the remaining 50 template-free primers do not produce non-specific amplification, thus confirming the absence of false positives.

[0161] Example of first primer (3'-5'): Table 4 First Primer Third chain example (5'-3'): Table 5 Third Chain Example of the fourth chain (5'-3'): Table 6 Fourth Chain Example of the sixth chain (3'-5'): Table 7 Sixth Chain The specific sequences involved in this embodiment are as follows.

[0162] Fourth chain (SEQ ID NO.37): AACAACTGCGGGTTCGCGGCGCGTGCACATGCACGCGCCGCG-FAM.

[0163] Fifth Chain: BHQ1-AACCCGCA.

[0164] Sixth chain (SEQ ID NO.38):

[0165] First primer-01 (Target_01) (SEQ ID NO.39): GACCAACAACTGCGGGTTGTTGTTGGTCTCGAGTAAAAGACTCGCAGGAGTCGCATAAGGGAG.

[0166] First primer-02 (Target_02) (SEQ ID NO.40): ATGGAACAACTGCGGGTTGTTGTTCCATAGACTGAAAAGACTCCCGGTGTCTCTTATCAGACC.

[0167] First primer-03 (Target_03) (SEQ ID NO.41): AACCAACAACTGCGGGTTGTTGTTGGTTATCGGAAAAAGACTCGTTTCTGCGAAAACGCGGGA.

[0168] First primer-04 (Target_04) (SEQ ID NO.42): GTCGAACAACTGCGGGTTGTTGTTCGACCACTAGAAAAGACTCGTCGCGGCGATTAAATCTCG.

[0169] First primer-05 (Target_05) (SEQ ID NO.43): GCACAACAACTGCGGGTGTTGTTGTGCCTGTGAAAAAGACTCATTTCTTGATGTCTCTGACC.

[0170] First primer-06 (Target_06) (SEQ ID NO.44): CATCAACAACTGCGGGTTGTTGTTGATGACCGCTAAAAGACTCATGCAAATGCTGAATGAGGG.

[0171] First primer-07 (Target_29) (SEQ ID NO.45): ACACAACAACTGCGGGTTGTTGTTGTGTAGATCGAAAAGACTCGATCGTGCTCCTGTCGTTGA.

[0172] First primer-08 (Target_30) (SEQ ID NO.46): AGGTAACAACTGCGGGTTGTTGTTACCTTCCACCAAAAGACTCTGCTGCAAAACGTCTGCGAC.

[0173] First primer-09 (Target_31) (SEQ ID NO.47): GGTTAACAACTGCGGGTTGTTGTTAACCGTAACGAAAAGACTCTGTTCCGGATCTGCATCGCA.

[0174] First primer-10 (Target_32) (SEQ ID NO.48): TTGGAACAACTGCGGGTTGTTGTTCCAATCCTCAAAAAGACTCACATCTGTATTAACGAAGCG.

[0175] First primer-11 (Target_33) (SEQ ID NO.49): GTGCAACAACTGCGGGTTGTTGTTGCACGCCACTAAAAGACTCACCGGGCATGTTCATCATCA.

[0176] First primer-12 (Target_34) (SEQ ID NO.50): CCTCAACAACTGCGGGTTGTTGTTGAGGTACCGCAAAAGACTCTTCATCGGTATCATTACCCC.

[0177] First primer-13 (Target_35) (SEQ ID NO.51): GATCAACAACTGCGGGTTGTTGTTGATCATCCACAAAAGACTCGAAGCCAGACATTAACGCTT.

[0178] First primer-14 (Target_36) (SEQ ID NO.52): CCGTAACAACTGCGGGTTGTTGTTACGGCGATTGAAAAGACTCGAACAGGCAGACATCTGTGA.

[0179] First primer-15 (Target_43) (SEQ ID NO.53): ATCCAACAACTGCGGGTTGTTGTTGGATAAGCTGAAAAGACTCGTAAAAAGGCCGCGTTGCTG.

[0180] First primer-16 (Target_47) (SEQ ID NO.54): GGCTAACAACTGCGGGTTGTTGTTAGCCGCTGCTAAAAGACTCGTAGGTCGTTCGCTCCAAGC.

