Anti-cd30l antibodies and uses thereof

Abstract

The present disclosure provides anti-CD30L antibodies and methods of making and using the same.

Description

Cross-reference to related applications

[0001] This application claims priority to U.S. Provisional Application No. 63 / 537,933, filed September 12, 2023, which is hereby incorporated by reference in its entirety. sequence list

[0002] By reference, the sequence list submitted at the same time as this paper is included in its entirety and is identified as follows: a 48,423 kilobyte XML document named "10471-WO01-SEC_Sequence_Listing_USPTO_8-26-2024", created on August 26, 2024. Technical Field

[0003] This invention relates to the field of inflammatory disorders. Specifically, this invention relates to anti-CD30L antibodies and the treatment of patients with said antibodies. Background Technology

[0004] Cluster 30 ligand (CD30L, also known as TNFL8, or member 8 of the tumor necrosis factor ligand superfamily) is a member of the tumor necrosis factor (TNF) superfamily, encoded by the TNFSF8 gene. The major isoform of CD30L consists of a 234-amino acid transmembrane protein, with 172 amino acids in its extracellular domain. Consistent with one of the hallmark features of the TNF superfamily, CD30L assembles into a homotrimeric complex and binds to its homologous receptor CD30 (TNFRSF8). Binding of CD30L to CD30 stimulates activation of multiple pathways, including mitogen-activated protein kinase (MAPK) and nuclear factor κB (NF-κB) signaling. Similar to other members of the TNF superfamily, CD30L and CD30 can detach from the cell membrane upon cleavage by proteases such as TNFα convertase (TACE). CD30L-CD30 conjugation has been shown to stimulate increased detachment of both the ligand and receptor. Soluble CD30L (sCD30L) can bind to and stimulate CD30 signal transduction.

[0005] CD30L expression is restricted by the immune system. CD30L expression is tightly regulated and is primarily observed on activated lymphocytes and monocytes. Genetic and pharmacological mouse models have revealed the role of CD30L-CD30 signaling in regulating the differentiation and effector function of helper T cells and B cells. CD30L signaling has been shown to regulate pan-helper T cell effector cytokines, including Th1, Th2, and Th17. CD30L has also been shown to regulate the production of multiple isotype classes of antibodies by B cells. Therefore, CD30L-CD30 signaling broadly regulates both type 1 and type 2 / hypersensitive adaptive immune responses.

[0006] Several pieces of evidence suggest that CD30L-CD30 signaling is associated with a variety of inflammatory disease indications. Rare loss-of-function genetic variants in TNFRSF8 (CD30) are associated with the prevention of severe asthma (Olafsdottir et al., Nature Communications, 2020). Elevated levels of sCD30 and sCD30L in plasma or serum have been reported in several disease indications, including asthma, inflammatory bowel disease, and multiple sclerosis, indicating higher levels of signaling activity in pathways associated with these diseases. Impaired CD30-CD30L signaling in mice, whether through genetic or pharmacological models, has been shown to improve disease severity in mouse models of inflammatory diseases (see, for example, Kennedy et al., Immunology. June 2006; 118(2):143-52). Anti-CD30L antibodies are known (see, for example, PCT Publication Nos. WO2013 / 163377 and WO 20221 / 77963), however, alternative therapeutic antagonism of CD30-CD30L signaling in human patients could provide broad clinical benefits through, for example, anti-CD30L antibodies with increased affinity and / or potency. Summary of the Invention

[0007] This disclosure partially provides an antibody that binds to CD30L, comprising HCDR1 containing SEQ ID NO: 1, HCDR2 containing SEQ ID NO: 2, HCDR3 containing SEQ ID NO: 3, LCDR1 containing SEQ ID NO: 4, LCDR2 containing SEQ ID NO: 5, and LCDR3 containing SEQ ID NO: 6. In embodiments, the antibody comprises: HCDR1 consisting of SEQ ID NO: 1, HCDR2 consisting of SEQ ID NO: 2, HCDR3 consisting of SEQ ID NO: 3, LCDR1 consisting of SEQ ID NO: 4, LCDR2 consisting of SEQ ID NO: 5, and LCDR3 consisting of SEQ ID NO: 6.

[0008] In any of the embodiments described above, the antibody comprises a heavy chain variable region (HCVR) and a light chain variable region (LCVR). The heavy chain variable region (HCVR) contains SEQ ID NO: 19 or a variant thereof, the variant containing an amino acid sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 19; the light chain variable region (LCVR) contains SEQ ID NO: 20 or a variant thereof, the variant containing an amino acid sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 20. In embodiments, the variant of SEQ ID NO: 19 contains no more than 6, 5, 4, 3, 2, or 1 amino acid substitution, insertion, or deletion associated with SEQ ID NO: 19, and the variant of SEQ ID NO: 20 contains no more than 6, 5, 4, 3, 2, or 1 amino acid substitution, insertion, or deletion associated with SEQ ID NO: 20, wherein the variation occurs in the frame region of HCVR, LCVR, or both HCVR and LCVR. In one embodiment, the antibody comprises HCVR containing SEQ ID NO: 19 and LCVR containing SEQ ID NO: 20. In another embodiment, the antibody comprises HCVR consisting of SEQ ID NO: 19 and LCVR consisting of SEQ ID NO: 20.

[0009] In any of the embodiments described above, the antibody comprises a heavy chain (HC) containing SEQ ID NO: 25 and a light chain (LC) containing SEQ ID NO: 26. In one embodiment, the antibody comprises two HCs and two LCs, wherein each HC contains SEQ ID NO: 25 and each LC contains SEQ ID NO: 26. In another embodiment, the antibody comprises two HCs and two LCs, wherein each HC consists of SEQ ID NO: 25 and each LC consists of SEQ ID NO: 26. In yet another embodiment, the antibody comprises two HCs and two LCs, wherein each HC consists of SEQ ID NO: 25 and each LC consists of SEQ ID NO: 26.

[0010] This disclosure provides an antibody that binds to CD30L, comprising HCDR1 containing SEQ ID NO: 7, HCDR2 containing SEQ ID NO: 8, HCDR3 containing SEQ ID NO: 9, LCDR1 containing SEQ ID NO: 10, LCDR2 containing SEQ ID NO: 11, and LCDR3 containing SEQ ID NO: 12. In any of the embodiments described above, the antibody comprises HCDR1 composed of SEQ ID NO: 7, HCDR2 composed of SEQ ID NO: 8, HCDR3 composed of SEQ ID NO: 9, LCDR1 composed of SEQ ID NO: 10, LCDR2 composed of SEQ ID NO: 11, and LCDR3 composed of SEQ ID NO: 12.

[0011] In any of the embodiments described above, the antibody comprises HCVR and LCVR, wherein the HCVR contains SEQ ID NO: 23 or a variant thereof, the variant containing an amino acid sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 23; and the LCVR contains SEQ ID NO: 24 or a variant thereof, the variant containing an amino acid sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 24. In embodiments, the variant of SEQ ID NO: 23 contains no more than 6, 5, 4, 3, 2, or 1 amino acid substitution, insertion, or deletion associated with SEQ ID NO: 23, and the variant of SEQ ID NO: 24 contains no more than 6, 5, 4, 3, 2, or 1 amino acid substitution, insertion, or deletion associated with SEQ ID NO: 24, wherein the variation occurs in the frame region of HCVR, LCVR, or both HCVR and LCVR. In one embodiment, the antibody comprises HCVR containing SEQ ID NO: 23 and LCVR containing SEQ ID NO: 24. In another embodiment, the antibody comprises HCVR consisting of SEQ ID NO: 23 and LCVR consisting of SEQ ID NO: 24.

[0012] In any of the embodiments described above, the HC contains SEQ ID NO: 29, and the LC contains SEQ ID NO: 30. In an embodiment, the antibody comprises two HCs and two LCs, wherein each HC contains SEQ ID NO: 29, and each LC contains SEQ ID NO: 30. In an embodiment, the antibody comprises two HCs and two LCs, wherein each HC is composed of SEQ ID NO: 29, and each LC is composed of SEQ ID NO: 30. In an embodiment, the antibody comprises two HCs and two LCs, wherein each HC is composed of SEQ ID NO: 29, and each LC is composed of SEQ ID NO: 30.

[0013] This article provides an anti-CD30L antibody comprising an HC containing SEQ ID NO: 29 and an LC containing SEQ ID NO: 30. It also provides an anti-CD30L antibody comprising two HCs and two LCs, each HC containing SEQ ID NO: 29 and each LC containing SEQ ID NO: 30. Further, it provides an anti-CD30L antibody consisting of two HCs and two LCs, each HC consisting of SEQ ID NO: 29 and each LC consisting of SEQ ID NO: 30.

[0014] An anti-CD30L antibody is also provided, comprising an HC containing SEQ ID NO: 33, 36, or 39 and an LC containing SEQ ID NO: 30. In one embodiment, the HC contains SEQ ID NO: 33, and the LC contains SEQ ID NO: 30. In another embodiment, the antibody comprises two HCs and two LCs, wherein each HC contains SEQ ID NO: 33, and each LC contains SEQ ID NO: 30. In yet another embodiment, the HC contains SEQ ID NO: 36, and the LC contains SEQ ID NO: 30. In yet another embodiment, the HC contains SEQ ID NO: 39, and the LC contains SEQ ID NO: 30. In yet another embodiment, the antibody comprises two HCs and two LCs, wherein each HC contains SEQ ID NO: 39, and each LC contains SEQ ID NO: 30.

[0015] This document also provides an anti-CD30L antibody comprising an HC containing SEQ ID NO: 25 and a light chain containing SEQ ID NO: 26. An anti-CD30L antibody comprising two HCs and two LCs is provided, wherein each HC contains SEQ ID NO: 25 and each LC contains SEQ ID NO: 26. Further, an anti-CD30L antibody comprising two HCs and two LCs is provided, wherein each HC is composed of SEQ ID NO: 25 and each LC is composed of SEQ ID NO: 26. An anti-CD30L antibody is also provided comprising an HC containing SEQ ID NO: 31, 34, or 37 and an LC containing SEQ ID NO: 26. In one embodiment, the HC contains SEQ ID NO: 31 and the LC contains SEQ ID NO: 26. In another embodiment, the antibody comprises two HCs and two LCs, wherein each HC contains SEQ ID NO: 31 and each LC contains SEQ ID NO: 26. In yet another embodiment, the HC contains SEQ ID NO: 34 and the LC contains SEQ ID NO: 26. In one embodiment, the antibody comprises two HCs and two LCs, wherein each HC contains SEQ ID NO: 34 and each LC contains SEQ ID NO: 26. In another embodiment, the HCs contain SEQ ID NO: 37 and the LCs contain SEQ ID NO: 26. In another embodiment, the antibody comprises two HCs and two LCs, wherein each HC contains SEQ ID NO: 37 and each LC contains SEQ ID NO: 26.

