Reagent compositions, kits and uses

Abstract

The present application relates to the technical field of biological detection, and discloses a reagent composition, a kit and a use. The reagent composition of the present application comprises reagents for detecting the methylation level of a cervical cancer marker gene or a fragment thereof, wherein the marker gene comprises GSX1 a gene, TBX5 a gene and CA10 a gene. Preferably, the reagent composition of the present application can realize efficient non-invasive screening of high-grade cervical precancerous lesions and cervical cancer by detecting the methylation level of the above marker gene, and has high detection specificity and sensitivity.

Description

Technical Field

[0001] This invention relates to the field of biological detection technology, specifically to a reagent composition, a reagent kit, and its uses. Background Technology

[0002] Cervical cancer is a common malignant tumor of the female reproductive tract. Currently, commonly used cervical cancer screening methods mainly include visual inspection with acetic acid or Lugol's iodine, cytological examination (such as TCT), and HPV testing. Among these, visual inspection has low sensitivity and specificity, and is generally used in areas with limited medical resources or where HPV testing or cytological examination is not available. TCT testing suffers from insufficient sensitivity, and the results are highly dependent on the pathologist's subjective interpretation experience, easily producing false negatives. This method also heavily relies on the operator's skill level. While HPV testing has high sensitivity, its positive predictive value for cervical cancer is low. To further confirm the diagnosis, many women with only transient infection or low-risk lesions require further colposcopy and biopsy, resulting in poor testing speed and convenience. Early detection through screening at the precancerous stage, and timely intervention and treatment, can effectively reduce the incidence and mortality of cervical cancer.

[0003] Therefore, there is an urgent need to develop methods that are highly sensitive and specific and easy to use, so as to provide non-invasive, accurate and convenient detection methods for cervical cancer or precancerous lesions. Summary of the Invention

[0004] The purpose of this invention is to overcome the aforementioned problems in the prior art and provide a reagent composition, a kit, and its uses. The reagent composition provided by this invention detects the methylation level of specific gene combinations, exhibiting high detection specificity and sensitivity. Furthermore, this composition can achieve efficient screening for cervical cancer and precancerous lesions by detecting cervical exfoliated cell samples, thereby improving patient compliance and detection efficiency.

[0005] To achieve the above objectives, a first aspect of the present invention provides a reagent composition for detecting cervical cancer and precancerous lesions, the reagent composition comprising a reagent for detecting the methylation level of a marker gene or a fragment thereof, wherein the marker gene includes... GSX1 Gene, TBX5 Genes and CA10 At least one of the genes.

[0006] A second aspect of the present invention provides a reagent composition for detecting the methylation level of a marker gene, the reagent composition comprising at least one of the following combinations (1)-(3): (1) Detection GSX1 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:5-6, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:7; And / or primer pairs with nucleotide sequences as shown in SEQ ID NO:20-21, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:22; (2) Detection TBX5 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:8-9, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:10; And / or primer pairs with nucleotide sequences as shown in SEQ ID NO:23-24, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:25; (3) Detection CA10 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:11-12, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:13; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:26-27, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:28.

[0007] A third aspect of the present invention provides a kit for detecting cervical cancer and precancerous lesions, the kit comprising the reagent composition described in the first or second aspect.

[0008] The fourth aspect of the present invention provides the use of the reagent composition described in the first or second aspect, or the kit described in the third aspect, in screening drugs for the treatment of cervical cancer and precancerous lesions.

[0009] The fifth aspect of the present invention provides joint detection GSX1 Gene, TBX5 Genes and CA10 Application of reagents for gene methylation levels in the preparation of products for detecting cervical cancer or precancerous lesions.

[0010] Through the above technical solution, the present invention can achieve at least the following beneficial effects: (1) This invention performs combined detection of methylation levels of specific cervical cancer and precancerous lesion marker genes and their combinations, which has a good screening effect on high-grade cervical precancerous lesions and cervical cancer, and the detection specificity and sensitivity are both at a high level.

[0011] (2) The reagent composition of the present invention can be used for non-invasive early screening and diagnosis of high-grade cervical precancerous lesions and cervical cancer. The detection time is short, the operation process is simple and non-invasive, which helps to improve patient compliance, reduce the difficulty of detection, and reduce the dependence on the professionalism of the testing personnel and equipment. It has the potential for clinical application and promotion.

[0012] (3) When using the reagent composition or kit of the present invention for screening high-grade cervical precancerous lesions and cervical cancer, it has high detection sensitivity and specificity for cervical exfoliated cell samples, reducing the misdiagnosis rate and missed diagnosis rate. Attached Figure Description

[0013] Figure 1 This is a graph showing the results of quantitative real-time PCR detection of a positive sample with a methylation ratio of 0.5% and a reaction concentration of 10 ng / mL, using the kit from the preparation example in Example 1.

[0014] Figure 2 This is a graph showing the results of quantitative real-time PCR detection of a negative sample containing 100 ng / mL of reagent using the kit from the preparation example in Example 1. Detailed Implementation

[0015] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0016] In this invention, "methylation level" and "methylation status" both refer to the methylation status of the target sequence in the marker gene (which may include whether the target sequence in the marker gene is methylated, the degree of methylation, etc.), have similar meanings, and can be used interchangeably.

