SNP molecular marker related to shade tolerance of brassica and application thereof

Abstract

The present application relates to the technical field of molecular biology and genetic breeding, and particularly relates to a SNP molecular marker related to rapeseed shade tolerance and application thereof. The sequence of the SNP molecular marker is shown as SEQ ID No. 1, and a C / A base mutation exists at 23190453 of SEQ ID No. 1. The SNP molecular marker provided by the present application is based on a competitive allele-specific PCR marker detection method, and is used for detecting and identifying the shade tolerance of rapeseed. The detection method is simple in operation, low in cost, accurate in detection result, good in repeatability and stability, and different detection laboratories and different data results can be compared and verified, and the data has universal comparability.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and genetic breeding technology, and in particular to SNP molecular markers related to shade tolerance in rapeseed and their applications. Background Technology

[0002] Shading refers to a form of abiotic stress caused by the shading of the upper leaves of a crop canopy or by tall crops in intercropping systems, resulting in reduced light intensity and altered light quality in lower or associated crops. The alteration in light quality is primarily manifested as a significant decrease in the ratio of red to far-red light (R:FR), a key environmental factor for plants to perceive proximity competition signals. With the continuous increase in planting density in modern agricultural production and the widespread adoption of intercropping and relay cropping models, shading stress has become one of the important environmental factors limiting crop yield and quality improvement.

[0003] To adapt to shady environments, plants have evolved a series of adaptive responses, collectively known as the Shade Avoidance Syndrome (SAS). Typical manifestations include elongation of the hypocotyl or main stem, elongation of petioles, reduced branching, and earlier flowering. While these responses help plants obtain more light in competition, excessive elongation often leads to an upward shift of the plant's center of gravity, a decrease in stem mechanical strength, a significant increase in the risk of lodging, and ultimately affects crop yield and harvest index.

[0004] Brassica napus Rapeseed is an important oilseed crop in my country, widely cultivated in the Yangtze River basin and the Northeast and Northwest regions. In recent years, direct seeding and dense planting have become an important development direction for rapeseed production in order to increase yield per unit area. However, the shady environment created under dense planting conditions can easily induce rapeseed to exhibit a typical shade avoidance response, manifested as excessive elongation of the hypocotyl, resulting in "leggy seedlings," which increases the risk of lodging during the seedling stage, reduces the overwintering survival rate, and ultimately affects the quality of seedlings and yield formation.

[0005] Studies have shown that rapeseed under shaded conditions not only exhibits significant hypocotyl elongation, but also suffers from decreased lignin content and reduced mechanical strength in its stems, further exacerbating the risk of lodging. Lodging not only leads to reduced oil content and increased incidence of sclerotinia disease in rapeseed, but also severely impacts the efficiency of mechanized harvesting, hindering the simplification and large-scale development of rapeseed production. Furthermore, shade stress can cause premature flowering, reduced pod number, and decreased grain fullness, thereby affecting yield and grain quality. Therefore, elucidating the molecular mechanism of rapeseed's shade avoidance response and cultivating new shade-tolerant, lodging-resistant, and densely planted rapeseed varieties is of great significance for ensuring my country's edible oil supply security.

[0006] In traditional breeding, shade tolerance evaluation relies heavily on field phenotypic identification, which is not only time-consuming and inefficient but also easily affected by environmental factors, failing to meet the urgent needs of modern breeding for precision and efficiency. With the rapid development of genomics technologies, genome-wide association studies (GWAS) and RNA-seq have been widely applied to the genetic analysis of important crop traits. By resequencing and phenotypic evaluation of large-scale germplasm resources, key genes and superior haplotypes related to shade tolerance can be systematically identified, leading to the development of corresponding molecular markers and enabling rapid screening and efficient aggregation of shade-tolerant germplasm. Therefore, in-depth exploration of key genes regulating the shade avoidance response in rapeseed, systematic analysis of their molecular regulatory networks, and the development of molecular markers for breeding have significant theoretical value and broad application prospects for improving rapeseed shade tolerance and achieving increased yield through dense planting. Summary of the Invention

[0007] In view of this, the present invention provides SNP molecular markers related to shade tolerance in rapeseed and their applications.