[0016] In the embodiments, the antibodies described herein (a) bind to human CD30L with a dissociation constant (KD) value of less than 100, 75, or 50 picomoles, as measured by surface plasmon resonance (SPR) or size exclusion assay; (b) bind to cynomolgus CD30L with a KD value of less than 100, 75, or 50 picomoles, as measured by SPR or size exclusion assay; (c) bind to both human CD30L and cynomolgus CD30L with an affinity within a factor of 10; (d) block the binding of human CD30L to human CD30, as determined by cell-based assays; or (e) inhibit CD30L-induced IL-8 secretion, as determined by cell-based assays.

[0017] In the embodiments of the antibodies disclosed herein, the antibodies specifically bind to CD30L. For example, antibodies specifically binding to CD30L are provided, comprising HCDR1 containing SEQ ID NO: 1, HCDR2 containing SEQ ID NO: 2, HCDR3 containing SEQ ID NO: 3, LCDR1 containing SEQ ID NO: 4, LCDR2 containing SEQ ID NO: 5, and LCDR3 containing SEQ ID NO: 6. Antibodies specifically binding to CD30L are also provided, comprising HCDR1 containing SEQ ID NO: 7, HCDR2 containing SEQ ID NO: 8, HCDR3 containing SEQ ID NO: 9, LCDR1 containing SEQ ID NO: 10, LCDR2 containing SEQ ID NO: 11, and LCDR3 containing SEQ ID NO: 12.

[0018] This disclosure provides a method for treating an inflammatory disorder in a patient, the method comprising administering an effective amount of the antibody disclosed herein to the patient. In an embodiment, the inflammatory disorder is asthma. In an embodiment, the inflammatory disorder is severe asthma. In an embodiment, the inflammatory disorder is lupus. In an embodiment, the inflammatory disorder is ulcerative colitis.

[0019] Also provided are isolated polynucleotide molecules containing nucleic acid sequences encoding the heavy chain and / or light chain of any antibody disclosed herein. In one aspect, HCVR, LCVR, HC, LC, LCVR, and HCVR, or LC and HC, are provided encoding an antibody binding to CD30L, wherein the antibody comprises HCDR1 containing SEQ ID NO: 1, HCDR2 containing SEQ ID NO: 2, HCDR3 containing SEQ ID NO: 3, LCDR1 containing SEQ ID NO: 4, LCDR2 containing SEQ ID NO: 5, and LCDR3 containing SEQ ID NO: 6. In an embodiment, the antibody comprises HCVR containing SEQ ID NO: 19 and LCVR containing SEQ ID NO: 20. In an embodiment, the antibody comprises HC containing SEQ ID NO: 25 and LC containing SEQ ID NO: 26.

[0020] In one embodiment, the polynucleotide encodes an HCVR of the antibody, wherein the amino acid sequence of the HCVR contains SEQ ID NO: 19. In another embodiment, the polynucleotide encodes an LCVR of the antibody, wherein the amino acid sequence of the LCVR contains SEQ ID NO: 20. In yet another embodiment, the polynucleotide encodes both an HCVR and an LCVR of the antibody, wherein the amino acid sequence of the HCVR contains SEQ ID NO: 19 and the amino acid sequence of the LCVR contains SEQ ID NO: 20.

[0021] In one embodiment, the polynucleotide encodes the HC of the antibody, wherein the amino acid sequence of the HC contains SEQ ID NO:25. In another embodiment, the polynucleotide encodes the LC of the antibody, wherein the amino acid sequence of the LC contains SEQ ID NO:26. In yet another embodiment, the polynucleotide encodes both the LC and HC of the antibody, wherein the amino acid sequence of the HC contains SEQ ID NO:25, and the amino acid sequence of the LC contains SEQ ID NO:26.

[0022] In one embodiment, the polynucleotide encoding antibody LC contains the nucleic acid sequence of SEQ ID NO: 18. In another embodiment, the polynucleotide encoding antibody HC contains the nucleic acid sequence of SEQ ID NO: 21.

[0023] In one aspect, HCVR, LCVR, HC, LC, LCVR, and HCVR, or LC and HC, polynucleotides encoding antibodies binding to CD30L are also provided, wherein the antibody comprises HCDR1 containing SEQ ID NO: 7, HCDR2 containing SEQ ID NO: 8, HCDR3 containing SEQ ID NO: 9, LCDR1 containing SEQ ID NO: 10, LCDR2 containing SEQ ID NO: 11, and LCDR3 containing SEQ ID NO: 12. In an embodiment, the antibody comprises HC containing SEQ ID NO: 23 and LCVR containing SEQ ID NO: 24. In an embodiment, the antibody comprises HC containing SEQ ID NO: 29 and LC containing SEQ ID NO: 30.

[0024] In one embodiment, the polynucleotide encodes an HCVR of the antibody, wherein the amino acid sequence of the HCVR contains SEQ ID NO: 23. In another embodiment, the polynucleotide encodes an LCVR of the antibody, wherein the amino acid sequence of the LCVR contains SEQ ID NO: 24. In yet another embodiment, the polynucleotide encodes both an HCVR and an LCVR of the antibody, wherein the amino acid sequence of the HCVR contains SEQ ID NO: 23 and the amino acid sequence of the LCVR contains SEQ ID NO: 24.

[0025] In one embodiment, the polynucleotide encodes the HC of the antibody, wherein the amino acid sequence of the HC contains SEQ ID NO: 29. In another embodiment, the polynucleotide encodes the LC of the antibody, wherein the amino acid sequence of the LC contains SEQ ID NO: 30. In yet another embodiment, the polynucleotide encodes both the LC and HC of the antibody, wherein the amino acid sequence of the HC contains SEQ ID NO: 29, and the amino acid sequence of the LC contains SEQ ID NO: 30.

[0026] In one embodiment, the polynucleotide encoding antibody LC contains the nucleic acid sequence of SEQ ID NO: 16. In another embodiment, the polynucleotide encoding antibody HC contains the nucleic acid sequence of SEQ ID NO: 17.

[0027] In embodiments, this disclosure provides vectors comprising any polynucleotides disclosed herein. In embodiments, the vector is a recombinant expression vector. In embodiments, the vector comprises polynucleotides encoding HCVR, LCVR, HC, LC, LCVR, and HCVR, or LC and HC, of ​​an antibody binding to CD30L, wherein the antibody comprises HCDR1 containing SEQ ID NO: 1, HCDR2 containing SEQ ID NO: 2, HCDR3 containing SEQ ID NO: 3, LCDR1 containing SEQ ID NO: 4, LCDR2 containing SEQ ID NO: 5, and LCDR3 containing SEQ ID NO: 6. In embodiments, the antibody comprises HCVR containing SEQ ID NO: 19 and LCVR containing SEQ ID NO: 20. In embodiments, the antibody comprises HC containing SEQ ID NO: 25 and LC containing SEQ ID NO: 26.

[0028] In one embodiment, the vector comprises a polynucleotide encoding an HCVR of an antibody, wherein the amino acid sequence of the HCVR contains SEQ ID NO: 19. In another embodiment, the vector comprises a polynucleotide encoding an LCVR of an antibody, wherein the amino acid sequence of the LCVR contains SEQ ID NO: 20. In yet another embodiment, the vector comprises polynucleotides encoding both HCVR and LCVR of an antibody, wherein the amino acid sequence of the HCVR contains SEQ ID NO: 19 and the amino acid sequence of the LCVR contains SEQ ID NO: 20.

[0029] In one embodiment, the vector comprises a polynucleotide encoding an antibody HC, wherein the amino acid sequence of the HC contains SEQ ID NO: 25. In another embodiment, the vector comprises a polynucleotide encoding an antibody LC, wherein the amino acid sequence of the LC contains SEQ ID NO: 26. In yet another embodiment, the vector comprises polynucleotides encoding both an antibody LC and an antibody HC, wherein the amino acid sequence of the HC contains SEQ ID NO: 25, and the amino acid sequence of the LC contains SEQ ID NO: 26.

[0030] In one embodiment, the vector comprises a polynucleotide encoding antibody LC, wherein the polynucleotide encoding LC contains the nucleic acid sequence of SEQ ID NO: 18. In another embodiment, the vector comprises a polynucleotide encoding antibody HC, wherein the polynucleotide encoding HC contains the nucleic acid sequence of SEQ ID NO: 21.

[0031] Also provided are vectors comprising polynucleotides encoding HCVR, LCVR, HC, LC, LCVR, and HCVR, or LC and HC, that encode an antibody binding to CD30L, wherein the antibody comprises HCDR1 containing SEQ ID NO: 7, HCDR2 containing SEQ ID NO: 8, HCDR3 containing SEQ ID NO: 9, LCDR1 containing SEQ ID NO: 10, LCDR2 containing SEQ ID NO: 11, and LCDR3 containing SEQ ID NO: 12. In an example, the antibody comprises HCVR containing SEQ ID NO: 23 and LCVR containing SEQ ID NO: 24. In an example, the antibody comprises HC containing SEQ ID NO: 29 and LC containing SEQ ID NO: 30.

[0032] In one embodiment, the vector comprises a polynucleotide encoding an HCVR of an antibody, wherein the amino acid sequence of the HCVR contains SEQ ID NO: 23. In another embodiment, the vector comprises a polynucleotide encoding an LCVR of an antibody, wherein the amino acid sequence of the LCVR contains SEQ ID NO: 24. In yet another embodiment, the vector comprises polynucleotides encoding both HCVR and LCVR of an antibody, wherein the amino acid sequence of the HCVR contains SEQ ID NO: 23 and the amino acid sequence of the LCVR contains SEQ ID NO: 24.