[0181] First primer-17 (Target_48) (SEQ ID NO.55): GAGCAACAACTGCGGGTTGTTGTTGCTCCTCGTGAAAAGACTCAGACACGACTTATCGCCACT.

[0182] First primer-18 (Target_58) (SEQ ID NO.56): TGGTAACAACTGCGGGTTGTTGTTACCAGACCAGAAAAGACTCCAGTGGAACGAAAACTCACG.

[0183] Second primer-01 (Target_01) (SEQ ID NO.57): CATACTCTGCGACATCGTAT.

[0184] Second primer-02 (Target_02) (SEQ ID NO.58): GCAACGACTGTTTGCCCGCC.

[0185] Second primer-03 (Target_03) (SEQ ID NO.59): AATTTGCGACGGCGCGTGCA.

[0186] Second primer-04 (Target_04) (SEQ ID NO.60): ATCCAGCGGATAGTTAATGA.

[0187] Second primer-05 (Target_05) (SEQ ID NO.61): AGACGCGCCGAGACAGAACT.

[0188] Second primer-06 (Target_06) (SEQ ID NO.62): GCTGTCTTCGGTATCGTCGT.

[0189] Second primer-07 (Target_29) (SEQ ID NO.63): AAACCGAAGACCATTCATGT.

[0190] Second primer-08 (Target_30) (SEQ ID NO.64): AGGTGTTCCACAGGGTAGCC.

[0191] Second primer-09 (Target_31) (SEQ ID NO.65): TACTGGAACGTTGTGAGGGT.

[0192] Second primer-10 (Target_32) (SEQ ID NO.66): ACGAGAGAGGATGCTCACGA.

[0193] Second primer-11 (Target_33) (SEQ ID NO.67): TGATAAAGCGGGCCATGTTA.

[0194] Second primer-12 (Target_34) (SEQ ID NO.68): ATCCGCGTCCAGCTCGTTGA.

[0195] Second primer-13 (Target_35) (SEQ ID NO.69): TGTGTCAGAGGTTTTCACCG.

[0196] Second primer-14 (Target_36) (SEQ ID NO.70): GCTCCCGGCATCCGCTTACA.

[0197] Second primer-15 (Target_43) (SEQ ID NO.71): GAGAGCGCACGAGGGAGCTT.

[0198] Second primer-16 (Target_47) (SEQ ID NO.72): CTGCTAATCCTGTTACCAGT.

[0199] Second primer-17 (Target_48) (SEQ ID NO.73): TGGCTTCAGCAGAGCGCAGA.

[0200] Second primer-18 (Target_58) (SEQ ID NO.74): GATTAAGCATTGGTAACTGT.

[0201] Table 8 GC content of each primer functional region Reaction procedure steps: Phase 1: First amplification (multi-target exponential amplification and background clearing) 1. Primer synthesis and working solution preparation Multiple primer synthesis: The 136 primers synthesized in this example (68 forward-contracting first strands and 68 backward-contracting second strands) were all HPLC purified.

[0202] Preparation of the 68-primer mixture: 136 dry powder primers were thoroughly resuspended in 1×TE Buffer (pH 8.0) to 100 μM. The entire primer set was then mixed in equal proportions and brought to a final volume with ultrapure water to achieve a single primer concentration of 2.0 μM in the initiation chamber. 5.0 μL of this mixture was added to a 50 μL amplification system to ensure a final primer concentration of 0.2 μM.

[0203] Standard plasmid template preparation: Only a single pET-22b(+) plasmid was used as the amplification template throughout the entire reaction. The concentration was precisely diluted after being determined by NanoDrop. 5.0 μL was added to a 50 μL system, and the final concentration was controlled at 0.2 ng / μL (total loading 10 ng). Due to the two-stage cascade amplification process, this 18-fold solid-state signal was intended to achieve relative quantification and peak consistency.

[0204] Polymerase selection: KlenTaq DNA polymerase (premixed solution 2×PCR Master Mix) lacking 5'-3' exonuclease activity was used to completely avoid the risk of accidental primer degradation during subsequent polymerization.

