Kit and method for detecting bacterial panicle blight of rice based on enzyme-mediated double amplification nucleic acid amplification
By using enzyme-mediated dual amplification nucleic acid amplification technology and designing specific primer-probe combinations, rapid and accurate detection of bacterial panicle blight pathogens in rice has been achieved, solving the problems of low sensitivity and inconvenience in carrying existing technologies. This method is suitable for field monitoring and on-site quarantine.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHANGHAI AGRI TECH EXTENSION SERVICE CENT
- Filing Date
- 2026-03-30
- Publication Date
- 2026-06-05
AI Technical Summary
Existing detection technologies for bacterial panicle blight of rice suffer from low sensitivity, long processing time, and inconvenience in portability, making it difficult to meet the needs of immediate testing. Furthermore, they are susceptible to false positives due to aerosol contamination.
Enzyme-mediated dual amplification nucleic acid amplification technology was employed, and a specific primer-probe combination was designed. Rapid detection was achieved through isothermal nucleic acid amplification and signal amplification reactions, combined with portable devices.
It achieves efficient amplification of target nucleic acid to 109-fold within 10-30 minutes under constant temperature of 42℃, with a sensitivity of up to 0.6 copies/μL. It is suitable for field monitoring and on-site quarantine, with a detection limit of up to 4.6 fg/μL. It is simple to operate and suitable for portable devices.
Smart Images

Figure CN122146903A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to a kit and method for detecting bacterial panicle blight pathogens in rice based on enzyme-mediated double amplification of nucleic acid. Background Technology
[0002] Bacterial panicle blight of rice Burkholderia glumae Burkholderia oryzae is an important seed-borne bacterial pathogen in rice, belonging to the family Burkholderiaceae and the genus Burkholderia. It is a quarantine pest that not only infects rice grains but also causes rice seedling rot, leading to large-scale yield reductions. The disease caused by this bacterial panicle blight fungus has a strong ability to spread under suitable conditions, especially during periods of high humidity, high temperature, and continuous rainy weather during the rice heading stage. The pathogen can rapidly spread and reinfect through diseased grains, plant debris, and aerosols. Therefore, developing quarantine detection technologies for this bacterial panicle blight fungus is crucial.
[0003] Conventional methods for detecting plant diseases include morphological and cultural identification, which involve symptom observation, pathogen isolation and culture, and identification based on morphological characteristics (such as colony morphology and spore structure). However, these methods are experience-dependent, time-consuming, and have limited detection capabilities for difficult-to-culture or unculturable pathogens, resulting in low sensitivity. Currently, high-sensitivity pathogen detection technologies are represented by polymerase chain reaction (PCR) and its derivatives. This technology has matured significantly over many years and is widely used in various scenarios. Conventional PCR uses agarose gel electrophoresis for endpoint detection, while real-time quantitative PCR (qPCR) can monitor the amplification process in real time, enabling quantitative analysis of pathogens. However, this technology requires expensive and inconvenient instruments, and the detection time typically exceeds 40 minutes. These drawbacks significantly limit its application in point-of-care testing.
[0004] To address the aforementioned technical challenges, researchers have conducted extensive studies. For example, Chinese patent document CN113151522A discloses a detection kit for rice bacterial leaf streak pathogens based on LFD-RPA technology, along with its primer-probe composition and applications. This invention, based on the gene sequence of rice bacterial leaf streak pathogens, designs specific amplification primers XOC3673F and XOC3673R, and a probe, establishing a recombinase polymerase isothermal amplification (LFDRPA) detection method for rice bacterial leaf streak pathogens based on flow chromatography test strips. This method is simple, rapid, sensitive, and specific. Chinese patent document CN118497383A discloses a rapid RPA-LFD detection method for rice bacterial blight pathogens, including a kit containing specific primer pairs and a probe combination. Using this kit, RPA reaction and LFD detection can be completed within 50 minutes in the field. Although the LFD-RPA method described above has a fast detection speed and can achieve in-situ detection, it may cause false positives due to aerosol contamination.
[0005] In conclusion, in order to fundamentally eliminate the pathogen of bacterial panicle blight in rice, it is necessary to develop a rapid on-site molecular detection technology to achieve simple and accurate on-site detection of bacterial panicle blight in rice. Summary of the Invention
[0006] In order to fundamentally cut off the pathogen of bacterial panicle blight of rice and achieve rapid and accurate detection of bacterial panicle blight of rice, this invention provides a kit for detecting bacterial panicle blight of rice based on enzyme-mediated double amplification of nucleic acid.