[0033] In one embodiment, the vector comprises a polynucleotide encoding an antibody HC, wherein the amino acid sequence of the HC contains SEQ ID NO: 29. In another embodiment, the vector comprises a polynucleotide encoding an antibody LC, wherein the amino acid sequence of the LC contains SEQ ID NO: 30. In yet another embodiment, the vector comprises polynucleotides encoding both an antibody LC and an antibody HC, wherein the amino acid sequence of the HC contains SEQ ID NO: 29, and the amino acid sequence of the LC contains SEQ ID NO: 30.

[0034] In one embodiment, the vector comprises a polynucleotide encoding antibody LC, wherein the polynucleotide encoding LC contains the nucleic acid sequence of SEQ ID NO: 16. In another embodiment, the vector comprises a polynucleotide encoding antibody HC, wherein the polynucleotide encoding antibody HC contains the nucleic acid sequence of SEQ ID NO: 17.

[0035] This disclosure provides host cells comprising any polynucleotide of this disclosure or any vector of this disclosure. In embodiments, host cells incorporating a vector of this disclosure are provided. In embodiments, the host cell comprises a vector containing a polynucleotide encoding an antibody HC, wherein the amino acid sequence of the HC contains SEQ ID NO: 25. In embodiments, the host cell comprises a vector containing a polynucleotide encoding an antibody LC, wherein the amino acid sequence of the LC contains SEQ ID NO: 26. In embodiments, a host cell comprising a vector containing polynucleotides encoding antibody HC and antibody LC, wherein the amino acid sequence of the HC contains SEQ ID NO: 25 and the amino acid sequence of the LC contains SEQ ID NO: 26. This disclosure also provides a method for producing an antibody comprising two HCs and two LCs, wherein the method comprises (i) culturing the host cell of this disclosure under conditions for antibody expression, and (ii) recovering the expressed antibody. In embodiments, each HC contains SEQ ID NO: 25 and each LC contains SEQ ID NO: 26. This disclosure also provides antibodies obtainable by said method.

[0036] In one embodiment, the host cell comprises a vector containing a polynucleotide encoding an antibody HC, wherein the amino acid sequence of the HC contains SEQ ID NO: 29. In another embodiment, the host cell comprises a vector containing a polynucleotide encoding an antibody LC, wherein the amino acid sequence of the LC contains SEQ ID NO: 30. In another embodiment, a host cell comprising a vector containing polynucleotides encoding antibodies HC and LC is provided, wherein the amino acid sequence of the HC contains SEQ ID NO: 29 and the amino acid sequence of the LC contains SEQ ID NO: 30. This disclosure also provides a method for producing an antibody comprising two HCs and two LCs, wherein the method comprises (i) culturing the host cell of this disclosure under conditions that allow the antibody to be expressed, and (ii) recovering the expressed antibody. In one embodiment, each HC contains SEQ ID NO: 29 and each LC contains SEQ ID NO: 30. This disclosure also provides antibodies obtainable by said method.

[0037] This disclosure provides antibodies for use in therapeutics.

[0038] This disclosure provides antibodies of this disclosure for use in the treatment of inflammatory disorders. In one embodiment, the inflammatory disorder is asthma. In another embodiment, the inflammatory disorder is lupus. In yet another embodiment, the inflammatory disorder is ulcerative colitis.

[0039] This disclosure provides antibodies for the manufacture of medicaments for treating inflammatory disorders. In one embodiment, the inflammatory disorder is asthma. In another embodiment, the inflammatory disorder is lupus. In yet another embodiment, the inflammatory disorder is ulcerative colitis.

[0040] This disclosure provides pharmaceutical compositions comprising the antibody disclosed herein and one or more pharmaceutically acceptable carriers, diluents, or excipients. Detailed Implementation

[0041] This disclosure provides anti-CD30L antibodies and methods for preparing and using said antibodies. Compared to other antibodies evaluated during antibody production, the antibodies disclosed herein exhibit improved characteristics, such as those related to stability. Following initial screening of over 3,500 antibodies, the functional activity of 368 clones in binding to CD30L and blocking of CD30 (receptor) and CD30L (ligand) interaction was further evaluated using cell-based assays measuring IL-8 secretion. Of these 368 clones, twenty-two clones were found to bind with high affinity to native CD30L expressed on human and cynomolgus monkey primary T cells. These twenty-two clones were analyzed using various computer simulation tools, and twelve clones were selected for further optimization and engineering. These twelve antibodies underwent an extensive hotspot rescue process using a yeast display screening platform that analyzed a total of 395 combinatorial mutant Fab variants, and then the CD30L binding of these variants was tested using yeast display methods. Nine antibodies were then converted to IgG1-SEFL2-YTE and tested before and after heat and light stress using five different cell-based assays. The biochemical and biophysical properties of these nine antibodies, including solubility, viscosity, chemical stability, physical stability, and photostability, were also tested. Of the nine antibodies, antibodies 46265 and 46183 exhibited the desired physicochemical properties and were more stable compared to other antibodies exhibiting undesirable properties, including high viscosity after pH jumps, low activity, antibody shearing, and / or solubility and aggregation problems. All nine antibodies were combined, indicating that they bind to the same or similar epitopes, and after extensive engineering and screening, only antibodies 46265 and 46183 showed the properties desired for potential therapy.

[0042] In the examples, the anti-CD30L antibody disclosed herein (i) specifically binds to human CD30L and cynomolgus monkey CD30L in the low picomolar range and with an affinity within 10-fold; (ii) exhibits a picomolar IC50 value in functional assays; (iii) exhibits an increased half-life; and / or (iv) exhibits acceptable physicochemical properties, such as acceptable levels of viscosity and stability.

[0043] As used herein, an "antibody" is an immunoglobulin molecule comprising two heavy chains (HC) and two light chains (LC) linked by disulfide bonds. The amino-terminal portion of each LC and HC includes a variable region of approximately 100–120 amino acids, primarily responsible for antigen recognition via the CDRs contained therein. The CDRs are separated from more conserved regions called frame regions ("FRs"). Each LCVR and HCVR consists of three CDRs and four FRs arranged in the following order from amino-terminus to carboxyl-terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The three CDRs of the LC are referred to as "LCDR1, LCDR2, and LCDR3," and the three CDRs of the HC are referred to as "HCDR1, HCDR2, and HCDR3." The CDRs contain the majority of residues that specifically interact with the antigen. Therefore, the functional ability of an antibody to bind to a specific antigen is largely influenced by the amino acid residues within the six CDRs. Unless otherwise stated, the amino acid assignments to the CDR domains within the LCVR and HCVR regions of the antibodies disclosed herein are based on the well-known Kabat numbering rules (Kabat et al., Ann. NY Acad. Sci. 190:382-93 (1971); Kabat et al., Sequences of Proteins of Immunological Interest, 5th edition, US Department of Health and Human Services, NIH Publication No. 91-3242 (1991)).It is understandable that other numbering rules can also be used, such as those of Chothia (Chothia et al., “Canonical structures for the hypervariable regions of immunoglobulin”, Journal of Molecular Biology, 196, 901-917 (1987); Al-Lazikani et al., “Standard conformations for the canonical structures of immunoglobulins”, Journal of Molecular Biology, 273, 927-948 (1997)), and / or North (North et al., “A New Clustering of Antibody CDR Loop Conformations”, Journal of Molecular Biology, 406, 228-256 (2011)).

[0044] "Anti-CD30L antibody" is an antibody that binds to CD30L. In the examples, the anti-CD30L antibody specifically binds to CD30L. As measured by surface plasmon resonance technology (e.g., BIACore, GE Healthcare, Uppsala, Sweden) or kinetic exclusion assay (KinExA, Savidyne, Boise, Idaho), when the antigen-binding protein binds at ≤ 10 -7 When the dissociation constant (KD) of M binds to an antigen, the antigen-binding protein is said to be "specifically bound" to that antigen. In examples, the anti-CD30L antibody specifically binds to human CD30L. In examples, the anti-CD30L antibody specifically binds to cynomolgus monkey CD30L. In examples, the anti-CD30L antibody specifically binds to human CD30L with an affinity within 10 times that of the binding affinity of the anti-CD30L antibody to cynomolgus monkey CD30L. When the antibodies, peptides, and other molecules disclosed herein exist in a physical environment different from the physical environment in which they are produced or naturally occurring, they are "dissociated".

[0045] As part of this disclosure, Fab, scFab, and scFv of CDRs containing the anti-CD30L antibody disclosed herein are also considered. As part of this disclosure, Fab and scFv of variable regions (LCVR and / or HCVR) containing the anti-CD30L antibody disclosed herein are also considered.

[0046] The antibodies disclosed herein may be IgG1, IgG2, or IgG4. The antibodies disclosed herein may be human antibodies or humanized antibodies. In the context of monoclonal antibodies, the terms "human" and "humanized" are well known to those skilled in the art (Weiner LJ, J. Immunother. [Journal of Immunotherapy] 2006; 29: 1-9; Mallbris L et al., J. Clin. Aesthet. Dermatol. [Journal of Clinical Cosmetic Dermatology] 2016; 9: 13-15).

[0047] The antibodies disclosed herein (e.g., IgG1 antibodies) may possess YTE (EU numbers M252Y, S254T, and T256E) to increase antibody half-life, and / or SEFL2 mutations (EU numbers R292C, N297G, and V302C) to reduce or eliminate effector function. Antibodies containing YTE and / or SEFL2 mutations, as well as antibodies containing neither YTE nor SEFL2 mutations, are contemplated as part of this disclosure. The antibodies may also contain cysteine ​​clamps to increase stability after removal of glycosylation sites.

[0048] The term “nucleic acid sequence” is intended to encompass polymers of DNA or RNA, namely polynucleotides, which may be single-stranded or double-stranded and may contain non-natural or modified nucleotides. The terms “nucleic acid,” “nucleic acid molecule,” “nucleic acid sequence,” and “polynucleotide” are used interchangeably herein and refer to polymeric forms of nucleotides of any length (ribonucleotides (RNA) or deoxyribonucleotides (DNA)). These terms refer to the primary structure of the molecule and therefore include double-stranded and single-stranded DNA, as well as double-stranded and single-stranded RNA. As an equivalent, the term “modified nucleic acid sequence” includes RNA or DNA analogs made from nucleotide analogs and modified polynucleotides (e.g., but not limited to methylated and / or capped polynucleotides). The polynucleotides disclosed herein include DNA molecules containing a non-naturally occurring polynucleotide sequence encoding a polypeptide having the amino acid sequence (e.g., heavy chain, light chain, variable heavy chain region, and variable light chain region) of at least one polypeptide in the anti-CD30L antibody disclosed herein.