[0205] 2. System Construction (Single-tube system, final volume: 50 μL) Table 9 System Configuration 3. Instrument Setup Place the thoroughly mixed reaction tube on a PCR amplification platform with a heat-sealed lid and execute the following thermal cycling program settings: Table 10 Amplification Procedure Free primer elimination and nucleic acid purification: 1. System construction (final volume 51.0 μL): The PCR product from the first amplification in stage one was directly used, and undiluted E. coli exonuclease I stock solution was added.

[0206] Table 11 System Configuration 2. Instrument Setup After short-term centrifugation, place the mixture in a constant-temperature reactor. Digestion and purification: Incubate at 37°C for 30 min. Exonucleases degrade single-stranded primers to purify the background. Enzyme inactivation: Heat to 80°C and incubate for 10 min to inactivate Exo I while retaining the double-stranded amplification product.

[0207] Phase Two: Third-strand isothermal amplification This stage utilizes an isothermal nick-displacement reaction for a second round of amplification, releasing the third chain.

[0208] Synergistic incision and displacement amplification: 1. System construction (single tube volume: 100 μL): Add amplification components and isothermal double enzyme tubes to the double-stranded background purified in stage one.

[0209] Table 12 System Configuration 2. Instrument Setup After mixing in the correct proportions, transfer the mixture to a constant temperature bath. Isothermal amplification: Incubate at 60°C for 30 min. Nt.BstNBI works synergistically with Bst polymerase to release the third strand through cleavage and strand displacement. Enzyme inactivation: Heat to 80°C and hold for 20 min to inactivate the enzyme, obtaining the third-strand single-stranded product for subsequent detection.

[0210] Phase Three: Time-resolved fluorescence detection The sixth strand and the fourth-to-fifth strand complex were mixed and detected using a temperature-controlled cyclic PCR instrument.

[0211] Step 1. Probe pre-annealing and substrate preparation: Fourth and fifth chain complex: 100 μM of fourth and fifth chains were mixed in a 1:1 ratio in a 1× buffer system. After denaturation at 95°C for 5 min, the mixture was annealed to 12°C at a cooling rate of 0.1°C / s to a final concentration of 50 μM, providing excess probe.

[0212] Sixth strand: Due to the long sequence caused by the 68-strand target tandem, the full-length gene sequence was directly synthesized and cloned into the plasmid. Specific Type IIS restriction endonuclease recognition sites (such as BsaI or BsmBI) were pre-defined at both ends of the core sequence of the sequencing track. After endonuclease digestion and stripping from the vector, the 5'-phosphate group (5'-P) was retained at the double strand ends, meeting the substrate requirements of Lambda exonucleases. The resulting gel was purified for later use.

[0213] Sixth-strand degradation protection: A GGGG sequence is introduced at the 5' end of the sixth strand to generate a G-quadruplex that blocks the Lambda exonuclease; its complementary base strand is unprotected and digested by the exonuclease, thus exposing the binding target site on the sixth strand unidirectionally. The 20nt sequence at the 5' end of the sixth strand serves as a buffer binding region.

[0214] Synchronization of initiation arrest and enzymatic digestion: An arrest region is retained at the initiation of the sixth chain, and the exonuclease is paused in the arrest region at 12°C; when the first 45°C pulse arrives, the exonuclease will start digestion synchronously again.

[0215] Step 2. Reaction loading table Operating conditions: Prepared in an ice bath at 0~4°C, reaction volume 20 μL.

[0216] Table 13 System Configuration Step 3. Temperature control and fluorescence acquisition: After centrifugation and remixing, the background baseline was read at 12°C. The thermal cycler detection program is as follows, performing 69 scan cycles: Table 14 Reaction Procedure Data export and decoding reconstruction: 1. After the reaction is complete, the raw fluorescence data charts are directly exported from the instrument.

[0217] 2. Because the Lambda exonuclease precisely degrades only one repeating unit on the sixth strand in each temperature cycle under programmed temperature control, there is a strict one-to-one correspondence between the number of temperature cycles and the spatial location of the target binding region on the sixth strand. When the system detects a fluorescence signal jump (luminescence peak) in the Nth cycle, it uniquely and definitively indicates the presence of the target corresponding to the Nth specific unit on the sixth strand (i.e., the third strand generated by the amplification of the target first strand).

[0218] Results and data: See Figure 25 , Figure 26 .