[0017] In this invention, the term "detection of cervical cancer and precancerous lesions" includes the detection and diagnosis of cervical cancer and precancerous lesions. Based on the severity of the lesions, cervical cancer and precancerous lesions are mainly classified into four grades: CIN1, CIN2, CIN3, and cervical cancer (CC). "CIN" refers to the grade of cervical intraepithelial neoplasia; "CIN1" refers to grade 1 cervical intraepithelial neoplasia, "CIN2" refers to grade 2 cervical intraepithelial neoplasia, and "CIN3" refers to grade 3 cervical intraepithelial neoplasia. The higher the grade, the higher the risk of cervical cancer. In this invention, "high-grade cervical precancerous lesions" include CIN2 and CIN3. "CIN2+" refers to CIN2, CIN3, and CC; "CIN3+" refers to CIN3 and CC.

[0018] Studies have shown that the methylation status of specific genes is closely related to the occurrence and development of cancer. Based on this, gene testing products for cervical cancer and its early screening have been developed in the field of cervical cancer and precancerous lesions. These include single-gene methylation testing and multi-gene methylation level testing, but both have significant technical limitations. For example, single-gene methylation testing suffers from poor sensitivity and specificity, easily leading to missed screenings and false positives, resulting in misdiagnosis. Therefore, in clinical applications, it needs to be combined with other testing methods for joint diagnosis, increasing the complexity and cost of the diagnostic process. Multi-gene methylation testing improves accuracy by expanding the range of genes to be tested. It confirms cervical cancer and related diseases by testing different genes one by one, collecting methylation level data of different genes, and then performing statistical analysis. However, it suffers from high reagent costs and complex result analysis. Moreover, the individual testing of multi-gene methylation is prone to sample contamination and operational errors due to the large number of samples, adversely affecting the accuracy of the test.

[0019] Through long-term research, the inventors of this invention ingeniously discovered that the methylation levels of several specific genes are highly associated with cervical cancer and high-grade cervical precancerous lesions. Using these genes (single or multiple genes) for cervical cancer screening exhibits excellent sensitivity and specificity, thereby effectively improving screening accuracy and the efficient utilization of medical resources, and significantly reducing referral rates. Therefore, this invention provides a method for detecting methylation levels in samples... GSX1 Gene, TBX5 Genes and CA10 A method for in vitro detection of cervical cancer and / or precancerous cervical lesions based on the methylation status of target sequences in genes. The method provided by this invention can detect cervical cancer and / or precancerous cervical lesions non-invasively and rapidly.

[0020] Based on this, a first aspect of the present invention provides a reagent composition for detecting cervical cancer and precancerous lesions, the reagent composition comprising a reagent for detecting the methylation level of cervical cancer marker genes or fragments thereof, wherein the marker gene includes GSX1 Gene (also known as) Gsh-1 ), TBX5 Genes and CA10 At least one of the genes.

[0021] The gene names involved in this invention have a general meaning in the art, and their complete sequences can be obtained through conventional methods in the art, such as by querying public bioinformatics databases such as NCBI.

[0022] The reagent composition provided by this invention can target the complete GSX1 Gene, TBX5 Genes and CA10The methylation level of a gene can be detected, or the methylation level (or state) of a specific segment (e.g., a single segment or multiple segments) of the gene can be detected. The inventors discovered that detecting and analyzing the methylation level of a specific region within the gene can achieve the goal of screening for cervical cancer and high-grade precancerous lesions at a high level of sensitivity and specificity. Compared to detecting the entire gene, detecting specific segments is simpler and easier; therefore, this invention preferably uses a specific region in the reagent composition. GSX1 Gene, TBX5 Genes and CA10 A reagent for detecting the methylation level of specific regions in a gene.

[0023] According to some preferred embodiments of the present invention, the reagent used to detect the methylation status of cervical cancer and precancerous lesion marker genes or fragments thereof is a reagent used to detect the methylation level of CpG island regions or fragments thereof in cervical cancer marker genes. CpG is an abbreviation for cytosine (C)-phosphate (p)-guanine (G), and "CpG island" refers to a region on the genome rich in CpG dinucleotides.

[0024] The reagent composition provided by this invention can detect the methylation level in the complete sequence of the CpG island region in the aforementioned genes, or it can detect the methylation level in a portion of the region (such as a single fragment or multiple fragments).

[0025] According to some preferred embodiments of the present invention, the reagent composition includes a reagent for detecting the methylation status of at least one of the gene fragments (also referred to as "target sequences" or "target marker sequences" in the present invention) shown in SEQ ID NO:1-3 and / or SEQ ID NO:17-19.

[0026] The reagent composition of the present invention can detect the methylation level of the target detection region sequence, or it can detect the methylation level of a segment in a marker gene that has at least 80% identity with the target sequence (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 100%, or any range of two of the above values, or any intermediate value within that range). For example, it can detect the methylation level of a gene fragment that contains additional nucleotides on top of the above sequence.