[0008] The specific technical solution is as follows: In a first aspect, the present invention provides an SNP molecular marker related to shade tolerance in rapeseed, wherein the SNP molecular marker is located at position 23190453 on chromosome A07 of rapeseed; the SNP base difference is C or A.

[0009] Furthermore, the sequence of the SNP molecular marker is shown in SEQ ID No. 1.

[0010] Secondly, the present invention provides a primer set for the above-mentioned molecular markers, the primer set comprising: The detection of the C / A site at sequence 23190453 shown in SEQ ID No. 1 includes: forward primer F1, forward primer F2, and universal reverse primer R1. The nucleotide sequence of forward primer F1 is 5'-GAAGGTGACCAAGTTCATGCTCGGCCACTATTAGTCAAAGAGTATC-3', the nucleotide sequence of forward primer F2 is 5'-GAAGGTCGGAGTCAACGGATTCGGCCACTATTAGTCAAAGAGTATA-3', and the nucleotide sequence of universal reverse primer R1 is 5'-AAAGCGTTTCTGCACGTATAGATTG-3'.

[0011] Furthermore, tags for distinguishing the base types of their corresponding molecular marker sites are connected to the 5' ends of the forward primers F1 and F2, respectively.

[0012] Furthermore, a connector sequence is connected between the forward primer F1, the forward primer F2 and the tag.

[0013] Furthermore, the linker sequence between the 5' end of the forward primer F1 and the tag is GAAGGTGACCAAGTTCATGCT; Furthermore, the linker sequence between the 5' end of the forward primer F2 and the tag is GAAGGTCGGAGTCAACGGATT.

[0014] Furthermore, the tag used to distinguish the base type of the corresponding molecular marker site is a fluorescent reporter group.

[0015] Preferably, the fluorescent reporter group is selected from FAM and HEX.

[0016] Thirdly, the present invention provides a detection kit comprising the aforementioned primer set.

[0017] Fourthly, the present invention also provides the application of a molecular marker, a primer set for detecting the molecular marker, or a detection kit in any of the following: (1) Identifying shade-tolerant rapeseed varieties; (2) Cultivate improved rapeseed germplasm resources with shade tolerance.

[0018] Fifthly, the present invention also provides a method for identifying whether rapeseed is shade-tolerant, comprising the following steps: Using the genomic DNA of the rapeseed sample to be tested as a template, the template is amplified by real-time quantitative PCR using the primer set or the detection kit, the fluorescence signal is read and analyzed, the genotype of the molecular marker is identified, and the genotype is used to determine whether the rapeseed is shade-tolerant. If the genotype at molecular marker site 23190453 is AA, then the rapeseed is shade-tolerant. If the genotype at molecular marker site 23190453 is CC, then rapeseed is not shade-tolerant; The molecular marker site 23190453 is located at 23190453bp on chromosome A07 of the rapeseed genome, and the full genome sequence version of the rapeseed genome is Brassica_napus_Darmor_v4.1.

[0019] Furthermore, the real-time PCR reaction system for labeling the 23190453bp site in this invention is as follows: 0.4 μL of 2×KASP Master Mix; 0.0054 μL of KASP mixed primers, where F1:F2:R1=2:2:5 (V / V / V); 0.8 μL of rapeseed sample DNA template at 10-20 ng / μL, dried; add sterile water to a total volume of 0.8 μL.

[0020] Furthermore, the fluorescence quantitative PCR reaction conditions for labeling the 23190453bp site in this invention are as follows: 94℃ for 15 minutes; 94℃ for 20 seconds, 65℃-56℃ (annealing temperature decreases by 0.8℃ per cycle) for 60 seconds, 10 cycles; 94℃ for 20 seconds, 57℃ for 60 seconds, 30 cycles.

[0021] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention provides a molecular marker combination for identifying shade tolerance in rapeseed, which can accurately detect and identify shade tolerance in rapeseed and has wide applicability.