[0049] By operatively linking DNA encoding the HCVR region to another DNA molecule encoding the heavy chain constant region, a separate DNA molecule encoding the HCVR region can be converted into a full-length heavy chain gene. The sequences of heavy chain constant region genes in humans and other mammals are known in the art. DNA fragments covering these regions can be obtained, for example, by standard PCR amplification.

[0050] By operatively linking DNA encoding the LCVR to another DNA molecule encoding the light chain constant region, isolated DNA encoding the LCVR region can be converted into a full-length light chain gene. The sequences of light chain constant region genes in humans and other mammals are known in the art. DNA fragments covering these regions can be obtained by standard PCR amplification. The light chain constant region can be a κ or λ constant region. In some embodiments, the light chain constant region is a κ constant region.

[0051] The term "encoding" refers to a polynucleotide sequence that encodes one or more amino acids. This term does not require start or stop codons. This disclosure covers nucleic acid molecules encoding anti-CD30L antibody peptide sequences, including those encoding heavy chain variable regions, light chain variable regions, and both the heavy and light chains.

[0052] The polynucleotides disclosed herein can be expressed in host cells after the sequence is operatively linked to the expression control sequence. Such expression vectors can typically be replicated in the host organism either as an episome or as part of the host chromosomal DNA. Typically, the expression vector will contain selection markers, such as tetracycline, neomycin, and dihydrofolate reductase, to allow detection of cells transformed with the desired DNA sequence.

[0053] Transformed cells can be cultured under conditions that promote peptide expression, and the peptides can be recovered using standard protein purification procedures. Peptides considered for use herein include substantially homogeneous recombinant mammalian peptides that are substantially free of contaminating endogenous material. Cells containing nucleic acids encoding the anti-CD30L antibody disclosed herein also include hybridomas.

[0054] The polynucleotide encoding the amino acid sequence of the anti-CD30L antibody disclosed herein can be of any length to suit its intended use or function, and may contain one or more additional sequences (e.g., regulatory sequences) and / or be part of a larger nucleic acid (e.g., a vector). Those skilled in the art will understand that each polypeptide sequence disclosed herein is encoded by a large number of other nucleic acid sequences due to the degeneracy of the genetic code. Mutations can also be introduced into nucleic acids without significantly altering the biological activity of the polypeptide they encode. For example, nucleotide substitutions can be made, thereby substituting amino acid residues at non-essential amino acid sites.

[0055] It should be understood that the anti-CD30L antibody disclosed herein may have at least one amino acid substitution, provided that the anti-CD30L antibody retains the same or better desired binding specificity (e.g., binding to CD30L). Therefore, modifications to anti-CD30L antibodies are covered within the scope of this disclosure. Such modifications may include amino acid substitutions, which may be conserved or non-conserved, and do not disrupt the desired binding ability of the binding construct. Conserved amino acid substitutions may cover non-naturally present amino acid residues typically incorporated through chemical peptide synthesis rather than synthesis in biological systems. These include peptide mimics and other reverse or inverted forms of the amino acid moiety. Conserved amino acid substitutions may also involve replacing native amino acid residues with standard residues such that they have little or no effect on the polarity or charge of the amino acid residue at this position.

[0056] Human CD30L consists of the amino acid sequence of SEQ ID NO: 40. Cynomolgus monkey CD30L consists of the amino acid sequence of SEQ ID NO: 41.

[0057] As used herein, the term “variant” with respect to nucleic acid sequences refers to (i) a portion or fragment of a reference nucleotide sequence; (ii) a complementary sequence to a portion of a reference nucleotide sequence; (iii) a nucleic acid substantially identical to a reference nucleic acid or its complementary sequence; or (iv) a nucleic acid that hybridizes to a reference nucleic acid, its complementary sequence, or a sequence substantially identical to it under stringent conditions. With respect to peptides or polypeptides, as used herein, the term “variant” refers to a peptide or polypeptide that differs from a reference peptide or polypeptide in its amino acid sequence by the insertion, deletion, or conserved substitution of amino acids, but retains at least one biological activity of the reference peptide or polypeptide. A variant can also refer to a protein having a substantially identical amino acid sequence to a reference protein that retains at least one biological activity. The term “isotype” may be used herein to refer to polypeptide or protein variants. Typically, a protein isotype is a group of highly similar members of a protein family that originates from a single gene or gene family and is a result of genetic differences. While some protein isotypes exhibit the same or similar biological functions, some areotypes have unique functions. Isotypes can be generated by alternative splicing, variable promoter use, or other post-transcriptional modifications of a single gene.

[0058] Variants can be nucleic acid sequences that are substantially identical across the full length of the gene sequence or a fragment thereof. The nucleic acid sequences can have 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity across the full length of the gene sequence or a fragment thereof. In other embodiments, variants can be amino acid sequences that are substantially identical across the full length of the amino acid sequence or a fragment thereof. The amino acid sequences can have 95%, 96%, 97%, 98%, 99%, or 100% identity across the full length of the amino acid sequence or a fragment thereof. In embodiments, the specified variant of the antibody amino acid sequence is a variant in which the variation occurs outside the antibody's CDR (e.g., such variation occurs within the frame region of HCVR, LCVR, or both HCVR and LCVR). In another embodiment, the specified amino acid sequence variants are those in which the mutation occurs outside the antibody's CDR (e.g., the mutation occurs in the frame region of HCVR, LCVR, or both HCVR and LCVR), and those in which the antibody retains residues mutated during antibody hotspot rescue.

[0059] "Sequence identity" refers to the relationship between two or more amino acid (peptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by sequence comparison. The identity between two sequences is preferably defined by assessing their similarity over the entire length of the sequences identified herein.

[0060] When comparing the identity of two or more nucleotide or amino acid sequences, the percentage of sequence identity between the first and second sequences can be calculated using methods known to those skilled in the art, for example, by dividing the number of residues in the first sequence that are identical to the residues at the corresponding positions in the second sequence by the total number of residues in the first sequence and multiplying by 100%, or by using known computer algorithms for sequence alignment, such as NCBI Blast, BLASTN and BLASTP (Altschul, SF et al., J. Mol. Biol. [Molecular Biology Journal] 215:403-410 (1990)), GCG package (Devereux, J. et al., Nucleic Acids Research [Nucleic Acids Research] 12 (1): 387 (1984)), BestFit, FASTA and EMBOSS Needle (Madeira, F. et al., Nucleic Acids Research [Nucleic Acids Research] 47(W1): W636-W641 (2019)).

[0061] The antibodies disclosed herein can be readily produced in mammalian cells, non-limiting examples of which include CHO, NSO, HEK293, or COS cells. Host cells are cultured using techniques well known in the art.

[0062] Vectors containing a target polynucleotide sequence (e.g., a polynucleotide encoding an antibody peptide and expressing a control sequence) can be transferred into host cells using well-known methods, depending on the type of cell host. Examples of vectors include, but are not limited to, plasmids, viral vectors, non-free mammalian vectors, and expression vectors (e.g., recombinant expression vectors).

[0063] The recombinant expression vector disclosed herein may contain the nucleic acid disclosed herein in a form suitable for expression in a host cell. The recombinant expression vector includes one or more regulatory sequences selected based on the host cell to be used for expression, the one or more regulatory sequences being operatively linked to the nucleic acid sequence to be expressed. Regulatory sequences include those that guide constitutive expression of nucleotide sequences in many types of host cells (e.g., SV40 early gene enhancers, Laureth sarcoma virus promoters, and cytomegalovirus promoters), those that guide expression of nucleotide sequences only in certain host cells (e.g., tissue-specific regulatory sequences, see Voss et al., 1986, Trends Biochem. Sci. 11:287; Maniatis et al., 1987, Science 236:1237, which are incorporated herein by reference in their entirety), and those that guide inducible expression of nucleotide sequences in response to specific treatments or conditions (e.g., metallothionein promoters in mammalian cells and tetracycline-reactive and / or streptomycin-reactive promoters in prokaryotic and eukaryotic systems (see ibid.)). Those skilled in the art will understand that the design of expression vectors can depend on factors such as the choice of host cells to be transformed and the desired protein expression level. The expression vectors disclosed herein can be introduced into host cells to produce proteins or peptides encoded by nucleic acids as described herein, including fusion proteins or peptides.

[0064] Typically, expression vectors used in any host cell will contain sequences for plasmid maintenance and for cloning and expressing exogenous nucleotide sequences. Such sequences are collectively referred to as “sidelink sequences” and, in some embodiments, will typically include one or more of the following nucleotide sequences: a promoter, one or more enhancer sequences, an origin of replication, a transcription termination sequence, a complete intron sequence containing donor and acceptor splicing sites, a leader sequence encoding a polypeptide secretion, a ribosome binding site, a polyadenylated sequence, a junctional region for inserting a nucleic acid encoding the polypeptide to be expressed, and a selection marker element. The leader sequence may contain SEQ ID NO: 32 (MDMRVPAQLLGLLLLWLRGARC), which may be encoded by SEQ ID NO: 28 (atggacatgagagtgcctgcacagctgctgggcctgctgctgctgtggctgagaggcgccagatgc). The leading sequence may contain SEQ ID NO: 27 (MAWALLLLTLLTQGTGSWA), which may be encoded by SEQ ID NO: 22 (atggcctggg ctctgctgct cctcaccctc ctcactcagg gcacagggtc ctgggcc).

[0065] Proteins can be purified using various methods, including but not limited to antibodies, and such methods are known in the art.