[0027] In this invention, "identity" refers to the percentage of identical sequences between two sequences. For example, 90% identity between sequence 1 and sequence 2 means that 90% of sequence 1 is identical to sequence 2, or 90% of sequence 2 is identical to sequence 1. Differences between the two sequences can be due to nucleotide deletions, additions, or substitutions. For example, sequence b is obtained by deleting 20 consecutive nucleotides from the 5' end of sequence a, which contains 100 nucleotides. Sequence a and sequence b have 80% identity, while sequence b and sequence a have 100% identity.

[0028] It is understood that, for a single gene, a gene fragment of that gene and a corresponding detection reagent are sufficient to detect the methylation level. Therefore, according to some preferred embodiments of the present invention, the reagent composition includes a reagent for detecting the methylation level of at least one of (a1)-(a3): (a1) Gene fragments with nucleotide sequences as shown in SEQ ID NO:1 and / or 17; (a2) Gene fragments with nucleotide sequences as shown in SEQ ID NO:2 and / or 18; (a3) Gene fragments with nucleotide sequences as shown in SEQ ID NO:3 and / or 19.

[0029] According to a preferred embodiment of the present invention, the reagent composition includes reagents for detecting the methylation level of gene fragments with nucleotide sequences such as SEQ ID NO:1, 2 and 3.

[0030] According to another preferred embodiment of the present invention, the reagent composition includes reagents for detecting the methylation level of gene fragments with nucleotide sequences such as SEQ ID NO:17, 2 and 3.

[0031] According to another preferred embodiment of the invention, the reagent composition includes reagents for detecting the methylation level of gene fragments with nucleotide sequences such as SEQ ID NO:1, 18 and 3.

[0032] According to another preferred embodiment of the present invention, the reagent composition includes reagents for detecting the methylation level of gene fragments with nucleotide sequences such as SEQ ID NO:1, 2 and 19.

[0033] According to a preferred embodiment of the present invention, the reagent composition further includes a reagent for detecting an internal standard. An "internal standard" refers to a non-target gene (or fragment thereof) that is detected together with the target gene (or a fragment thereof). Adding an internal standard reagent during detection can further improve detection accuracy. Typically, a known conserved gene in the target analyte (e.g., the sample used for detection) can be selected as the internal standard.

[0034] Preferably, the internal label is at least one of human housekeeping genes or fragments thereof. "Housekeeping genes," also known as "family-managing genes" or "housekeeping genes," are a class of genes that are stably expressed in all cells.

[0035] According to a particularly preferred embodiment of the present invention, the internal standard is... ACTB The gene (whose complete sequence can be found in GenBank accession number: NC_000007.14) or a fragment thereof. ACTB The gene is the gene that encodes human cytoskeleton actin (β-Actin).

[0036] Preferably, the nucleotide sequence of the internal standard (target sequence) is as shown in SEQ ID NO:4.

[0037] In this invention, the reagents used to detect the methylation level of the marker gene and (optionally) the internal standard can be conventional reagents used in methods capable of performing the corresponding detections in the art. For example, detection can be performed using amplification-sequencing, biochips, quantitative PCR for methylation, etc. Correspondingly, the reagent composition of this invention can use reagents commonly used in the above-mentioned methods.

[0038] For example, when using methylation-based quantitative PCR for detection, according to a preferred embodiment of the present invention, the reagent composition includes nucleic acid primers and optional probes. "Optional probes" means that the probe is not a necessary component of the composition and can be selected for inclusion or exclusion based on actual needs. For example, when using methylation PCR-electrophoresis or methylation PCR-sequencing for detection, the composition may not contain probes; conversely, when using methylation-based quantitative PCR for detection, the composition may contain probes. "Methylation-based quantitative PCR" refers to a method that involves digesting the region to be detected with a methylation-sensitive restriction endonuclease, followed by quantitative PCR detection using primers and probes specifically designed for the detection target, thereby determining the methylation level of the region to be detected.

[0039] Any nucleic acid primer and (optional) probe capable of detecting the aforementioned marker gene and (optionally) internal standard are applicable to this invention. "Primer" refers to an oligonucleotide that, when placed under conditions that induce the synthesis of primer extension products complementary to the nucleic acid chain, i.e., in the presence of nucleotides and an inducer such as DNA or RNA polymerase and at suitable temperature and pH, can serve as a synthesis initiation point. Primers typically contain at least about 9, 10, 15, 20, or 25 or more nucleotides. "Probe" refers to a nucleic acid sequence that, under specified conditions, hybridizes to a target sequence and can be used to detect the presence of that target sequence. The probe is a fragment that hybridizes to at least 15 nucleotides in the target sequence of the target gene under stringent conditions. To obtain better detection results, according to a particularly preferred embodiment of the invention, the reagent composition comprises at least one of the following combinations (1)-(3): (1) Detection GSX1 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:5-6, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:7; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:20-21, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:22; (2) Detection TBX5 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:8-9, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:10; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:23-24, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:25; (3) Detection CA10 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:11-12, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:13; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:26-27, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:28.