[0007] The specific technical solution adopted is as follows: A kit for detecting bacterial panicle blight pathogens in rice based on enzyme-mediated double amplification of nucleic acid, comprising a sequence combination of RNA primer probe, DNA upstream primer and DNA downstream primer; The nucleotide sequences of the RNA primer probes are as follows: UGGUGGAGGCAGACGGGAUCGAACCGAC; The upstream primer for DNA is: 5'-AAGCTAATACGACTCACTATAGGGCACCTGGGTAGTCTCTGTAGGGAAGGGG-3'; The downstream primer for DNA is: 5'-GTATCCCTGAACGTTTGTCATTGAAGAT-3'.
[0008] This invention targets the conserved ITS sequence region in the genome of rice bacterial panicle blight (the sequence of the target gene is shown in SEQ ID No. 37). Based on enzyme-mediated dual amplification nucleic acid rapid detection technology, RNA primer probes, DNA upstream primers, and DNA downstream primers were designed. The sample to be tested was subjected to isothermal nucleic acid amplification and isothermal signal amplification reaction, and finally the determination was made by detecting the fluorescence signal value.
[0009] Optionally, the RNA primer probe is labeled with a quenching group at its 5' end and a reporter group at its 3' end. The RNA primer probe modified with the reporter and quenching groups is used to display a fluorescent signal generated during the amplification process of the target gene, and the fluorescent signal is proportional to the total amount of DNA bound to the probe.
[0010] Further preferably, the quenching group includes, but is not limited to, DABCYL, TAMRA, MGB, BHQ0, BHQ1, BHQ2, or BHQ3, and the reporter group includes, but is not limited to, FAM, FITC, TET, HEX, JOE, rhodamine-based dye groups, ROX, Alexa Fluor dye groups, or ATTO dye groups. Most preferably, the 5' end of the RNA primer probe is labeled with the quenching group BHQ1, and the 3' end is labeled with the reporter group FAM.
[0011] Furthermore, the kit also contains a plasmid standard of the ITS gene fragment of rice bacterial panicle blight (sequence shown in SEQ ID No. 37).
[0012] Preferably, the kit further comprises a nucleic acid amplification enzyme system and a signal amplification enzyme system, integrated into a single reaction tube. The nucleic acid amplification enzyme system contains four enzymes (recombinase, single-stranded binding protein, polymerase, and ATP energy regenerating enzyme), while the signal amplification enzyme system contains two enzymes (transcriptase and cleavage enzyme).
[0013] Specifically, recombinases are used to open the DNA double strand; Single-strand binding proteins are used to stabilize the opened DNA double strand and promote the binding of primers, polymerases and target sequences; Polymerase is used in conjunction with primers to replicate and extend target sequences; ATP energy regeneration enzymes are used to provide the energy required for the reaction; Localizing enzymes are used to recognize hybrid strands of RNA and DNA and guide cleaving enzymes to the vicinity of the hybrid strand; The cleavage enzyme is used to cleave RNA in the DNA-RNA hybrid strand, separating the quenching group and the fluorescent group, thereby releasing a fluorescent signal.
[0014] Preferably, the kit further includes a high-efficiency lysis buffer for DNA extraction from samples of rice bacterial panicle blight pathogens, the high-efficiency lysis buffer comprising buffer, NaCl, EDTA, SDS, PVP-40, and proteinase K.
[0015] Preferably, the kit contains a nucleic acid amplification detection reagent, which is composed of the RNA primer probe, DNA upstream primer, DNA downstream primer, nucleic acid amplification enzyme system, signal amplification enzyme system, NTP (nucleoside triphosphate), buffer, RNase-free water, and lyophilization protectant; the nucleic acid amplification detection reagent is lyophilized into pre-aliquoted lyophilized microspheres.
[0016] The present invention also provides the application of the kit in the detection of bacterial panicle blight pathogens in rice.