[0066] The anti-CD30L antibody disclosed herein can be biosynthesized, purified, and formulated for administration by well-known methods. For example, suitable host cells (such as HEK 293 or CHO) can be transiently or stably transfected with an antibody-secreting expression system using a predetermined HC:LC vector ratio (if using two vectors), or a vector system encoding the heavy and light chains. Vectors suitable for expressing and secreting antibodies from these commonly used host cells are well known. After antibody expression and secretion, the culture medium is clarified to remove cells, and the clarified medium is purified using any of many commonly used techniques. For example, the medium can be applied to a protein A or G column that has been equilibrated with a buffer (such as phosphate-buffered saline (pH 7.4)). The column is washed to remove non-specifically bound components. For example, bound antibodies are eluted through a pH gradient (e.g., 0.1 M sodium phosphate buffer (pH 6.8) to 0.1 M sodium citrate buffer (pH 2.5)). Antibody fractions are detected, for example, by SDS-PAGE, and then pooled. Further purification is optional, depending on the intended use. Antibodies can be concentrated and / or sterile filtered using common techniques. Other materials (besides the antibody), such as host cells and growth medium components, as well as soluble aggregates and polymers of the antibody, can be effectively reduced or removed using common techniques including size exclusion, hydrophobic interactions, cation exchange, anion exchange, affinity chromatography, or hydroxyapatite chromatography. The antibody purity after these chromatographic steps is typically higher than 95%. The product can be frozen or lyophilized at -70°C.

[0067] In an exemplary aspect, the antibodies disclosed herein comprise HC containing a C-terminal lysine, as in SEQ ID NO: 25, 29, 34, and 36. Alternatively, the antibodies comprise HC without a C-terminal lysine, as in SEQ ID NO: 31, 33, 37, and 39. Furthermore, the N-terminal glutamine and / or N-terminal glutamic acid of the HC can be converted to pyroglutamic acid, as in SEQ ID NO: 34, 36, 37, and 39. Either form is contemplated for the antibodies disclosed herein.

[0068] The presently disclosed anti-CD30L antibody or pharmaceutical composition comprising it is envisioned for the treatment of inflammatory diseases. Inflammatory diseases include, but are not limited to, autoimmune diseases such as asthma (including severe asthma), rheumatoid arthritis, lupus and multiple sclerosis, ulcerative colitis and atopic dermatitis.

[0069] Arthritis can be treated using the methods and compositions disclosed herein. As used herein, the term "arthritis" refers to a chronic inflammatory condition that primarily affects joints or the connective tissue surrounding them, but various organs of the body may also be affected.

[0070] Arthritis can initially be autoimmune or traumatic, or it can be triggered by exposure to a foreign antigen, subsequently leading to a chronic condition that no longer depends on the persistent presence of the triggering antigen. As used herein, the term "arthritis" includes: arthritic deformities; osteoarthritis; rheumatoid arthritis (adults and adolescents); Lyme disease arthritis; reactive arthritis, including Lyttle's disease; psoriatic arthritis; tuberous arthritis; and seronegative spondyloarthritis, including but not limited to ankylosing spondylitis.

[0071] The antibodies described herein can be used to treat a variety of rheumatic disorders, which are defined herein as any chronic disorder involving pain and often multiple localized inflammation of the joints, muscles, nerves, tendons, skin, eyes, connective tissue, or various other organ systems. These include, but are not limited to: arthritis; scleroderma; gout; systemic lupus erythematosus (SLE); polymyalgia rheumatica; Still's disease; chronic uveitis; and disorders causing voluntary muscle inflammation, including dermatomyositis and polymyositis, including sporadic inclusion body myositis. Systemic lupus erythematosus can cause inflammation of the joints, skin, kidneys, heart, lungs, blood vessels, and brain. Late forms of systemic lupus erythematosus can lead to kidney failure.

[0072] Methods for using the antibodies described herein in therapies for treating a variety of endocrine disorders are also provided, including but not limited to: juvenile or adult-onset diabetes (including autoimmune, insulin-dependent diabetes; non-insulin-dependent and obesity-mediated diabetes); idiopathic adrenal atrophy; Addison's disease; hypothyroidism; Graves' disease; autoimmune thyroiditis, such as Hashimoto's thyroiditis; and polyglandular autoimmune syndromes (types I and II).

[0073] The antibodies described in this article can also be used in therapies for gastrointestinal disorders, including but not limited to: autoimmune sclerosing cholangitis; celiac disease; inflammatory bowel disease, including Crohn's disease and ulcerative colitis; autoimmune pancreatitis, including chronic pancreatitis; idiopathic gastroparesis; and idiopathic ulcers, including gastric ulcers and duodenal ulcers.

[0074] It also includes methods for using the antibodies described herein in the treatment of various disorders of the genitourinary system, such as autoimmune and idiopathic glomerulonephritis; and chronic idiopathic prostatitis (non-bacterial), including benign prostatic hyperplasia.

[0075] This article also provides methods for using the antibodies described herein in therapies for various hematologic disorders, including but not limited to: anemia and hematologic disorders, including pernicious anemia and aplastic anemia, as well as Fanconi aplastic anemia; autoimmune hemolytic anemia; idiopathic thrombocytopenic purpura (ITP); myelodysplastic syndromes (including refractory anemia, refractory anemia with ringed sideroblasts, refractory anemia with blasts, and refractory anemia with blasts during transformation); and autoimmune lymphoproliferative syndromes (ALPS).

[0076] The disclosed antibodies can also be used to treat conditions that affect the liver, such as autoimmune or chronic inflammatory hepatitis.

[0077] Furthermore, the disclosed antibodies and combinations are used to treat various autoimmune or chronic inflammatory disorders involving hearing loss. One of these is inner ear or cochlear nerve-related hearing loss, which is believed to be caused by an autoimmune process (i.e., autoimmune hearing loss). This condition is currently treated with steroids, methotrexate, and / or cyclophosphamide, which can be administered concurrently with inhibitors or blockers of CD30 / CD30L interactions.

[0078] A variety of inflammatory lung disorders can also be treated with the disclosed antibodies, including: idiopathic lymphangioleiomyomatosis; chronic obstructive pulmonary disease (COPD) associated with chronic non-infectious bronchitis or emphysema; and fibrotic lung diseases such as cystic fibrosis and idiopathic pulmonary fibrosis.

[0079] Transplant-related disorders, including graft-versus-host disease (GVHD), can also be treated with the disclosed antibodies. To prevent or improve GVHD, a composition containing one or more of the disclosed antibodies may be administered before, during, or after bone marrow or solid organ transplants (including transplants of the heart, liver, lung, skin, kidney, or other organs).

[0080] The disclosed antibodies can also be used to treat chronic inflammatory eye diseases, including autoimmune uveitis.

[0081] Such antibodies can also be used to treat diseases associated with airway inflammation, such as asthma.

[0082] The antibodies described in this article can also be used to treat inflammatory disorders affecting the female reproductive system, including: multiple implantation failures / infertility; fetal loss syndrome or IV embryo loss (spontaneous abortion); and endometriosis.

[0083] Other medical disorders treatable with the antibodies described herein include chronic inflammatory and / or central nervous system degenerative diseases. This includes, for example, diseases associated with demyelinating disorders such as multiple sclerosis, systemic sclerosis, and Guillain-Barré syndrome (including acute inflammatory demyelinating polyneuropathy, acute motor axononeuropathy, acute motor-sensory axononeuropathy, and Fisher syndrome). Multiple sclerosis is a representative chronic degenerative disease of the central nervous system that can be treated with agents capable of inhibiting or blocking the interaction between CD30 and CD30L.

[0084] Other chronic inflammatory conditions that can be treated with the disclosed antibodies include cold agglutinin disease; Behçet's syndrome; Sjögren's syndrome; and idiopathic tenosynovitis, as well as various chronic inflammatory disorders associated with genetic defects. Subject inhibitors, compositions, and combination therapies may also be used to treat Bell's palsy (idiopathic facial paralysis); chronic fatigue syndrome (unrelated to ongoing infection); chronic degenerative disc disease; Gulf War syndrome; and myasthenia gravis, which can be treated concurrently with corticosteroids.

[0085] Disorders involving the skin or mucous membranes can also be treated with the antibodies described in this article. These disorders include: acantholytic diseases, including discoid lupus, subacute cutaneous lupus erythematosus, cutaneous vasculitis, Darrie's disease, keratosis pilaris, pemphigus vulgaris, and paraneoplastic pemphigus; rosacea; alopecia areata; bullous pemphigoid; eczema; erythema, including erythema multiforme and vesicular erythema multiforme (Schwartz-Jones syndrome); inflammatory skin diseases; lichen planus; linear IgA bullous diseases (chronic bullous dermatitis in children); loss of skin elasticity; neutrophilic dermatitis (Sweet syndrome); pityriasis rubra pilaris; psoriasis; pyoderma gangrenosa; loss of skin elasticity; and toxic epidermal necrolysis.

[0086] Other diseases that can be treated with the disclosed antibodies include: autoimmune-associated chronic mucocutaneous candidiasis; allergies; sarcoidosis; multicentric reticulocytosis; Wegener's granulomatosis; arteritis, including giant cell arteritis; vasculitis; and chronic autoimmune myocarditis.

[0087] The anti-CD30L antibody or pharmaceutical composition comprising the antibody disclosed herein may be administered via parenteral routes, non-limiting examples of which include subcutaneous and intravenous administration. The anti-CD30L antibody disclosed herein may be administered to patients in single or multiple doses with pharmaceutically acceptable loaders, diluents, or excipients. The pharmaceutical compositions disclosed herein may be prepared by methods well known in the art (e.g., Remington: The Science and Practice of Pharmacy, 22nd edition (2012), A. Loyd et al., Pharmaceutical Press) and comprise an antibody as disclosed herein, and one or more pharmaceutically acceptable loaders, diluents, or excipients.

[0088] As used interchangeably herein, “treatment and / or treating and / or treating” is intended to refer to all processes in which there may be a slowing, interruption, prevention, control, cessation, or reversal of the progression of the disorder described herein, but does not necessarily mean the complete elimination of all disorder symptoms. Treatment includes administering the anti-CD30L antibody disclosed herein to treat a person who will benefit from the activity of the anti-CD30L antibody disclosed herein, and includes: (a) inhibiting further progression of the disease; and (b) alleviating the disease, i.e., causing the disease or disorder to subside or reducing its symptoms or complications.

[0089] A therapeutically effective amount (or dose) of the anti-CD30L antibody disclosed herein may be administered. The amount of anti-CD30L antibody constituting a therapeutic dose may vary depending on the indication for treatment, the patient's weight, and the calculated patient's skin surface area. The administration of the anti-CD30L antibody may be adjusted to achieve the desired effect. In many cases, repeated administration may be necessary. The dosage and frequency of administration may vary depending on factors such as the route of administration, the specific anti-CD30L antibody used, the nature and severity of the disease to be treated, whether the condition is acute or chronic, and the subject's body size and general condition.