[0040] In some preferred embodiments, the reagent composition further includes: (4) Detection of internal standard ( ACTBPrimers and optional probes for the gene: primers with nucleotide sequences as shown in SEQ ID NO:14-15, and optional probes with nucleotide sequences as shown in SEQ ID NO:16.

[0041] According to a preferred embodiment of the present invention, the probe is modified with a reporter group (usually located at the 5' end), preferably a fluorescent reporter group. Any fluorescent reporter group commonly used in the art can be used in the present invention, such as ATTO 425, HEX, FAM, ROX, CY5, Quasar705, AF405, etc.

[0042] According to a preferred embodiment of the present invention, the probe is further modified with a fluorescence quenching group (typically located at the 3' end). Any quenching group commonly used in the art for use with a fluorescent reporter group is applicable to the present invention. For example, it can be BHQ0, BHQ1, BHQ2, BHQ3, SQ1, SQ2, etc. Those skilled in the art are familiar with the pairing between fluorescent groups and their corresponding fluorescence quenching groups; the quenching groups on different probes can be the same or different, which will not be elaborated further here.

[0043] According to some preferred embodiments of the present invention, the reagent composition further includes a negative control and / or a positive control.

[0044] A negative control refers to a target gene that is not methylated (such as the aforementioned marker gene or its fragment, or any fragment of the genomic gene containing it, or a whole human genome gene). In the reagent composition provided by this invention, the negative control may contain only one validated unmethylated marker gene or its fragment, or it may contain multiple validated unmethylated marker genes or their fragments.

[0045] A positive control refers to a reagent containing a target gene known to be methylated (such as the aforementioned marker gene or its fragment, or any fragment of the genomic gene containing it, or a whole human genome gene). In the reagent composition provided by this invention, the positive control may contain only one validated methylated marker gene or its fragment, or it may contain multiple validated methylated marker genes or their fragments.

[0046] In the reagent composition provided by the present invention, both the negative control and the positive control can be obtained by conventional means, such as by artificial synthesis.

[0047] It should be noted that the above-described reagent composition of the present invention actually achieves the following: GSX1 Gene, TBX5 Genes and CA10 The detection of gene methylation can therefore serve as a product for detecting the aforementioned gene methylation.

[0048] A second aspect of the present invention provides a reagent composition for detecting the methylation level of a marker gene, the reagent composition comprising at least one of the following combinations (1)-(3): (1) Detection GSX1 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:5-6, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:7; And / or primer pairs with nucleotide sequences as shown in SEQ ID NO:20-21, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:22; (2) Detection TBX5 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:8-9, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:10; And / or primer pairs with nucleotide sequences as shown in SEQ ID NO:23-24, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:25; (3) Detection CA10 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:11-12, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:13; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:26-27, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:28.

[0049] The reagent composition may also contain other components of the reagent composition in the first aspect, as described above, and will not be repeated here. This reagent composition can be used to detect cervical cancer and precancerous lesions, and can also be used in any other scenario requiring the detection of the methylation levels of the aforementioned marker genes.

[0050] A third aspect of the present invention provides a kit for detecting cervical cancer and precancerous lesions, the kit comprising the reagent composition described in the first or second aspect.

[0051] The kit provided by this invention may contain only core reagents for detecting cervical cancer and precancerous lesions (such as primers and optional probes used in the aforementioned marker gene detection), or it may include some convenient reagents for detection (such as negative and positive controls used in the aforementioned marker gene detection), and may further include other conventional reagents required for the detection process (such as buffer systems, enzymes, nucleotides, and other reagents required for PCR detection; and reagents required for sample pretreatment steps such as nucleic acid extraction, purification, and methylation detection). Any reagent commonly used in the art for marker gene detection can be applied to this invention, and those skilled in the art can select and adjust it according to the actual detection technology used.

[0052] According to some preferred embodiments of the present invention, the kit further includes at least one of an enzyme, a buffer, a magnesium source, and deoxyribonucleoside triphosphates (dNTPs).

[0053] Preferably, the enzyme comprises a methylation-sensitive restriction endonuclease and / or a DNA polymerase. Any enzyme suitable for use in methylation-based quantitative PCR is applicable to this invention. Preferably, the methylation-sensitive restriction endonuclease comprises at least one of HpaII, HinP1I, and HhaI. Any DNA polymerase available in the art for methylation-based quantitative PCR can be used in this invention, such as conventional DNA polymerases (e.g., Taq polymerase) or hot-start DNA polymerases (e.g., HS-Taq polymerase).

[0054] Preferably, the magnesium source comprises a water-soluble inorganic magnesium salt. Typically, the magnesium source can be provided in the form of an aqueous solution, such as magnesium chloride, magnesium sulfate, magnesium nitrate, etc., with a magnesium ion concentration of 1-6 mM.

[0055] More preferably, the kit also includes reagents and instruments for nucleic acid extraction and / or purification.