[0017] This invention also provides a method for detecting bacterial panicle blight pathogens in rice based on enzyme-mediated double amplification of nucleic acid, comprising the following steps: S1. Collect the sample, add high-efficiency lysis buffer, and obtain sample DNA; S2. Using the sample DNA obtained in S1 as a template, add the pre-packaged lyophilized microspheres to carry out an isothermal amplification reaction; S3. The fluorescence signal Tt value of S2 reaction is used as the detection result of bacterial panicle blight of rice. If there is no Tt value in the cycle, it means that the sample is not infected with bacterial panicle blight of rice and the detection result is negative. If there is a Tt value, it means that the sample is infected with bacterial panicle blight of rice and the detection result is positive.
[0018] Furthermore, in S1, the pyrolysis conditions were 95°C for 10 minutes.
[0019] After efficiently lysing the sample to be tested for 10 minutes to obtain sample DNA, pre-packaged freeze-dried pellets are prepared by combining nucleic acid amplification enzyme system, signal amplification enzyme system, RNA primers, DNA upstream primers, and DNA downstream primers. Simply add the sample DNA and react it in a handheld metal bath and handheld fluorescence detector for 10-30 minutes to complete the detection of bacterial panicle blight pathogens in rice.
[0020] Compared with the prior art, the present invention has the following beneficial effects: (1) The enzyme-mediated double amplification nucleic acid amplification technology for detecting bacterial panicle blight of rice in this invention, by integrating the enzyme system of nucleic acid amplification group, can amplify the target nucleic acid to 10 within 10-30 minutes under constant temperature of 42℃. 9 By integrating the signal amplification enzyme system, it is possible to generate more than 10,000 fluorescence signals from a single nucleic acid amplification product under isothermal conditions of 42℃. This ultimately achieves efficient and rapid sample detection.
[0021] (2) The method of the present invention can perform on-site molecular detection of rice bacterial panicle blight, with high specificity and sensitivity as low as 0.6 copies / μL, and the sample detection limit can reach 4.6 fg / μL, which can detect samples infected with rice bacterial panicle blight at an early stage.
[0022] (3) The kit of the present invention can be used in conjunction with a portable handheld metal bath and a handheld fluorescence detector, and can be carried to any location such as rural sites to carry out testing, meeting various application scenarios such as field monitoring, on-site quarantine, and port import and export testing.
[0023] (4) The method for detecting rice bacterial panicle blight based on enzyme-mediated double amplification of nucleic acid provided by the present invention has a simple operation process, no usage threshold, and has a wide application prospect. Attached Figure Description
[0024] Figure 1 This is the RNA primer screening result of Example 1 of the present invention.
[0025] Figure 2 This is the result of the initial DNA upstream primer screening in Example 2 of the present invention.
[0026] Figure 3 This is the result of the initial round of DNA downstream primer screening in Example 3 of the present invention.
[0027] Figure 4 The results are from the initial primer combination sensitivity experiment of Example 4 of this invention.
[0028] Figure 5 This is the result of the second round of DNA upstream primer screening in Example 5 of the present invention.
[0029] Figure 6 This is the result of the second round of DNA downstream primer screening in Example 6 of the present invention.
[0030] Figure 7 This is a specific experimental result of Example 7 of the present invention.
[0031] Figure 8 The results are from the sensitivity experiment of Example 8 of the present invention.
[0032] Figure 9 This is the detection result of Example 9 of the present invention.
[0033] Figure 10 This is the detection result of Example 10 of the present invention. Detailed Implementation
[0034] To make the objectives, features, and advantages of this invention more apparent and understandable, a detailed description is provided below through specific embodiments. Many specific details are set forth in the following description to provide a full understanding of the invention. However, the invention can be practiced in many ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below. Technical features in various embodiments of the invention can be combined appropriately without conflict.
[0035] Unless otherwise specified, the operating methods in the following examples are generally performed under conventional conditions or as recommended by the manufacturer. Contents not described in detail in this specification are prior art known to those skilled in the art. Unless otherwise specified, the experimental materials used in the examples below can be purchased from conventional biochemical reagent companies.
[0036] The following experiments used rice bacterial panicle blight fungus (… Burkholderia glumae Os48 was collected and preserved in the laboratory, and continuous detection using real-time PCR showed positive results.