[0090] Anti-CD30L antibodies or pharmaceutical compositions containing such molecules can be administered by any feasible method. Protein therapeutics are typically administered via parenteral routes (e.g., by injection) because, in the absence of certain specific formulations or conditions, oral administration would result in the hydrolysis of proteins in the acidic environment of the stomach. Subcutaneous, intramuscular, intravenous, intra-arterial, intralesional, or peritoneal bolus injections are possible routes of administration. Anti-CD30L antibodies can also be administered via infusion (e.g., intravenous or subcutaneous infusion).

[0091] Anti-CD30L antibodies can be administered in the form of a composition comprising one or more additional components, such as physiologically acceptable carriers, excipients, or diluents. Optionally, the composition may further comprise one or more physiologically active agents. In various specific embodiments, in addition to one or more anti-CD30L antibodies, the composition may also comprise one, two, three, four, five, or six physiologically active agents.

[0092] As used herein, "effective amount" means the amount of the anti-CD30L antibody disclosed herein or a pharmaceutical composition comprising such an antibody that will elicit a biological or medical response or desired therapeutic effect in a tissue, system, animal, mammal, or human as sought by an investigator, physician, or other clinician. The effective amount of an antibody can vary depending on factors such as an individual's disease state, age, sex, and weight, and the antibody's ability to elicit the desired response in that individual. An effective amount is also the amount in which the therapeutically beneficial effect of the antibody outweighs any toxic or harmful effects. Such benefits include improvement in the signs or symptoms of one or more inflammatory diseases. Those skilled in the art can readily determine the effective amount using known techniques and by observing results obtained under similar conditions. An effective amount of the anti-CD30L antibody disclosed herein can be administered in single or multiple doses. When determining the effective dose for a patient, the attending physician will consider many factors, including but not limited to: the patient’s body type (e.g., weight or mass), body surface area, age and general health status; the specific disease or disorder involved; the degree, extent or severity of the disease or disorder; the individual patient’s response; the specific compound administered; the route of administration; the bioavailability characteristics of the administered formulation; the dosage regimen chosen; the use of concomitant medications; and other relevant circumstances known to the physician. Example

[0093] Example 1: CD30L specificity

[0094] To determine antibody species cross-reactivity and specificity, HEK 293T cells cultured in Freestyle™ 293 expression medium (supplemented with 2% fetal bovine serum (HyClone)) and 50 µg / mL G-418 disulfide solution (Sigma-Aldrich) were transiently transfected using the 293fectin™ transfection reagent (Gibco) as described below.

[0095] TNF superfamily members most closely associated with CD30L, CD27L, 4-1BBL, and FasL were identified through sequence homology. According to the manufacturer's instructions, human CD30L (SEQ ID NO: 40), cynomolgus monkey CD30L (SEQ ID NO: 41), human CD27L (SEQ ID NO: 15), human 4-1BBL (SEQ ID NO: 38), human FasL (SEQ ID NO: 35), or the control expression vector Gibco™ OptiMEM were used. ® The protein was expressed in HEK 293T cells by transfection with culture medium (Gibberco) and 293Fectin™ reagent (Invitrogen). Human B-cell lymphoma (Ramos) cell lines were also used to determine the specificity for endogenously expressed CD30L.

[0096] Transfected cells were incubated overnight at 37°C, 5% CO2, in a humidified incubator at 120 RPM on a fixed-track shaker. The next day, transfected cells were washed and resuspended in FACs buffer (PBS supplemented with 2% FBS). Cells were added at 50,000 cells / well to 96-well clear V-bottom polystyrene plates (Corning®) and incubated for 2 hours at 4°C with 5 µg / mL (or a 2-fold diluted sample if the concentration is less than 5 µg / mL) of the test antibody. After washing twice with FACs buffer, cells were irrigated with Alexa Fluor. ® 647-conjugated AffiniPure goat anti-human Fcγ fragment-specific IgG (Jackson ImmunoResearch) and 2.5 µg / mL 7-aminoactinomycin D (Sigma-Aldrich) were stained at 4°C for 20 min. After a further washing step, cells were resuspended in FACS buffer, and binding strength was determined using an iQue flow cytometer equipped with an Intellicyt autosampler (Intellicyt). The binding strength was determined using Intellicyt Forecyt. ® Enterprise Client software analyzes the acquired data.

[0097] Data from hybridomas in three groups of immunized animals are shown in Table 1.

[0098] These data indicate that the antibody binds only to human and cynomolgus monkey CD30L cells. The antibodies tested in the supernatant did not bind to human CD27L, human 4-1BBL, human FasL, or 293T cells transfected with the control expression vector. Further studies showed that the purified antibody 46265 did not bind to mouse CD30L (SEQ ID NO: 13; ratio 1.0) or rat CD30L (SEQ ID NO: 14; ratio 1.1).

[0099] Table 1. Binding (relative) of hybridoma supernatant (final Ab concentration 5 µg / ml) as determined by flow cytometry (combination multiple of control)

[0100]

[0101] Example 2: Antibodies that bind to human and cynomolgus monkey PBMCs

[0102] The binding of anti-CD30L antibodies to endogenous CD30L expressed in primary human and cynomolgus monkey peripheral blood mononuclear cells (human or cynomolgus monkey PBMCs) was assessed by flow cytometry. For the human primary cell binding assay, purified human T cells (Biological Specialty Corp.) were thawed and cultured at 2.5 × 10⁻⁶ cells / cells. 6 T cells were suspended at a concentration of 1 cell / mL. The cells were then stimulated for 72 hours at 37°C / 5% CO2 with 5 µg / mL of anti-human CD3 clone OKT3 (eBioscience) bound to the plate and 1 µg / mL of anti-human CD28 (BD Pharmingen) in suspension. After 72 hours, the cells were removed, washed, and inoculated at 0.5 x 10⁻⁶ cells / mL. 6 Cells were suspended at a concentration of 10 ng / mL in IL-2 (Pepro Tech). The cells were then incubated at 37°C / 5% CO2 for 7 days. For primary cell binding assays in cynomolgus monkeys, cynomolgus monkey PBMCs (Shin Nippon Scientific Co., Ltd. (SNBL)) were thawed and incubated at 4 × 10⁻⁶ cells / mL. 6 With 5 × 10 6PBMCs were suspended at a concentration between cells / mL. PBMCs were stimulated for 72 hours at 37°C / 5% CO2 with 1 µg / mL anti-human CD28 (BD Pharmingen) in the suspension and 1 µg / mL anti-human CD3 clone SP34 (BD Pharmingen) bound to a plate (pre-coated with 5 µg / mL anti-mouse IgG Fc (Pierce)). Cells for flow cytometry were prepared 72 hours after thawing of cynomolgus monkey PBMCs and 10 days after thawing of human T cells. Both human T cells and cynomolgus monkey PBMCs were first incubated with hybridoma supernatant, positive control antibody, and isotype control antibody. After washing, the cells were incubated with 5 µg / mL Alexa Fluor 647 AffiniPure F(ab')2 fragment goat anti-human IgG Fc (Jackson Immunological Research) and 8.25 nM YoPro1 (Ingenium). Cynomolgus monkey PBMCs also included anti-human CD4 conjugated to the Pacific Blue fluorophore (BioLegend) for gating T cell populations. Cells were then run on a BD FACSCanto II flow cytometer to detect CD30L antibody binding. Geometric mean fluorescence intensity (gMFI) values ​​were obtained for both fluorescently labeled human and cynomolgus monkey PBMCs. These values ​​were divided by those obtained with unlabeled PBMCs to derive a value representing the binding fold relative to the isotype control.

[0103] Table 2. CD30L antibodies binding to PBMCs

[0104]

[0105] These data indicate that hybridoma supernatants containing the antibodies disclosed herein bind to endogenously expressed human and cynomolgus CD30L on primary T cells.

[0106] Example 3: Affinity of anti-CD30L antibody

[0107] The affinity of hybridoma supernatant containing antibody clone 46183 or antibody clone 46265 for native cynomolgus CD30L transiently expressed on 293T cells and for native human CD30L expressed on Ramos cells was assessed by kinetic exclusion assay (KinExA).

[0108] KinExA is performed, where K is determined based on the concentration of free antibody remaining in solution after equilibrium has been established between the antibody and the antigen expressed on the cell surface. offCompared to soluble CD30L, KinExA provides a more sensitive determination of the binding affinity for the natural form of CD30L. The determination is performed essentially as described by Rathanaswami et al., Anal. Biochem [Analytical Biochemistry]: 373(1): 52-60 (2008).

[0109] In short, equilibration groups were established for each antibody using Ramos cells expressing human CD30L or 293T cells expressing cynomolgus monkey CD30L. Cells were counted using a hemocytometer. Ramos cells were titrated and incubated in HUT medium (RPMI 1640, 10% FBS, 10 mM HEPES, 2 mM L-Glut, 1 mM Sod. Pyr, 0.1 mM NEA, 50 µM 2-ME) with two different constant antibody concentrations (one at 48 pM and the other at 2 nM) with 0.05% sodium azide. For the high [Ab] equilibration group, Ramos cells were titrated at a concentration of 25 million / mL in Eppendorf tubes at a 1:2 ratio for 10 points and equilibrated with a total volume of 400 µL of 1 nM antibody. For the low [Ab] equilibration group, Ramos cells were titrated at a concentration of 3.89 million / mL in 50 mL Fulcon tubes at a 1:2 ratio at 10 points and equilibrated with 20-30 pM antibody in a total volume of 15.5 mL.

[0110] 293T cells expressing cynomolgus macaque CD30L were titrated and incubated in 293T medium (free-form expression 293T medium with 2% FBS and 50 pg / ml G418) with two different constant antibody concentrations (118 pM and 5 nM). For the high [Ab] equilibration group, 293T cells were titrated at 25 million / mL in Eppendorf tubes at 1:3 for 10 points and equilibrated with 200 µL of 5 nM antibody. For the low [Ab] equilibration group, 293T cells were titrated at 980,000 / mL in 15 mL Fulcon tubes at 1:3 for 10 points and equilibrated with 10.2 mL of 118 pM antibody. For each equilibration group, reference controls included samples containing only cell culture medium and samples without cells. The equilibration groups were incubated at room temperature with shaking for 24 hours. After 24 hours of incubation, the supernatant was separated from the cell pellet by centrifugation at 500 xg for five minutes. The supernatants from the high [Ab] and low [Ab] equilibration groups were then passed through a KinExA 3200 machine.