[0056] The reagents (or instruments) used for nucleic acid extraction and / or purification are primarily used to extract nucleic acids from samples, and the extracted nucleic acids are further detected using the reagents contained in the kit of this invention for detecting the methylation level of marker genes. Any reagents in the art that can be used to extract / purify nucleic acids from biological samples are applicable to this invention; they can be purchased directly commercially or prepared according to existing technology. The biological sample can be a test sample collected from a subject in need, such as at least one of histological sections, tissue biopsy / paraffin-embedded tissue, cells (e.g., cervical exfoliated cells).

[0057] In this invention, there are no particular restrictions on the concentration of the various reagents contained in the kit, and they can be adjusted according to actual testing needs.

[0058] To achieve better detection results (such as improved sensitivity, specificity, and accuracy), according to some preferred embodiments of the present invention, the final concentration of magnesium ions in the reagents included in the kit can be 1-6 mM; the final concentration of dNTPs can be 1-80 mM; the final concentration of methylation-sensitive restriction endonuclease can be 0.01-30 U / μL; the final concentration of primers can be 0.1-40 μM; and the final concentration of probes can be 0.1-20 μM. The final concentrations of primers and probes refer to the final concentration of one primer / probe.

[0059] The present invention further provides a method for detecting cervical cancer and precancerous lesions, the method comprising detecting a sample using the reagent composition described in the first or second aspect, or the kit described in the third aspect.

[0060] The methods provided by this invention can be either diagnostic or non-diagnostic. For example, diagnostic methods may include using the reagent compositions or kits provided by this invention to test samples from subjects in need, determining whether they have a risk of cervical cancer (e.g., whether they are in a low-risk stage of cervical intraepithelial neoplasia grade 1, or a high-risk precancerous stage of cervical intraepithelial neoplasia grade 2 or 3) or whether they have cervical cancer, thereby determining subsequent treatment plans (e.g., whether to conduct further referral, further treatment, etc.). As another example, non-diagnostic methods may include using the reagent compositions or kits provided by this invention to test samples in research or non-diagnostic testing, such as using the reagent compositions or kits provided by this invention to test experimental samples in research on the mechanisms of cervical cancer and precancerous lesions, drug development, etc.

[0061] Based on this, the fourth aspect of the present invention provides the use of the reagent composition described in the first or second aspect, or the kit described in the third aspect, in screening drugs for the treatment of cervical cancer and precancerous lesions.

[0062] For example, in the drug screening process, the reagent composition or kit of the present invention can be used to detect the methylation level of the aforementioned cervical cancer marker genes in cell samples or experimental animals after drug administration, thereby determining whether the efficacy of the drug meets the criteria for proceeding to the next step of the experiment.

[0063] Similarly, the present invention also provides the use of the reagent composition described in the first or second aspect, or the kit described in the third aspect, in screening samples for cervical cancer or precancerous cervical lesions.

[0064] The fifth aspect of the present invention provides joint detection GSX1 Gene, TBX5 Genes and CA10Application of reagents for gene methylation levels in the preparation of products for detecting cervical cancer or precancerous lesions.

[0065] Similarly, the present invention further provides joint detection. GSX1 Gene, TBX5 Genes and CA10 Application of gene methylation levels in the detection of cervical cancer or precancerous lesions of the cervix.

[0066] The applications of the fourth and fifth aspects provided by the present invention can be diagnostic (e.g., for medical testing to further determine and identify subsequent testing / treatment plans) or non-diagnostic (e.g., for research work, for drug screening, disease mechanism research and verification, etc.).

[0067] The present invention will be described in detail below through embodiments. It should be understood that the following embodiments are only used to further explain and illustrate the content of the present invention by way of example, and are not intended to limit the present invention.

[0068] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available products purchased from regular chemical or biological reagent / material suppliers, and all reagents are of analytical grade.

[0069] Preparation Example 1. Identify the target gene and prepare the target sequence and primers and probes for detecting the target sequence. by GSX1 Gene, TBX5 Genes and CA10 The combination of genes serves as a marker gene, and its target sequences are shown in SEQ ID NO:1-3 below: ATCTCTGTGGGTAAGCGGGGCCGCCGCGCAGAGGGACCGGGCAGGTGATCCGAAGCAGGATGGAGAGCCAGATGGAGGAAGAGGGACCCTGGGCTTTCTGGGGGCGGTGAGGGTCATGTCGGGGACTAAGG (SEQ ID NO: 1, GSX1 (Gene target sequence) GCCTGAAAATCTGGCCTGCTTTTTCCCGGGAACTGCGGAGGTTGTCTCTGTGACTTTGATTATTTGCATTGATGACCCTGGGGCAAGATTCTTGGACCAACCCTGGAGTCCGGCCCCGATCGAGTGGAGGTAGTTGGGGGA (SEQ ID NO: 2, TBX5 (Gene target sequence) TGGGAAGATCCAGGATTTCTCGGCGCGCTTGTCCCGATTGGGAACTGTGACGTTAGGAGATTTTGCACAAGCGCGGATGAACACACACATAACAAACACAAACACACACATACCCCGCGGGGATTTTTTATCCACTTTTAAT (SEQ ID NO: 3, CA10 (Gene target sequence) To further improve detection accuracy, the ACTB gene was used as an internal standard. The target sequence of the internal standard is shown below: GTTGTTACAGGAAGTCCCTTGCCATCCTAAAAGCCACCCCACTTCTCTCTAAGGAGAATGGCCCAGTCCTCTCCCAAGTCCACACAGGGGAGGTGATAGCATTGC (SEQ ID NO: 4, ACTB (Gene target sequence) The primers and probes used for detection are shown in Table 1, and all were synthesized by Hunan Kangde Biotechnology Co., Ltd. In Table 1, primers marked with "F" are upstream primers, primers marked with "R" are downstream primers, and probes are marked with "P".