[0022] 2. This invention provides a detection method based on KASP markers, which can be used to detect the shade tolerance trait of rapeseed. The KASP marker detection method is simple, fast, and low in cost, and is suitable for different detection instruments and equipment.

[0023] 3. The detection method provided by this invention has high specificity, sensitivity and resolution; the labeling is not affected by environmental conditions, and seeds or any type of plant tissue can be used. The detection results are accurate, repeatable and stable; different testing laboratories and different data results can be compared and verified with each other, and the data has universal comparability. Attached Figure Description

[0024] Figure 1 Genotyping diagram for shade-tolerant rapeseed using molecular markers. Red clusters represent the CC genotype, and blue clusters represent the AA genotype.

[0025] Figure 2 The results show the detection of the molecular markers of this invention in 52 diverse materials; among which, Figure 2 In this paper, A represents the relationship between the molecular marker genotype and the relative hypocotyl in this invention. Figure 2 B in the figure represents the statistical analysis result. Detailed Implementation

[0026] To enable those skilled in the art to better understand the present invention, the technical solution of the present invention will be clearly and completely described below with reference to specific embodiments. It should be noted that the following detailed descriptions are exemplary and are only some embodiments of the present invention, not all embodiments.

[0027] Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.

[0028] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. The experimental materials used in the embodiments of this invention are all conventional experimental materials in the art and are commercially available. Experimental methods not specifying detailed conditions are performed according to conventional experimental methods or the operating instructions recommended by the supplier.

[0029] The rapeseed material used in this invention was obtained by the rapeseed team at Zhejiang University.

[0030] Example 1 In this case, through a survey and analysis of 229 rapeseed shade tolerance accessions and a genome-wide association study, 16 SNP molecular markers related to rapeseed shade tolerance were screened.

[0031] The following indicators were used to compare the genotyping results of each SNP locus: Indicator 1: Assess the risk of marker development based on flanking sequences; Indicator 2: Polymorphism of the corresponding loci in the 52 submitted germplasm samples; Indicator 3: KASP tagging's clustering ability.

[0032] Table 1 Molecular marker sites type Variant sites chromosome Indicator 1 Indicator 2 Indicator 3 23227677 SNP [C / T] A02 High risk of failure N / A Not significant 23190453 (S1 of this invention) SNP [C / A] A07 Developable high Significant 23200339 SNP [G / A] A07 High risk of failure N / A Not significant 14360546 SNP [T / A] C03 Developable Low Not significant 14361571 SNP [A / T] C03 Developable Low Not significant 14361625 SNP [G / A] C03 High risk of failure N / A Not significant 14361724 SNP [A / C] C03 High risk of failure N / A Not significant 14361745 SNP [T / C] C03 High risk of failure N / A Not significant 14363574 SNP [A / G] C03 High risk of failure N / A Not significant 14363600 SNP [T / C] C03 Developable none Not significant 14363715 SNP [G / A] C03 Developable none Not significant 14363721 SNP [T / C] C03 High risk of failure N / A Not significant 14363730 SNP [G / C] C03 High risk of failure N / A Not significant 14430586 SNP [G / A] C03 High risk of failure N / A Not significant 14430792 SNP [C / T] C03 High risk of failure N / A Not significant 14430836 SNP [C / A] C03 High risk of failure N / A Not significant The results showed that the SNP site (S1) at position 23190453 on chromosome A07 of the Brassica_napus_Darmor_v4.1 genome was significantly associated with shade tolerance. This SNP site is a C / A difference. The nucleotide sequence of this SNP is shown in SEQ ID No.1. The 201st position of this sequence is the SNP site, and there is C / A diversity.