[0037] Example 1 Bacterial genomic DNA extraction kit (TIANGEN, DP302) was used to extract bacterial panicle blight pathogens from rice. Burkholderia glumaeFor total DNA from Os48, take 1-5 mL of bacterial culture medium, centrifuge at 10,000 rpm (~11,500×g) for 1 min, and aspirate the supernatant as thoroughly as possible. Add 200 μL of buffer GA to the bacterial pellet and vortex until the bacterial cells are completely suspended. Add 220 μL of buffer GB and 20 μL of proteinase K and mix thoroughly by inverting. Incubate at 70°C for 10 min until the solution becomes clear. Briefly centrifuge to remove water droplets from the inner wall of the tube cap. Add 220 μL of anhydrous ethanol and vortex thoroughly for 15 sec. Flocculent precipitate may appear at this point. Briefly centrifuge to remove water droplets from the inner wall of the tube cap. Add the solution and flocculent precipitate from the previous step to an adsorption column CB3. Centrifuge at 12,000 rpm (~13,400×g) for 30 sec. Discard the waste liquid in the collection tube and place the adsorption column CB3 into the collection tube. Add 500 μL of buffer GD to the adsorption column CB3 and centrifuge at 12,000 rpm (~13,400×g) for 30 sec. Discard the waste liquid in the collection tube and place the adsorption column CB3 into the collection tube. Add 600 μL of buffer GD to the adsorption column CB3. Centrifuge with μL of PW wash buffer at 12,000 rpm (~13,400×g) for 30 sec, discard the waste liquid in the collection tube, and place the adsorption column CB3 into the collection tube; centrifuge at 12,000 rpm (~13,400×g) for 2 min, discard the waste liquid, and let the adsorption column CB3 air dry at room temperature for 2 min to completely dry the residual wash liquid in the adsorption material; transfer the adsorption column CB3 into a 1.5 mL centrifuge tube, add 50-200 μL of elution buffer TE dropwise to the middle of the adsorption membrane, let it air dry at room temperature for 2 min, centrifuge at 12,000 rpm (~13,400×g) for 2 min, collect the solution into the centrifuge tube, verify the extracted DNA by agarose gel electrophoresis imaging and detect the concentration by a micro spectrophotometer, and then store it in a -20℃ freezer.
[0038] Reaction system: Add 1 μL of 10 μM upstream DNA primer, 1 μL of 10 μM downstream DNA primer, 1 μL of 1 μM RNA primer / probe, and 7 μL of extracted DNA to an eight-tube containing basic dry powder (recombinase, single-stranded binding protein, polymerase, ATP energy regenerating enzyme, localizing enzyme, and cutting enzyme). Briefly centrifuge and incubate at room temperature for 2 min. Add 10 μL of an activation solution (NTP, nucleoside triphosphate) and buffer solution along the tube wall and briefly centrifuge again. Vortex to mix for 10 s, then briefly centrifuge again before detection. Detection procedure: A real-time PCR instrument (ABI 7500) was used. The reaction temperature was 42℃, each cycle was 1 min, and signal acquisition was performed once per cycle for a total of 30 cycles. The reaction time was 30 min. The reporter group was set to FAM.
[0039] Using DNA validated by previous PCR as a template, and RNase-free water (Takara, 9012) as a blank control, RNA primers were screened (primers for screening are shown in Table 1). Primers F1 and F6 were cross-combined with primers R1 and R6, resulting in F1R1, F1R6, F6R1, and F6R6, respectively. RNA primers RNA1, RNA2, RNA3, RNA4, RNA5, and RNA6 were added to each primer group. Corresponding primer groups were compared, and the RNA primer with the lowest Tt value and highest endpoint fluorescence value was selected. Simultaneously, based on the RNA primers, the screening results for the corresponding four DNA primer groups were determined, selecting the RNA primer with the lowest Tt value and highest endpoint fluorescence value, and the primer group with no amplification signal in the negative control. The results showed that 24 combinations were obtained by combining four primer groups (F1R1, F1R6, F6R1, and F6R6) with six RNA primers (RNA1, RNA2, RNA3, RNA4, RNA5, and RNA6). Among them, the RNA6 combination had the lowest Tt value (3.05) and relatively high fluorescence value. The negative control showed no amplification signal, so the RNA6 primer was selected for subsequent experiments. Figure 1 ).