[0070] Table 1

[0071] 2. Prepare the unit reaction reagent kit for PCR reaction. Prepare the reagents according to the required quantities for the unit reaction reagent kits (i.e., reagent kits used to detect one sample in one PCR reaction) in Table 2. In Table 2, the PCR amplification buffer was purchased from Hunan Kangde Biotechnology Co., Ltd., catalog number PCR buffer (S10); Taq enzyme was purchased from Feipeng Biotechnology Co., Ltd.; the methylation-sensitive restriction endonuclease mix was purchased from Hunan Kangde Biotechnology Co., Ltd., catalog number MRE S01, catalog number ME012-01; "upstream primer", "downstream primer" and "probe" are the quantities used for one sequence; the reagents are packaged separately according to the "PCR reaction solution" and "enzyme" in the table, that is, the PCR reaction solution is a mixture of the listed components, and the enzyme is a mixture of the listed enzymes.

[0072] Table 2

[0073] 3. Prepare control reagents Negative sample: Human genomic DNA with no target gene methylation verified by sequencing, at a concentration of 10 ng / µL.

[0074] Positive sample: Prepared by mixing fully methylated human genomic DNA and unmethylated genomic DNA from normal human cervical exfoliated cells. Includes: The concentration is 1 ng / μL containing 10% fully methylated human genomic DNA (1 ng / μL unmethylated normal human cervical exfoliated cell genomic DNA of the target gene: 1 ng / μL fully methylated human genomic DNA = 9:1). The concentration is 1 ng / μL containing 1% fully methylated human genomic DNA (1 ng / μL unmethylated normal human cervical exfoliated cell genomic DNA of the target gene: 1 ng / μL fully methylated human genomic DNA = 99:1). The concentration is 1 ng / μL containing 0.5% fully methylated human genomic DNA (1 ng / μL unmethylated normal human cervical exfoliated cell genomic DNA of the target gene: 1 ng / μL fully methylated human genomic DNA = 199:1).

[0075] 4. Prepare the reagent kit According to the target detection capacity of a single kit, combine and package the reagents prepared in steps 1-3.

[0076] Example 1 Using the kit prepared in the example, negative and positive samples were used as test samples to detect gene methylation levels, in order to determine its sensitivity and specificity.

[0077] Specific testing methods include: Take a unit reaction reagent kit, mix the reagents in the PCR tube, add 10 μL of the sample to be tested, mix well, and then place the PCR tube in the Hongshi Real-Time PCR Analyzer and perform the PCR reaction according to the reaction conditions in Table 3.

[0078] Table 3

[0079] Select the corresponding channel pair based on the fluorescent labeling group on the probe. GSX1 Gene, TBX5 Gene, CA10 Genes and internal standards ACTB Genetic testing was performed.

[0080] After the reaction is complete, the instrument automatically saves the results, which can be automatically analyzed using the instrument's built-in software. The intersection of the amplification curve and the threshold line is recorded as the Ct value (Ct is an abbreviation for cycle threshold, which refers to the number of cycles that the fluorescence signal in the PCR reaction tube takes to reach the set threshold).

[0081] Figure 1 and Figure 2The detection results for a positive sample with a methylation ratio of 0.5% (10 ng / reaction) and a negative sample with a methylation ratio of 100 ng / reaction are shown. As can be seen from the figure, all target genes showed obvious amplification curves in the positive sample, while only the internal standard showed an amplification curve in the negative sample. This indicates that the kit of the present invention has excellent specificity, and the fact that it can detect methylation of target sequences even at such a low final concentration in the positive sample demonstrates the kit's excellent sensitivity.

[0082] Example 2 The kit prepared in this study was used to test actual clinical samples to verify its effectiveness in detecting cervical cancer.

[0083] The test samples used in this embodiment included 400 clinically collected cervical exfoliated cell samples, of which 105 were normal samples, 88 were cervical intraepithelial neoplasia grade 1 (CIN1), 80 were cervical intraepithelial neoplasia grade 2 (CIN2), 65 were cervical intraepithelial neoplasia grade 3 (CIN3), and 62 were cervical cancer patients. Informed consent was obtained from the relevant personnel for the research content of this embodiment.

[0084] Specific testing and verification methods include: (1) Sample processing Nucleic acid was extracted from each sample using Sansure Biotech's S10025 nucleic acid extraction reagent and the Natch48 nucleic acid extractor.