[0033] SEQ ID No. 1: TTATATCTTTCATAAAAAAAATTATGTACCAAAACCAATTACATGTGTCTTCACATGTCTTTACATTTTGTTTTTCTAATTTTCTTACTCAAATAAAATACTCAATTGTGTGCATGCAACATATCAATTAACGTAAAATAATTATATTGATAAATTAGTACATATTTCCTATATAACCGGCCACTATTAGTCAAAGAGTATM TAGCTATTCATACAGTTAATACATGCATGAATTACTTGAATATTAACAATATTAATAACAATCTATACGTGCAGAAACGCTTTTGCTTTTCTACCCAACAAATTTCAATTGGTTGCTTAAAAATATTTGATCGTATGCAACTATGCATGTATTTAGACTAAACCTTGTAATTGATGGTGAACTCAAAGTTGGCTTTGTAT.

[0034] Example 2 2.1 KASP Tag Design and Synthesis Based on the obtained SNP site information, referring to chromosome 23190453 of the Brassica napus Darmor v4.1 genome, a C / A nucleotide polymorphism was found. Flanking sequences of 150 bp before and after this site were extracted. Primers were designed using the online primer design website BatchPrimer3 (http: / / probes.pw.usda.gov / batchprimer3 / ). This KASP marker consists of three primers: two specific forward primers as shown in SEQ ID No. 2 and SEQ ID No. 3, and one universal reverse primer as shown in SEQ ID No. 4. The primer sequences are as follows: SEQ ID No.2: GAAGGTGACCAAGTTCATGCTCGGCCACTATTAGTCAAAGAGTATC; SEQ ID No.3: GAAGGTCGGAGTCAACGGATTCGGCCACTATTAGTCAAAGAGTATA; SEQ ID No. 4: AAAGCGTTTCTGCACGTATAGATTG.

[0035] The two forward primers, SEQ ID No. 2 and SEQ ID No. 3, have universal tag sequences at their 5' ends, as shown in SEQ ID No. 5 and SEQ ID No. 6, respectively. These tag sequences can bind to the FAM or HEX fluorescent groups in the KASP Master Mix to generate a signal.

[0036] SEQ ID No.5: GAAGGTGACCAAGTTCATGCT; SEQ ID No. 6: GAAGGTCGGAGTCAACGGATT.

[0037] 2.2 Detection and Validation of Molecular Markers Molecular markers were validated and detected using Douglas Scientific's ArrayTape system. The ArrayTape genotyping platform includes NEXAR for PCR amplification system assembly, SOELLEX for PCR amplification, ARAYA for fluorescence signal scanning, and INTELLICS for data analysis.

[0038] PCR amplification system: The PCR amplification system was automatically assembled using NEXAR, and the PCR amplification system is shown in Table 2 below.

[0039] Table 2. PCR amplification system for KASP marker genotyping Components Final concentration Actual usage 100 μM Primer C 0.375μM 0.0030 μL 100 μM Primer X 0.15μM 0.0012 μL 100 μM Primer Y 0.15μM 0.0012 μL 2× KASP Master Mix 1× 0.4 μL Ultrapure water / 0.3946 μL DNA (DNA is added to a tape membrane and then dried) / 10 ng-20 ng Total volume / 0.8 μL PCR amplification: PCR amplification was performed using SOELLEX under the following conditions: 94℃ for 15 minutes; 95℃ for 20 seconds, 65℃-56℃ (annealing temperature decreased by 0.8℃ per cycle) for 60 seconds, 10 cycles; 94℃ for 20 seconds, 57℃ for 60 seconds, 30 cycles.

[0040] Signal scanning and genotyping: After the PCR reaction, the fluorescence signal of the reaction system was scanned using ARAYA, and then genotyping and data analysis were performed using INTELLICS. In the KASP marker genotyping detection, the genotypes of the samples were divided into three clusters: the FAM cluster, the VIC cluster, and the heterozygous genotype cluster (see...). Figure 1 The FAM cluster indicates that the sample contains the homozygous CC allele at this KASP marker site (marked in red in the upper left corner of the genotyping graph), and the VIC cluster indicates that the sample contains the homozygous AA allele at this KASP marker site (marked in blue in the lower right corner of the genotyping graph).

[0041] The molecular marker combinations were validated using 52 materials. The validation showed that homozygous and heterozygous clusters were well-typed and compact, with single-copy loci and a detection rate exceeding 98%. The detection results of the molecular marker combinations are as follows: Figure 2 As shown in Table 3, the test results of 52 samples with different genotypes are shown in Table 4, and the corresponding germplasm names and phenotypic information are shown in Table 4.