[0040] Table 1 Primer selection table (SEQ ID No. 1 - SEQ ID No. 34)
[0041] Example 2 Rice bacterial panicle blight Burkholderia glumae Using Os48 DNA as a template, the sample loading system of Example 1 was followed. RNA primer 6 (RNA primer) and upstream primer F6 were fixed. Downstream primers R1, R2, R3, R4, R5, and R6 (Table 1) were selected for screening. The RNA primer with the lowest Tt value and the highest endpoint fluorescence value, along with the primer group showing no amplification signal in the negative control, were chosen. The results showed that among the DNA downstream primers, the R1 group had a low Tt value of 4.74 and a relatively high fluorescence value, indicating that downstream primer R1 performed well. Since the negative control showed no amplification signal, primer R1 was selected, and the RNA6R1 combination was used for subsequent experiments. Figure 2 ).
[0042] Example 3 Rice bacterial panicle blight Burkholderia glumaeUsing Os48 DNA as a template, the sample loading system of Example 1 was followed, with RNA6 primer and downstream primer R1 fixed. Upstream primers F1, F2, F3, F4, F5, and F6 (Table 1) were selected for screening. The primers with the lowest Tt value and the highest endpoint fluorescence value, along with the primer group showing no amplification signal in the negative control, were chosen. The results showed that among the DNA upstream primers, group F6 had a low Tt value of 4.67 and a high fluorescence value, indicating that upstream primer F6 was effective. Since the negative control showed no amplification signal, primer F6 was selected, and the RNA6F6R1 combination was chosen for the experiment. Figure 3 ).
[0043] Example 4 According to the sampling system of Example 1, bacterial panicle blight pathogens of rice were used. Burkholderia glumae Os48 DNA, diluted 10-fold to a concentration of 46 pg / μL, was serially diluted 10-fold with RNase-free water to obtain four concentration gradients: 46 pg / μL, 4.6 pg / μL, 460 fg / μL, and 46 fg / μL. Each gradient was tested in triplicate. The primer set RNA6F6R1 selected in Example 3 was used for sensitivity testing. The results showed that, based on the experimental results, the lowest detectable concentration of the screened primer probe was 460 fg / μL, and the sensitivity needs further improvement. Figure 4 ).
[0044] Example 5 To further improve detection sensitivity, using bacterial panicle blight pathogens of rice... Burkholderia glumae Using Os48 DNA as a template, and following the sample loading system of Example 1, primers RNA6 and R1 were fixed. Forward primers F6, F7, F8, F9, F10, F11, F12, F13, F14, F15, and F16 were selected for screening (primers for screening are shown in Table 1). The DNA primers with the lowest Tt values and the highest endpoint fluorescence values, along with the negative control primers showing no amplification signal, were chosen. The results showed that among the DNA forward primers, groups F8, F9, and F16 exhibited the best amplification efficiency, with relatively low Tt values of 7.57, 7.42, and 7.52 respectively, and high fluorescence values. However, the optimal forward primer could not be confirmed at this time. Therefore, F6-RNA6 was selected for further screening of downstream primers. Figure 5 ).
[0045] Example 6 Rice bacterial panicle blight Burkholderia glumaeUsing Os48 DNA as a template, the sample loading system of Example 1 was followed. RNA primer 6 and upstream primer F6 were fixed. Downstream primers R7, R8, R9, R10, R11, and R12 were selected for screening. The downstream primers with the lowest Tt value and the highest endpoint fluorescence value, along with the primer group showing no amplification signal in the negative control, were chosen. Results showed that among the downstream primers, the R7 group had a lower Tt value of 7.41 and a relatively higher fluorescence value, indicating that downstream primer R7 performed well. Furthermore, the negative control showed no amplification signal, thus primer R7 was selected. Figure 6 The primers were then combined with F8, F9, and F16, and compared with the initial optimal RNA6F6R1 combination to determine the final primer combination. Results showed that RNA6F8R7 had the lowest Tt value (6.35) and the highest fluorescence value, and was therefore confirmed as the optimal combination for subsequent experiments. Figure 6 ).