[0111] The equilibrium sample groups were read in duplicate on the KinExA instrument. For low [Ab] equilibrium samples, 6.8 mL and 4.6 mL of each sample were run in duplicate for human and cynomolgus monkey CD30L equilibrium experiments, respectively. For high [Ab] equilibrium samples, 16 pL and 75 pL of each sample were run in duplicate for human and cynomolgus monkey CD30L equilibrium experiments, respectively.

[0112] PMMA (polymethyl methacrylate) beads were coated with goat anti-human Fc Ab or goat anti-hlgG (Fl+L) Ab and subsequently blocked with blocking solution (lxPBS pF17.4 + 10 mg / mL BSA + 0.05% sodium azide). For each equilibration sample, free [Ab] was detected by passing the equilibration sample through the coated beads and then rapidly washing with run buffer (lxPBS + 1% BSA + 0.05% sodium azide). A second detection antibody (goat anti-huIgG (Fl+L) Alexa 647) was passed through the flow cell at 680 ng / mL and 500 pL per run. Kd was calculated using the KinExA voltage output signal in KinExA software. Krf was obtained by curve fitting using n-curve analysis in KinExA Pro software version 4.3.11 (Sapidyne Instruments Inc.) based on the curves at two different initial total [Ab] concentrations. The 95% confidence intervals are for Kd low and Kd high. The results are shown in Table 3.

[0113] These data indicate that the disclosed antibody binds to human CD30L and cynomolgus monkey CD30L with high affinity.

[0114] Table 3. Affinity of CD30L antibody to human and cynomolgus monkey CD30L (shown as Kd, where 95% of each was determined). CI)

[0115]

[0116] Example 4: Antibody-mediated functional activity

[0117] The ability of the antibody to block the endogenous expression of CD30L in Ramos cell line (endogenous expression of CD30) to stimulate the production of interleukin-8 (IL-8) in K299 cell line (endogenous expression of CD30) was tested. The antibody was prepared in assay medium (RPMI 1640 with 10% FBS and 2 mM L-Glut) (starting from 80 nM with 1:5 dilution steps) and loaded into flat-bottom 96-well plates at 50 μL / well (20 nM final starting concentration).

[0118] Ramos cells expressing CD30L were prepared in assay medium at a concentration of 10 million / ml, and 50 µl / well of anti-CD30L antibody was added to each well to reach a cell density of 500,000 cells / well. Karpas-299 cells expressing CD30 were prepared in assay medium at a concentration of 1 million / ml, and 100 µl / well of Karpas-299 cells expressing CD30 was added to each well containing the assay antibody and Ramos cells to reach a cell density of 100,000 cells / well, with a Ramos:Karpas-299 ratio of 5:1.

[0119] Cells and anti-CD30L antibody were incubated overnight at 37°C with 5% CO2. At the end of incubation, the supernatant was collected and induced IL8 secretion was measured using the R&D IL8 ELISA kit. The results are shown in Table 4.

[0120] These data demonstrate that the antibody disclosed herein inhibits CD30L-induced IL-8 secretion, with an IC50 value in the picomolar range.

[0121] Table 4. Inhibition of IL-8 production by CD30L antibody

[0122]

[0123] Example 5: The Fc domain engineered by YTE exhibits enhanced interaction with FcRn.

[0124] The standard running buffers are as follows: 20 mM MES / HCl, 140 mM NaCl, pH = 5.5 (Buffer A); 20 mM MRIS / HCl, 140 mM NaCl, pH = 8.8 (Buffer B). In short, each analyte is diluted to 0.5 mg / mL in Buffer A, at least 5-fold if possible. Gradient elution is performed after injecting 20 µL of analyte onto a pre-equilibrated column in 20% Buffer B. The gradient conditions are: 10 min loading followed by 80 min washing from 20% to 100% Buffer B, then 10 min washing with 100% B, followed by a rapid 3 min return to 20% Buffer B. The retention time (rt) of the analytes is normalized using antibodies without YTE (YTE negative control) and antibodies with YTE (YTE positive control) as (analyte (rt) - YTE negative control (rt)) / (YTE positive control - YTE negative control (rt)). After baseline subtraction, the data were fitted to a Gaussian function in OriginPro (OriginLab, Northampton, MA), and the resulting peak retention time and full width at half maximum (FWHM) were obtained from the fitted data. Trel represents elution time. Trel between zero (YTE negative control) and one (YTE positive control) indicates reduced interaction with FcRn.rel = (t) 样品 - t 标准1 ) / (t 标准2 -t 标准1 The results are shown in Table 5.

[0125] Table 5. Anti-CD30L antibodies exhibiting YTE-FcRn interaction

[0126]

[0127] Example 6: The Fc domain engineered by YTE extends the in vivo half-life.

[0128] Mouse pharmacokinetic (PK) studies were conducted in 32 homozygous male huFcRn transgenic mice. Anti-CD30L antibodies with and without the YTE mutation were prepared in 10 mM sodium acetate (pH 5.2) with 9% sucrose. Mice received a single injection of the appropriate test substance at a dose of 1 mg / kg via the lateral tail vein. Blood samples were collected via submandibular vein puncture at predetermined time points up to 42 days post-administration. Whole blood was collected and placed in Microvette® 500 μl K3 EDTA plasma separator tubes (20.1341.102, Sarstedt, Newton, NAT, N.C.), gently mixed by manual inversion 8–10 times, and centrifuged at 11,500 xg for 5 min at 4°C. The resulting plasma was stored at -70°C (±10°C) until analysis.

[0129] The concentration of anti-CD30L antibody in mouse plasma samples was determined by an ELISA specific to the intact, full-length sample, using biotinylated mouse anti-human IgG Fc 1.35.1 mAb (Amgen, PL-50510) as the capture reagent and biotinylated recombinant human CD30 ligand / TNFSF8 protein (R&D Systems, 1028-CL-050) as the detection reagent, followed by streptavidin-horseradish peroxidase conjugate (R&D Systems, Inc., Minneapolis, Minnesota). Serum analyte concentrations were obtained by interpolation from the standard curve using the corresponding analytes 46265-2 and 46183-1. The LLOQ measured in serum was 0.61 ng / mL. The ULOQ measured in serum was 10000 ng / mL. Sample concentrations were interpolated from the standard curve fitted to the four-parameter logistic model using Watson LIMS (v7.4; Thermo Fisher). PK parameters were estimated from individual plasma concentration-nominal time data using non-compartmental analysis using Phoenix® WinNonlin® (v6.4; Certara, Princeton, NJ). Results are shown in Table 6.

[0130] These data indicate that anti-CD30L antibodies engineered with the YTE Fc domain exhibit an extended half-life consistent with YTE engineering in the Fc.

[0131] Table 6. Half-life of CD30L antibodies with or without YTE

[0132]

[0133] Example 7: Anti-CD30L antibodies reduce antibody responses to immunity.

[0134] Eight-week-old female Balb / c mice were immunized intraperitoneally with 100 μg of 2,4,6-trinitrophenyl haptenized ovalbumin (TNP-ova) antigen, which was precipitated with alum (InVivoGen) and delivered in 200 μl PBS. Three weeks post-immunization, mice were treated with either anti-muCD30L-muIgG1 (clone M15) or a muIgG1 isotype control, with N = 5 mice per group. M15 is a mouse effector functional alternative to the two antibodies described herein, exhibiting comparable in vitro affinity and potency. One day after treatment, mice were challenged with 100 μg of TNP-ova in alum. Seven days post-antigen challenge, mice were euthanized and serum was collected. Serum was also collected from naïve (unimmunized) mice. IgE and IgG antibody titers were assessed by ELISA. Results are shown in Table 7.

[0135] These data indicate that, compared with the control, administration of the mouse substitute anti-CD30L antibody reduced the concentrations of IgE (associated with type 2 inflammatory response) and IgG antibody (associated with type 1 inflammatory response).

[0136] Table 7. In vivo IgE and IgG titers

[0137]

[0138] Example 8: CD30L in a mouse airway inflammation model

[0139] Eight-week-old female Balb / c mice were immunized with 100 μg of ovalbumin (ova) antigen via intraperitoneal injection, which was precipitated with alum (InVivoGen). Two weeks post-immunization, mice were treated with either anti-mouse CD30L antibody M15 or IgG1 isotype controls, with N = 5 mice per group. Mice were treated twice weekly until the end of the study. Airway inflammation was induced in mice by intranasal administration of ovalbumin for three consecutive weeks, starting one day after the first treatment. Four days after final airway challenge, mice were euthanized and tissues were collected. Tissues were also collected from naïve (unimmunized) mice as controls. Blood was collected into serum separator tubes (GE Healthcare) and processed according to the manufacturer's instructions. Serum was frozen at -20°C. Serum was thawed at a later time point for analysis of IgE and IgG antibody titers by ELISA. Lungs were perfused with PBS prior to collection. Perfused lung tissue was processed into a single-cell suspension using Miltenyi C tubes and passed through a 100 µm cell filter. Viable cells were counted, and 1 x 10^6 cells were stained with antibody groups for flow cytometry analysis. After excluding non-viable cells with live / dead staining reagent, eosinophils, B cells, and T cells were counted using standard lineage markers. The results are shown in Table 8.

[0140] These data indicate that, compared with controls, administration of mouse alternatives to anti-CD30L antibodies reduced eosinophil (associated with type 2 inflammation), B cell, and T cell lung infiltration, and showed decreased antibody titers of IgE and IgG isotypes in this mouse airway inflammation model.

[0141] Table 8. In vivo efficacy of anti-mouse CD30L antibody

[0142] sequence

[0143] .