[0042] Table 3. Detection results of molecular markers on 52 samples Sample Name Genotyping results Phenotype JD0002 C:C Not shade-tolerant JD0005 C:C Not shade-tolerant JD0006 C:C Not shade-tolerant JD0007 C:C Not shade-tolerant JD0008 C:C Not shade-tolerant JD0009 C:C Not shade-tolerant JD0011 C:C Not shade-tolerant JD0016 C:C Not shade-tolerant JD0017 C:C Not shade-tolerant JD0019 C:C Not shade-tolerant JD0020 C:C Not shade-tolerant JD0021 C:C Not shade-tolerant JD0022 C:C Not shade-tolerant JD0023 C:C Not shade-tolerant JD0024 C:C Not shade-tolerant JD0026 C:C Not shade-tolerant JD0027 A:A Shade-tolerant JD0028 C:C Not shade-tolerant JD0031 C:C Not shade-tolerant JD0034 C:C Not shade-tolerant JD0036 C:C Not shade-tolerant JD0037 C:C Not shade-tolerant JD0038 A:A Shade-tolerant JD0039 C:C Not shade-tolerant JD0040 C:C Not shade-tolerant JD0041 C:C Not shade-tolerant JD0042 C:C Not shade-tolerant JD0043 C:C Not shade-tolerant JD0044 C:C Not shade-tolerant JD0046 C:C Not shade-tolerant JD0047 C:C Not shade-tolerant JD0050 C:C Not shade-tolerant JD0051 C:C Not shade-tolerant JD0052 C:C Not shade-tolerant JD0053 C:C Not shade-tolerant JD0054 C:C Not shade-tolerant JD0055 C:C Not shade-tolerant JD0056 C:C Not shade-tolerant JD0057 C:C Not shade-tolerant JD0059 C:C Not shade-tolerant JD0065 A:A Shade-tolerant JD0066 N Shade-tolerant JD0067 C:C Not shade-tolerant JD0068 A:A Shade-tolerant JD0069 A:A Shade-tolerant JD0070 C:C Not shade-tolerant JD0074 C:C Not shade-tolerant JD0075 C:C Not shade-tolerant JD0076 A:A Shade-tolerant JD0077 A:A Shade-tolerant JD0078 A:A Shade-tolerant JD0079 A:A Shade-tolerant Table 4. Germplasm names and phenotypic information of 52 tested samples Sample Name Germplasm name ES / WL JD0002 R4171 1.340162761 JD0005 R4182 1.414376085 JD0006 R4191 1.174335714 JD0007 R4213 1.437015763 JD0008 R4215 1.719163205 JD0009 R4218 1.477877842 JD0011 R4222 1.187141991 JD0016 R4283 1.369497224 JD0017 R4302 1.398358845 JD0019 R4345 1.455187379 JD0020 R4405 1.218381538 JD0021 R4413 1.385942654 JD0022 R4420 1.475106324 JD0023 R4451 1.46617061 JD0024 R4452 1.298232053 JD0026 R4464 1.379678947 JD0027 R4465 0.634740146 JD0028 R4474 1.23129881 JD0031 R4601 1.332806774 JD0034 R4655 1.213942713 JD0036 R4684 1.248212006 JD0037 R4697 1.194188309 JD0038 R4718 0.542293561 JD0039 R4737 1.204352742 JD0040 R4743 1.381763481 JD0041 R4747 1.170632223 JD0042 R4748 1.493095155 JD0043 R4762 1.414217683 JD0044 R4763 1.339532037 JD0046 R4792 1.25331728 JD0047 R4796 1.164942023 JD0050 R4801 1.220139329 JD0051 R4815 1.383571849 JD0052 R4822 1.332457101 JD0053 R4835 1.193515516 JD0054 R4875 1.816580564 JD0055 R4877 1.334771765 JD0056 R4887 1.531755663 JD0057 R4897 1.213131399 JD0059 R4920 1.152452026 JD0065 R5003 0.586246176 JD0066 R5009 0.550096354 JD0067 R5022 1.225588355 JD0068 R5040 0.456030272 JD0069 R5043 0.534743202 JD0070 R5057 1.369190336 JD0074 R5132 1.161488397 JD0075 R5137 1.321210002 JD0076 R5148 0.608901515 JD0077 R5152 0.671929516 JD0078 R5159 0.481606561 JD0079 R5161 0.48170853 The above results indicate that the AA genotype corresponds to a shade-tolerant phenotype in rapeseed, while the CC genotype corresponds to a shade-intolerant phenotype. In 52 validation materials, the concordance rate between marker genotyping and phenotype identification was as high as 98%. The KASP genotyping technology developed using the SNP loci in this invention can rapidly genotype the shade-tolerant trait in rapeseed, with accurate, efficient, and high-throughput detection, and can be used for marker-assisted selection.