[0046] Example 7 Three strains of bacterial panicle blight pathogens of rice were analyzed using a bacterial genomic DNA extraction kit (TIANGEN, DP302). Burkholderia glumae Os48, Os14, and Os25, one closely related species ( Burkholderia gladioli Os6, the bacterial leaf streak pathogen of rice ( Xanthomonas oryzae pv.oryzicoli Rs105, BLS256, FZ05, 4821-3, 4821-4, and 4821-5, four strains of rice bacterial blight pathogen ( Xanthomonas oryzae pv.oryzae PXO99, ScYc-b, HNB1-25, and SJ2023, two bacterial strains of rice scynaceae (PXO99, ScYc-b, HNB1-25, and SJ2023) Acidovorax oryzae RS1 and RS2, two strains of rice bacterial basal rot fungus ( Dickeya oryzae DNA was extracted from ZJU1906 and DZ7 as templates, and the sample loading system was followed as in Example 1. RNase-free water was used as a negative control. The optimal primer set RNA6F8R7 obtained from screening was used for specific detection according to the reaction system, time, and temperature in Example 1. The results showed that among 18 plant pathogenic bacteria selected for specificity experiments, 3 strains of rice bacterial panicle blight were detected, while the remaining 15 strains were not detected. This indicates that the primer and probe combination screened in this study has high specificity (Table 2). Figure 7 ).
[0047] Table 2 Information on the tested strains in this embodiment
[0048] Example 8 Reaction system: Pre-aliquoted lyophilized beads were prepared from a system consisting of basic dry powder (recombinase, single-stranded binding protein, polymerase, ATP energy regenerating enzyme, signal amplification enzyme system), DNA upstream primer (F8), DNA upstream primer (R7), RNA primer (RNA6), activation solution NTP (nucleoside triphosphate), buffer, RNase-free water, and lyophilization protectant. 50 μL of template DNA was added to each lyophilized bead, the bead was capped, and the mixture was vortexed for 10 seconds. After centrifugation for 10 seconds, the sample was analyzed. A real-time PCR instrument was used at 42℃, with signal acquisition performed once per cycle for a total of 30 cycles. The reaction time was 30 minutes, and the reporter group was set to FAM.
[0049] Bacterial panicle blight of rice Burkholderia glumae Os48 DNA, diluted 100-fold to a concentration of 4.6 pg / μL, was serially diluted 10-fold with RNase-free water to achieve five concentration gradients: 4.6 pg / μL, 460 fg / μL, 46 fg / μL, and 4.6 fg / μL. Each gradient was tested in triplicate. The optimal primer set RNA6F8R7 was used for sensitivity testing. Results showed that the selected primer probe could detect concentrations as low as 4.6 fg / μL, exhibiting high sensitivity, and the serially diluted DNA performed well on the RNase. Figure 8 ).
[0050] Example 9 Place an appropriate amount of leaf samples (approximately 2 cm in length and width) or seed samples (around 20 seeds) into a resealable bag and label it. Pour an appropriate amount of sample soaking solution into the resealable bag until the sample is completely submerged. Gently rub the resealable bag to thoroughly mix the sample and soaking solution until the soaking solution foams and the sample is slightly damaged. Take out the corresponding number of lysis buffer tubes, shake them downwards three times to collect the liquid at the bottom of the tube, and label them. Draw 50 μL of supernatant from the resealable bag and add it to the lysis buffer tubes. Tightly cap the lysis buffer tubes and mix them vigorously up and down five times, then shake them downwards three times to collect the liquid at the bottom of the tube. Place the tubes in a metal bath preheated to 95 °C and incubate for 10 minutes. After incubation, remove the tubes and allow them to cool to obtain the nucleic acid solution to be tested.
[0051] Rice leaves and seeds collected in the laboratory were used as test samples. DNA was rapidly extracted from the samples using lysis buffer, targeting the bacterial rice panicle blight pathogen strain. Burkholderia glumaeOs48 DNA was used as a positive control, and RNase-free water as a negative control. The optimal primer set RNA6F8R7 obtained through screening was used, and the sample loading system, time, and temperature in Example 1 were followed to determine the effectiveness of this method in actual samples. Nine samples were randomly selected from the laboratory for testing. DNA was rapidly extracted from the samples using lysis buffer, and the remaining samples were used for PCR detection. The results showed that the method was consistent with the PCR detection results, with an accuracy of 100% (Table 3 and...). Figure 9 ).
[0052] PCR detection method: Upstream primer (BG1F, SEQ ID No. 35): 5'-CCGCGCTGTTCATGAGGGATAA-3'; Downstream primer (BG1R, SEQ ID No. 36): 5'-CGGGCGGAACGACGGTAAGT -3'; The amplification product was 138 bp.
[0053] Reaction conditions: 94℃ for 5 min; 94℃ for 30 sec, 63℃ for 30 sec, 72℃ for 10 sec (35 cycles); 72℃ for 5 min.