[0085] (2) Sample testing and result analysis Following the method described in Example 1, the nucleic acids extracted from each sample were subjected to methylation fluorescent PCR detection. "CIN2-" indicates that the sample is CIN1 or a normal sample; the pathological result "CIN2+" indicates CIN2, CIN3, or cervical cancer; "CIN3-" indicates that the sample is CIN2, CIN1, or a normal sample; the pathological result "CIN3+" indicates CIN3 or cervical cancer.

[0086] Detection criteria: Select the corresponding channel for detection according to the fluorescent reporter group shown in Table 1. If the Ct value of the AF 405 internal standard channel is >32, the sample is considered invalid and needs to be resampled and tested. If the Ct value of the AF 405 internal standard channel is ≤32, and the Ct value of the target detection is ≤32, the sample is considered positive; otherwise, it is considered negative. Calculate the sensitivity under different definitions according to the following formula (1), and calculate the specificity under different definitions according to the following formula (2). When defining positive cases with different definitions, the negative, positive, sensitivity, and specificity results of different positive cases are shown in Table 4.

[0087] Definition 1: CIN2- is a negative case, and CIN2+ is a positive case; Definition 2: CIN3- is a negative case, and CIN3+ is a positive case.

[0088] Sensitivity (%) = Number of positive cases detected / Total number of positive cases × 100% Equation (1) Specificity (%) = Number of negative cases detected among negative cases / Total number of negative cases × 100% Equation (2) Table 4

[0089] As can be seen from Table 4, the present invention provides the use of GSX1 , TBX5 , CA10 The combined biomarker of the three targets achieved a high level of sensitivity in detecting cervical exfoliated cell samples of high-grade cervical precancerous lesions and cervical cancer, indicating that the three combined biomarkers are specific methylation gene combination biomarkers for high-grade cervical precancerous lesions and cervical cancer. Using this combination for screening high-grade cervical precancerous lesions and cervical cancer results in high accuracy and a low false negative rate. Furthermore, the specificity of the combined biomarker for detecting high-grade cervical precancerous lesions and cervical cancer samples exceeds 90%, demonstrating that this detection system has good specificity and a low false positive rate, providing an effective and accurate new method for screening and diagnosing high-grade cervical precancerous lesions and cervical cancer.

[0090] Example 3 Following the method in Example 2, the clinical samples used in Example 2 were tested, and the test results of each clinical sample were analyzed. The difference was that the primers and probes used in the kit to detect the target sequences of the marker genes were replaced with primers and probes targeting the following target sequences according to Table 5 (the fluorescent reporter group, fluorescent quencher group, and target sequence of the internal standard, as well as the primer and probe, remained unchanged). Specific primer and probe sequences are shown in Table 5, where "F" indicates the upstream primer, "R" indicates the downstream primer, and "P" indicates the probe. The analysis and calculation results of the clinical samples are shown in Table 6.

[0091] AGGTCTGATCGCTTCCTTCTCTGCTCTGCCACCTCCAGACAGCAGCTCTAACCAGCTGCCCAGCAGCAAGAGGATGCGCACGGCTTCACCAGCACGCAGCTGCTAGAGCTGGAGCGCGAGTTCGCTTCTAATATGTACCTGTCCCG (SEQ ID NO: 17, GSX1 (Gene replacement target sequence) CGCTGGCCGCCACAGTCCCCGGCCGGCGGGGCCATCGGCCCGGCTTAGCCAAATTGCTTTGACGGCTGGGGACAGTGTGGAGACATCAGCGCGAGGGCGATCTAATGGCTCCTAATTTCA (SEQ ID NO: 18, TBX5 (Gene replacement target sequence) GAAGGAGATTTCCCCACCAAACCCGCGCGCGCACACACACACACACCCAGCGCGCGGCTCTCCAGGGCCCCAGGGGAAAGTAGGGGCGGCGCGAGCACCACCCACCCACCCAGGCCGAGGCCAGGGGCAGCCAGTCCGCAGAAG (SEQ ID NO: 19, CA10 (Gene replacement target sequence) Table 5

[0092] Table 6

[0093] By comparing the test results of different target sequence combinations in Table 6, it can be seen that although the detection sensitivity and specificity fluctuate to some extent with the change of target sequence combination, overall, the detection sensitivity and specificity using the method selected in this invention are still effective. GSX1 , TBX5 , CA10 The three-target combination biomarker can achieve a high level of sensitivity in detecting cervical exfoliated cell samples of high-grade cervical precancerous lesions and cervical cancer, thereby achieving the goal of rapid and accurate screening for cervical cancer and advanced precancerous lesions.

[0094] Comparative Example 1 The clinical samples used in Example 2 were tested using the same methods as in Example 2. The difference was that one of the target genes was replaced with... HAS1 Genes were compared to assess the diagnostic performance of combined detection of different target genes for cervical cancer.

[0095] GSX1 Gene, TBX5 Gene, CA10 Genes and internal standards ACTB The target sequences of the gene are shown in SEQ ID NO:1-4, and their primers and probes are detailed in Table 1. HAS1 The target sequence of the gene is shown in SEQ ID NO:29, and its primers and probes are shown in Table 7 below.