Claims

1. SNP molecular markers associated with shade tolerance in rapeseed, characterized in that, The SNP molecular marker is located at position 23190453 on chromosome A07 of rapeseed; the SNP base difference is C or A.

2. The SNP molecular marker related to shade tolerance in rapeseed as described in claim 1, characterized in that, The sequence of the SNP molecular marker is shown in SEQ ID No.

1.

3. A primer set for detecting the molecular marker of claim 1, characterized in that, The primer set includes: The detection of the C / A site at sequence 23190453 shown in SEQ ID No. 1 includes: forward primer F1, forward primer F2, and universal reverse primer R1. The nucleotide sequence of forward primer F1 is 5'-GAAGGTGACCAAGTTCATGCTCGGCCACTATTAGTCAAAGAGTATC-3', the nucleotide sequence of forward primer F2 is 5'-GAAGGTCGGAGTCAACGGATTCGGCCACTATTAGTCAAAGAGTATA-3', and the nucleotide sequence of universal reverse primer R1 is 5'-AAAGCGTTTCTGCACGTATAGATTG-3'.

4. The primer set according to claim 3, characterized in that, The 5' ends of the forward primers F1 and F2 are respectively connected to tags used to distinguish the base types of their corresponding molecular marker sites.

5. The primer set according to claim 4, characterized in that, A connector sequence is connected between the forward primer F1, the forward primer F2 and the tag.

6. The primer set according to claim 5, characterized in that, The linker sequence between the 5' end of the forward primer F1 and the tag is GAAGGTGACCAAGTTCATGCT; The linker sequence between the 5' end of the forward primer F2 and the tag is GAAGGTCGGAGTCAACGGATT.

7. The primer set according to any one of claims 4 to 6, characterized in that, The tag used to distinguish the base type of the corresponding molecular marker site is a fluorescent reporter group; The fluorescent reporter group is selected from FAM and HEX.

8. A test kit, characterized in that, The kit contains the primer set as described in any one of claims 3 to 7.

9. The use of the molecular marker as described in claim 1 or 2, the primer set as described in any one of claims 3 to 7, or the detection kit as described in claim 8 in any of the following: (1) Identifying shade-tolerant rapeseed varieties; (2) Cultivate improved rapeseed germplasm resources with shade tolerance.

10. A method for determining whether rapeseed is shade-tolerant, characterized in that, Includes the following steps: Using the genomic DNA of the rapeseed sample to be tested as a template, the template is amplified by real-time PCR using the primer set of any one of claims 3 to 7 or the detection kit of claim 8. The fluorescence signal is read and analyzed to identify the genotype of the molecular marker. Based on the genotype, it is determined whether the rapeseed is shade-tolerant. If the genotype at molecular marker site 23190453 is AA, then the rapeseed is shade-tolerant. If the genotype at molecular marker site 23190453 is CC, then rapeseed is not shade-tolerant; The molecular marker site 23190453 is located at 23190453bp on chromosome A07 of the rapeseed genome, and the full genome sequence version of the rapeseed genome is Brassica_napus_Darmor_v4.1.

Images