[0054] Reaction system: 10×PCR buffer 5 μL, 25 mM MgCl2 3 μL, 25 mM dNTP 1 μL, 20 mg / mL bovine serum albumin (BSA) 2.2 μL, 1% Tween-20 0.6 μL, Primer (20 μM) 1 μL each, 5 U / µL Taq DNA polymerase 0.2 μL, template DNA 2 μL, ddH2O 34 μL, Total 50 μL.
[0055] Table 3. Comparison of results between the method in this embodiment and the PCR detection method.
[0056] Example 10 Rice leaves and seeds collected in the laboratory were used as test samples. DNA was rapidly extracted from the samples using lysis buffer (lysis method as in Example 9). A plasmid containing the ITS gene fragment of the target rice bacterial panicle blight pathogen was used as a standard, and RNase-free water was used as a negative control to determine the effectiveness of this method in detecting actual samples in the field. The sample loading system was followed as in Example 8, and detection was performed using a portable fluorescence detector. Six samples were collected from the laboratory and tested on-site. DNA was rapidly extracted from the samples using lysis buffer, and the remaining samples were used for PCR detection. The results showed that the rapid on-site detection effect was consistent with the PCR detection results, with an accuracy of 100% (Table 4 and...). Figure 10 ).
[0057] Table 4. Comparison of field detection results and PCR detection results using this implementation method.
[0058] The embodiments described above provide a detailed explanation of the technical solutions of the present invention. It should be understood that the above descriptions are merely specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, additions, or similar substitutions made within the scope of the principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A kit for detecting bacterial panicle blight pathogens in rice based on enzyme-mediated double amplification of nucleic acid, characterized in that, This includes sequence combinations consisting of RNA primers / probes, upstream DNA primers, and downstream DNA primers; The nucleotide sequences of the RNA primer probes are as follows: UGGUGGAGGCAGACGGGAUCGAACCGAC; The upstream primer for DNA is: 5'-AAGCTAATACGACTCACTATAGGGCACCTGGGTAGTCTCTGTAGGGAAGGGG-3'; The downstream primer for DNA is: 5'-GTATCCCTGAACGTTTGTCATTGAAGAT-3'.
2. The reagent kit according to claim 1, characterized in that, The RNA primer probe is labeled with a quenching group BHQ1 at its 5' end and a reporter group FAM at its 3' end.
3. The reagent kit according to claim 1, characterized in that, The kit also contains a plasmid standard of the ITS gene fragment of rice bacterial panicle blight pathogen.
4. The reagent kit according to claim 1, characterized in that, The kit also includes a nucleic acid amplification enzyme system and a signal amplification enzyme system. The nucleic acid amplification enzyme system includes recombinase, single-stranded binding protein, polymerase and ATP energy regeneration enzyme, and the signal amplification enzyme system includes transcriptase and cleavage enzyme.
5. The reagent kit according to claim 1, characterized in that, The kit also includes a high-efficiency lysis buffer for DNA extraction from samples of rice bacterial panicle blight pathogens. The high-efficiency lysis buffer includes buffer, NaCl, EDTA, SDS, PVP-40, and proteinase K.
6. The reagent kit according to claim 1, characterized in that, The kit contains a nucleic acid amplification detection reagent, which consists of the aforementioned RNA primer probe, DNA upstream primer, DNA downstream primer, nucleic acid amplification enzyme system, signal amplification enzyme system, nucleoside triphosphate, buffer, RNase-free water, and lyophilization protectant; the nucleic acid amplification detection reagent is lyophilized into pre-aliquoted lyophilized microspheres.
7. The application of the kit according to any one of claims 1-6 in the detection of bacterial panicle blight pathogens in rice.
8. A method for detecting bacterial panicle blight pathogens in rice based on enzyme-mediated double amplification of nucleic acid, characterized in that, Includes the following steps: S1. Collect the sample, add high-efficiency lysis buffer, and obtain sample DNA; S2. Using the sample DNA obtained in S1 as a template, add the pre-dispensed lyophilized microspheres from the kit described in claim 6 to perform an isothermal amplification reaction; S3. The fluorescence signal Tt value of S2 reaction is used as the detection result of bacterial panicle blight of rice. If there is no Tt value in the cycle, it means that the sample is not infected with bacterial panicle blight of rice and the detection result is negative. If there is a Tt value, it means that the sample is infected with bacterial panicle blight of rice and the detection result is positive.