[0096] CGAAGGCGATGGTCAGCACCCTCCGGGCCAGGCCGGAGCAGCGGCAGGCTGCAGGAGTGGGCTTGGGCGCGTCCTGCTGGGAGCGAGAGGGGAAAGGAAGGGGCATGAGTCCCGGGCGCATGAGCCTCCTCCGAGAGAAGATTA (SEQ ID NO: 29, HAS1 (Gene target sequence) Table 7

[0097] Note: In Table 7, CC- HAS1 -P is modified with a fluorescent reporter group at the 5' end and a corresponding fluorescent quencher group at the 3' end. The specific modified group depends on the fluorescent reporter group modified on the probes of other genes being detected together (so that the fluorescent reporter group modified on this probe is detected in a different channel than the fluorescent reporter group modified on the probes of other genes).

[0098] The sensitivity and specificity of cervical exfoliated cell samples were calculated using the method described in Example 2 for combined detection of different target gene combinations. The results are detailed in Table 8.

[0099] Table 8

[0100] As can be seen from Table 8, the detection results of different target gene combinations in the above-mentioned target gene joint detection system are different. Among them, the target gene combination selected in this invention ( GSX1 + TBX5 + CA10 The detection sensitivity and specificity of this combination are the highest. In other words, among these combined detection systems, the false negative rate and false positive rate are the lowest when using this combination for screening high-grade cervical precancerous lesions and cervical cancer. This indicates that the combined detection of this gene combination for cervical cancer screening is more suitable for promotion and application in clinical and research work.

[0101] The research related to this invention was funded by the Hunan Provincial Science and Technology Innovation Program, project number 2024RC9025.

[0102] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.

Claims

1. A reagent composition for detecting cervical cancer and precancerous lesions, characterized in that, The reagent composition includes reagents for detecting the methylation level of a marker gene or a fragment thereof, wherein the marker gene includes... GSX1 Gene, TBX5 Genes and CA10 At least one of the genes.

2. The reagent composition according to claim 1, wherein, The reagent composition includes reagents for detecting the methylation level of at least one of (a1)-(a3): (a1) Gene fragments with nucleotide sequences as shown in SEQ ID NO:1 and / or 17; (a2) Gene fragments with nucleotide sequences as shown in SEQ ID NO:2 and / or 18; (a3) Gene fragments with nucleotide sequences as shown in SEQ ID NO:3 and / or 19; And / or, the reagent composition further includes a reagent for detecting an internal standard; Preferably, the internal standard is selected from at least one of the human housekeeping gene or a fragment thereof; More preferably, the internal standard is ACTB The gene or a fragment thereof, preferably the nucleotide sequence of the internal standard as shown in SEQ ID NO:

4.

3. A reagent composition for detecting the methylation level of a marker gene, characterized in that, The reagent composition comprises at least one of the following combinations (1)-(3): (1) Detection GSX1 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:5-6, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:7; And / or primer pairs with nucleotide sequences as shown in SEQ ID NO:20-21, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:22; (2) Detection TBX5 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:8-9, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:10; And / or primer pairs with nucleotide sequences as shown in SEQ ID NO:23-24, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:25; (3) Detection CA10 Primers and optional probes for gene methylation levels: Primer pairs with nucleotide sequences as shown in SEQ ID NO:11-12, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:13; Alternatively, primer pairs with nucleotide sequences as shown in SEQ ID NO:26-27, and optionally, probes with nucleotide sequences as shown in SEQ ID NO:

28.

4. The reagent composition according to claim 3, wherein, The reagent composition further includes: (4) Detection ACTB Primers and optional probes for the gene: primer pairs with nucleotide sequences as shown in SEQ ID NO:14-15, and optional probes with nucleotide sequences as shown in SEQ ID NO:

16.

5. The reagent composition according to claim 3 or 4, wherein, The probe is modified with a fluorescent reporter group and a fluorescent quencher group.

6. The reagent composition according to any one of claims 1-5, wherein, The reagent composition also includes a negative control and / or a positive control.

7. A reagent kit for detecting cervical cancer and precancerous lesions, characterized in that, The kit comprises the reagent composition according to any one of claims 1-6.

8. The kit according to claim 7, wherein, The kit also includes at least one of the following: enzyme, buffer, magnesium source, and deoxyribonucleoside triphosphate; Preferably, the enzyme comprises a methylation-sensitive restriction endonuclease and / or a DNA polymerase, and more preferably, the methylation-sensitive restriction endonuclease comprises at least one of HpaII, HinP1I, and HhaI; Preferably, the magnesium source comprises a water-soluble inorganic magnesium salt; More preferably, the kit also includes reagents for nucleic acid extraction and / or purification.

9. The use of the reagent composition according to any one of claims 1-6, or the kit according to claim 7 or 8, in screening for drugs to treat cervical cancer and precancerous lesions.

10. Joint detection GSX1 Gene, TBX5 Genes and CA10 Application of reagents for gene methylation levels in the preparation of products for the detection of cervical cancer and precancerous lesions.

Images