Claims

1. An antibody that binds to CD30L, the antibody comprising: a. HCDR1 containing SEQ ID NO: 1, HCDR2 containing SEQ ID NO: 2, HCDR3 containing SEQ ID NO: 3, LCDR1 containing SEQ ID NO: 4, LCDR2 containing SEQ ID NO: 5, and LCDR3 containing SEQ ID NO: 6; or b. HCDR1 containing SEQ ID NO: 7, HCDR2 containing SEQ ID NO: 8, HCDR3 containing SEQ ID NO: 9, LCDR1 containing SEQ ID NO: 10, LCDR2 containing SEQ ID NO: 11, and LCDR3 containing SEQ ID NO:

12.

2. The antibody of claim 1, wherein the antibody comprises the HCDR1 containing SEQ ID NO: 1, the HCDR2 containing SEQ ID NO: 2, the HCDR3 containing SEQ ID NO: 3, the LCDR1 containing SEQ ID NO: 4, the LCDR2 containing SEQ ID NO: 5, and the LCDR3 containing SEQ ID NO:

6.

3. The antibody of claim 1, wherein the antibody comprises the HCDR1 containing SEQ ID NO: 7, the HCDR2 containing SEQ ID NO: 8, the HCDR3 containing SEQ ID NO: 9, the LCDR1 containing SEQ ID NO: 10, the LCDR2 containing SEQ ID NO: 11, and the LCDR3 containing SEQ ID NO:

12.

4. The antibody according to any one of claims 1-3, wherein the antibody comprises a. A heavy chain variable region (HCVR) and a light chain variable region (LCVR), wherein the heavy chain variable region (HCVR) contains SEQ ID NO: 19 or a variant thereof, the variant comprising an amino acid sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 19; and the light chain variable region (LCVR) contains SEQ ID NO: 20 or a variant thereof, the variant comprising an amino acid sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 20; or b. HCVR and LCVR, wherein the HCVR contains SEQ ID NO: 23 or a variant thereof, the variant comprising an amino acid sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 23; and the LCVR contains SEQ ID NO: 24 or a variant thereof, the variant comprising an amino acid sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO:

24.

5. The antibody according to any one of claims 1, 2 or 4, wherein the antibody comprises the HCVR containing SEQ ID NO: 19 and the LCVR containing SEQ ID NO:

20.

6. The antibody according to any one of claims 1, 3 or 4, wherein the antibody comprises the HCVR containing SEQ ID NO: 23 and the LCVR containing SEQ ID NO:

24.

7. The antibody according to any one of claims 1-6, wherein the antibody comprises: a. A heavy chain (HC) containing SEQ ID NO: 25 and a light chain (LC) containing SEQ ID NO: 26, or b. HC containing SEQ ID NO: 29 and LC containing SEQ ID NO:

30.

8. The antibody according to any one of claims 1, 2, 4, 5 or 7, wherein the antibody comprises the HC containing SEQ ID NO: 25 and the LC containing SEQ ID NO:

26.

9. The antibody according to any one of claims 1, 3, 4, 6 or 7, wherein the antibody comprises the HC containing SEQ ID NO: 29 and the LC containing SEQ ID NO:

30.

10. The antibody according to any one of claims 1-9, wherein the antibody comprises: a. Two HCs and two LCs, each HC containing SEQ ID NO: 25 and each LC containing SEQ ID NO: 26; or b. Two HCs and two LCs, each HC containing SEQ ID NO: 29 and each LC containing SEQ ID NO:

30.

11. The antibody according to any one of claims 1, 2, 4, 5, 7, 8 or 10, wherein the antibody comprises two HCs and two LCs, each HC containing SEQ ID NO: 25 and each LC containing SEQ ID NO:

26.

12. The antibody according to any one of claims 1, 3, 4, 6, 7, 9 or 10, wherein the antibody comprises two HCs and two LCs, each HC containing SEQ ID NO: 29 and each LC containing SEQ ID NO:

30.

13. An anti-CD30L antibody comprising a heavy chain containing SEQ ID NO:29 and a light chain containing SEQ ID NO:

30.

14. An anti-CD30L antibody comprising a heavy chain containing SEQ ID NO:25 and a light chain containing SEQ ID NO:

26.

15. An anti-CD30L antibody, the antibody comprising a. HC containing SEQ ID NO: 33 and LC containing SEQ ID NO: 30; b. HC containing SEQ ID NO: 36 and LC containing SEQ ID NO: 30; c. HC containing SEQ ID NO: 39 and LC containing SEQ ID NO: 30; d. HC containing SEQ ID NO: 31 and LC containing SEQ ID NO: 26; e. HC containing SEQ ID NO: 34 and LC containing SEQ ID NO: 26; or f. HC containing SEQ ID NO: 37 and LC containing SEQ ID NO:

26.

16. The antibody according to any one of claims 1-15, wherein the antibody a. Binding with human CD30L with a dissociation constant (KD) value of less than 100, 75 or 50 picomoles, as measured by surface plasmon resonance or kinetic exclusion assay; b. KD values ​​less than 100, 75 or 50 picomoles are used to bind cynomolgus CD30L, as measured by surface plasmon resonance technology or kinetic exclusion determination. c. It binds to human CD30L and cynomolgus monkey CD30L with an affinity that is less than 10 times greater; d. Blocking the binding of human CD30L to human CD30, as determined by cell-based assays; or e. Inhibit CD30L-induced IL-8 secretion, as determined by cell-based assays.

17. A method for treating an inflammatory disorder in a patient, the method comprising administering to the patient an effective amount of an antibody as described in any one of claims 1-16.

18. The method of claim 17, wherein the inflammatory disorder is asthma.

19. The method of claim 17, wherein the inflammatory disorder is lupus.

20. The method of claim 17, wherein the inflammatory disorder is ulcerative colitis.

21. A polynucleotide encoding: HCVR, LCVR, both HCVR and LCVR, LC, HC, or both HC and LC of an antibody that binds to CD30L, wherein the antibody comprises a. HCDR1 containing SEQ ID NO: 1, HCDR2 containing SEQ ID NO: 2, HCDR3 containing SEQ ID NO: 3, LCDR1 containing SEQ ID NO: 4, LCDR2 containing SEQ ID NO: 5, and LCDR3 containing SEQ ID NO: 6; or b. HCDR1 containing SEQ ID NO: 7, HCDR2 containing SEQ ID NO: 8, HCDR3 containing SEQ ID NO: 9, LCDR1 containing SEQ ID NO: 10, LCDR2 containing SEQ ID NO: 11, and LCDR3 containing SEQ ID NO:

12.

22. The polynucleotide of claim 21, wherein the antibody comprises the HCDR1 containing SEQ ID NO: 1, the HCDR2 containing SEQ ID NO: 2, the HCDR1 containing SEQ ID NO: 3, the LCDR1 containing SEQ ID NO: 4, the LCDR2 containing SEQ ID NO: 5, and the LCDR3 containing SEQ ID NO:

6.

23. The polynucleotide of claim 21, wherein the antibody comprises the HCDR1 containing SEQ ID NO: 7, the HCDR2 containing SEQ ID NO: 8, the HCDR1 containing SEQ ID NO: 9, the LCDR1 containing SEQ ID NO: 10, the LCDR2 containing SEQ ID NO: 11, and the LCDR3 containing SEQ ID NO:

12.

24. The polynucleotide of claim 21 or 22, wherein the polynucleotide encodes the LC of the antibody, wherein the amino acid sequence of the LC contains SEQ ID NO:

26.

25. The polynucleotide of claim 21 or 22, wherein the polynucleotide encodes the HC of the antibody, wherein the amino acid sequence of the HC contains SEQ ID NO:

25.

26. The polynucleotide of claim 21 or 22, wherein the polynucleotide encodes the HC and LC of the antibody, wherein the amino acid sequence of the HC contains SEQ ID NO: 25, and the amino acid sequence of the LC contains SEQ ID NO:

26.

27. The polynucleotide of claim 21 or 23, wherein the polynucleotide encodes the LC of the antibody, wherein the amino acid sequence of the LC contains SEQ ID NO:

30.

28. The polynucleotide of claim 21 or 23, wherein the polynucleotide encodes the HC of the antibody, wherein the amino acid sequence of the HC contains SEQ ID NO:

29.

29. The polynucleotide of claim 21 or 23, wherein the polynucleotide encodes the HC and LC of the antibody, wherein the amino acid sequence of the HC contains SEQ ID NO: 29, and the amino acid sequence of the LC contains SEQ ID NO:

30.

30. The polynucleotide of claim 21, 22, 25 or 26, wherein the polynucleotide encoding the antibody HC contains SEQ ID NO:

21.

31. The polynucleotide of claim 21, 22, 24 or 26, wherein the polynucleotide encoding the antibody LC contains SEQ ID NO:

18.

32. The polynucleotide of claim 21, 23, 28 or 29, wherein the polynucleotide encoding the antibody HC contains SEQ ID NO:

17.

33. The polynucleotide of claim 21, 23, 27 or 29, wherein the polynucleotide encoding the antibody LC contains SEQ ID NO:

16.

34. A vector comprising one or more polynucleotides as described in any one of claims 21-33.

35. A host cell comprising one or more polynucleotides as described in any one of claims 21-33 or a vector as described in claim 34.

36. A method for producing an anti-CD30L antibody comprising two HCs and two LCs, wherein the method comprises culturing a host cell as described in claim 35 under conditions that allow the antibody to be expressed, and recovering the expressed antibody.

37. The method of claim 36, wherein the HC comprises the amino acid of SEQ ID NO: 25, and the LC comprises the amino acid sequence of SEQ ID NO:

26.

38. The method of claim 36, wherein the HC comprises the amino acid sequence of SEQ ID NO: 29, and the LC comprises the amino acid sequence of SEQ ID NO:

30.

39. An antibody that can be obtained by the method of claim 37.

40. An antibody that can be obtained by the method of claim 38.

41. The antibody according to any one of claims 1-16, 39 or 40, for use in the treatment of inflammatory disorders.

42. The antibody of claim 41, for use in the treatment of an inflammatory disorder, wherein the inflammatory disorder is asthma, lupus, or ulcerative colitis.

43. Use of the antibody as described in any one of claims 1-16, 39 or 40 in the manufacture of a medicament for treating inflammatory disorders.

44. The use as described in claim 43, wherein the inflammatory disorder is asthma, lupus, or ulcerative colitis.

45. A pharmaceutical composition comprising an antibody as described in any one of claims 1-16, 39 or 40, and one or more pharmaceutically acceptable carriers, diluents or excipients.

Images