[0219] Table 15-1 Interpretation of Results Table 15-2 Interpretation of Results Figure 25 Negative control (NTC) assessment: The baseline signal in the NTC group remained at approximately 200 RFU. This indicates that no nonspecific cross-reaction occurred between the primers and probes in the 68-fold multiplex system, resulting in no false positive signals. The locations with elevated fluorescence signals in the figure correspond to the target gene, while the remaining 50 template-free locations were negative.

[0220] Figure 26 Target-specific detection and signal stability: All 18 positive targets achieved specific binding and luminescence at their predetermined locations. Although the fluorescence background was slightly elevated, it was as expected. The average peak fluorescence intensity of these 18 positive targets was 2848.20, with a relative standard deviation (CV) of only 4.58%. This result demonstrates that the system exhibits good uniformity and stability in the amplification and detection signals of each target during high-multiplex detection.

[0221] It should be noted that, in this document, the terms "comprising," "including," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Unless otherwise specified, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes that element.

[0222] The embodiments of the present invention have been described above with reference to the accompanying drawings. However, the present invention is not limited to the specific embodiments described above. The specific embodiments described above are merely illustrative and not restrictive. Those skilled in the art can make many other forms under the guidance of the present invention without departing from the spirit and scope of the claims. All of these forms are within the protection scope of the present invention.

Claims

1. A multiplex nucleic acid detection system based on a programmable DNA structure state machine and an enzyme-catalyzed clock stepping mechanism, characterized in that, The multiplex nucleic acid detection system includes detection reagents and detection equipment; the detection reagents include enzyme reaction reagents and nucleic acid reaction reagents, and the nucleic acid reaction reagents include separately configured signal strands, time-series strands, and primer pairs, each primer pair containing a first primer and a second primer; when used for multiplex nucleic acid detection, multiple primer pairs are configured; The first primer is a forward-specific amplification strand, which amplifies the first strand; The second primer is a reverse specific amplification strand, which amplifies the second strand; The structures of the first chain and the second chain are complementary; The second chain has a nicking enzyme recognition region, which is used to release the third chain via a nicking chain replacement reaction after amplification; The first chain is provided with a gene binding region for specific binding to the target gene, a nicking enzyme recognition region and six functional regions; wherein the first to sixth functional regions are connected end to end in sequence, and the second functional region is complementary to the sixth functional region and the third functional region is complementary to the fifth functional region, so that the third chain forms a self-locking hairpin structure in the free state. The first functional region serves as a complementary sequence to the specific foothold of the third chain; the GC content of the first functional region is 40-66%; and its length is 6 nt. The second functional region is a complementary sequence to the specific stem region sequence of the third strand; the GC content of the second functional region is 50-75%; and its length is 4 nt. The third functional region is a complementary sequence to the general stem region sequence of the third chain; the GC content of the third functional region is 17-33%; and its length is 6 nt. The fourth functional region is a complementary sequence to the flexible loop region of the third chain; the GC content of the fourth functional region is 60-75%; and its length is 8 nt. The fifth functional region serves as a complementary sequence to the general binding site of the third chain and the stem region sequence; the GC content of the fifth functional region is 17-33%; and its length is 6 nt. The sixth functional region is a complementary sequence to the specific stem region sequence of the third strand; the GC content of the sixth functional region is 50-75%; and its length is 4 nt. The signal chain consists of a fourth chain and a fifth chain, wherein the fourth chain is a fluorescent signal chain and the 3' end of the fluorescent signal chain is labeled with a fluorescent group; The fourth chain is a single-chain hairpin structure, which includes a probe receiving foothold, a quenching chain bonding area, a probe strong hairpin stem structure, and a probe flexible ring area structure; the probe strong hairpin stem structure is connected to the probe flexible ring area structure. The fifth chain is a quenching chain, and the 5' end of the quenching chain is marked with a quenching group; the fifth chain has a single-chain structure; the fifth chain has a sequence that hybridizes and complements the quenching chain binding region of the fourth chain; After being combined with the time-series chain, the third chain has a probe receiving foothold for combining with the fourth chain and a quenching chain binding region and a sequence structure that replaces the fifth chain. The time-series strand is the sixth strand, which is a one-dimensional double-stranded DNA formed by the tandem connection of multiple units. During enzymatic digestion, the upper strand is degraded, exposing the functional regions of the lower strand in sequence. Each unit on the sixth strand contains five functional regions: The seventh functional region incorporates the specific foothold sequence of the third chain; the GC content of the seventh functional region is 40-66%; and its length is 6 nt. The eighth functional region is bound to a specific stem region sequence of the third strand; the GC content of the eighth functional region is 50-75%; and its length is 4 nt. The ninth functional region is combined with the general stem region sequence of the third strand; the GC content of the ninth functional region is 17-33%; and its length is 6 nt. The tenth functional region is a physical buffer that provides physical space and reduces steric hindrance to the preceding functional region when Lambda exonuclease stagnation occurs; the GC content of the tenth functional region is 0-50%; and its length is 4 nt. The eleventh functional region acts as a blocking region, and after exposure, it combines with the fifth chain to perform quenching; the GC content of the eleventh functional region is 60-75%; and its length is 8nt. The enzyme reaction reagent contains DNA polymerase, exonuclease, strand displacement polymerase, nick endonuclease, and Lambda exonuclease. The Lambda exonuclease performs enzymatic digestion on the sixth strand. The digestion process of the Lambda exonuclease is regulated by the structure of the eleventh functional region of the sixth strand and a programmed temperature control, exhibiting a run-block-run cycle. The programmed temperature control is a 45℃ high-temperature - 12℃ low-temperature cycle control program.

2. The multiplex nucleic acid detection system as described in claim 1, characterized in that, The detection equipment of the multiplex nucleic acid detection system includes a fluorescence detection device.

3. A multiplex nucleic acid detection method based on a programmable DNA structure state machine and enzyme-catalyzed clock stepping, characterized in that, The multiplex nucleic acid detection method is based on the multiplex nucleic acid detection system described in claim 1 or 2, and includes the following steps: S01: Design a first primer and a second primer for the target gene to be detected. The gene binding regions of the first primer and the second primer are used to locate and amplify the target gene. When the reaction system includes multiple target genes, design multiple primer pairs. S02: DNA polymerase is added to the reaction system and amplified together with the first primer and the second primer. The amplification product is double-stranded DNA. The double-stranded DNA consists of a first strand and a second strand, and the first strand and the second strand are structurally complementary. S03: Add a single-strand-specific exonuclease to the reaction system to remove the primers; S04: Heat the aforementioned reaction system to deactivate the enzymes therein; S05: Add nick endonuclease and strand displacement polymerase to the reaction system to obtain the third strand; then perform isothermal amplification of the third strand; S06: The reaction program is controlled to inactivate the endoglucanase and the chain displacement polymerase. S07: Use a pre-annealing process to hybridize the fourth chain and the fifth chain together to form a fourth chain-fifth chain complex; S08: Add the fourth-fifth strand complex, the sixth strand, and the Lambda exonuclease, so that the third strand in the system participates in the reaction based on the sixth strand's time-stepping mechanism; start the fluorescence detection device, set the reaction conditions to dual-temperature programmed variable temperature cycling, and collect the fluorescence signal at low temperature; obtain the target gene by analyzing the fluorescence signal data; S08 is a reaction based on the fluorescence signal and quenching reaction of enzyme digestion, and the reaction conditions are a cyclic temperature-controlled reaction with low temperature of 12℃ and high temperature of 45℃; When the reaction system contains multiple target genes, S08 analyzes and identifies the specific types of multiple target genes and the detection results based on the time of fluorescence signal appearance or the number of temperature cycles.

4. The multiplex nucleic acid detection method as described in claim 3, characterized in that, S01 is a PCR amplification reaction, which involves 20-25 cycles of denaturation-annealing-extension.

5. The multiplex nucleic acid detection method as described in claim 3, characterized in that, S05 is an isothermal amplification reaction, and the reaction conditions are a constant temperature reaction at 40-60℃ for 20-30 minutes for amplification.

Citation Information

Patent Citations

  • Thermostatic methods, compositions, kits and systems for detecting nucleic acids

    CN116096884A

  • Preparation method of light-regulated single-stranded DNA and application of light-regulated single-stranded DNA in CRISPR nucleic acid detection

    CN120591381A