Methods and compositions for immunosuppressant-resistant cell therapy

Abstract

Described herein are methods for engineering human immune cells that target exon 5 of the PPIA gene to produce a modified version of the gene product, cyclophilin A, to confer resistance to immunosuppressant drugs. Described herein are compositions comprising the engineered immune cells, as well as methods for treatment comprising administering them.

Description

Cross-reference to related applications

[0001] This application claims priority to U.S. Provisional Application No. 63 / 546,806, filed November 1, 2023, pursuant to 35 USC § 119(e), the contents of which are incorporated herein by reference in their entirety. Government support

[0002] This invention was completed with government support under grant number AI174967 from the National Institutes of Health. The government holds certain rights to this invention. sequence list

[0003] This application includes a sequence list, which has been submitted in XML format through the Patent Center and is incorporated herein by reference in its entirety. The XML copy was created on October 29, 2024, named 701039-000137WOPT_SL.xml, and has a size of 8,759 bytes. Technical Field

[0004] The techniques described herein relate to methods and compositions for immunosuppressant-resistant cell therapy (e.g., calcineurin inhibitor-resistant T cells). Background Technology

[0005] Recurrence of underlying malignancies and complications associated with viral reactivation are leading causes of morbidity and mortality after allogeneic hematopoietic cell transplantation (HCT). In fact, many conditions in hematopoietic cell transplantation, solid organ transplantation, and autoimmune diseases may require treatment with cell therapy. Immune effector cells (IECs) are increasingly being used to prevent and treat these complications. These include therapies such as CAR-T cells, CAR-Tregs, and virus-specific T cells, including anti-CD19 CAR-T cells for B-ALL relapse after HCT, and virus-specific T cells (VSTs) targeting EBV, CMV, etc. However, patients with these medical conditions may have chronic deficiencies in immune tolerance and may already be receiving calcineurin inhibitors (such as cyclosporine or vorticol) for maintenance therapy, which suppress T cell activity. Therefore, in the early post-HCT period, the efficacy of these IECs may be compromised due to the suppressive effects of the immunosuppressants used. This can create a tricky clinical situation where doctors are unsure whether the drug can continue to be used during cell therapy and may gradually reduce or discontinue the drug out of caution, inadvertently causing a disease flare-up. Summary of the Invention

[0006] The techniques described herein relate to methods and compositions related to enhanced cell therapy, particularly the engineering of immune cells to be resistant to immunosuppressant drugs. Aspects of the techniques described herein are based on the inventors' discovery that gene-editing strategies modifying the cyclophilic protein A encoded by the PPIA gene can induce resistance to immunosuppressant drugs.

[0007] In one aspect of any embodiment, this document describes a method for engineering human immune cells, the method comprising gene editing the cells by editing exon 5 of the PPIA gene encoding cyclophilin A, wherein the gene editing produces modified cyclophilin A.

[0008] In some embodiments of any aspect, the gene editing includes introducing a ribonucleoprotein complex into the cell, the ribonucleoprotein complex comprising a CRISPR-associated protein (Cas) and a single guide RNA (sgRNA) targeting exon 5 of the PPIA gene. In some embodiments of any aspect, the sgRNA targets the sequence GGTTTGGCAAAGTGAAAGA.

[0009] In some embodiments of any aspect, the human immune cell is a T cell.

[0010] In one aspect of any embodiment, this document describes a method for preparing engineered human immune cells, the method comprising: isolating immune cells or T cells from a subject; stimulating the immune cells or T cells with an antibody, a virus-derived antigen, an antigen derived from other pathogens, or a cancer antigen; isolating the stimulated immune cells or T cells based on the expression of a marker to obtain a composition of selected immune cells or T cells; gene-editing the cells of the composition by introducing a ribonucleoprotein complex into the cells of the composition to edit the PPIA gene encoding cyclophilin A, the ribonucleoprotein complex comprising a CRISPR-associated protein (Cas) and a single-guide RNA (sgRNA) targeting exon 5 of the PPIA gene; and screening the engineered cells by culturing the cells in the presence of an immunosuppressant capable of interacting with cyclophilin A.

[0011] In some embodiments of any aspect, the sgRNA targeting sequence used for engineered human immune cells is GTGTTTGGCAAAGTGAAAGA. In some embodiments of any aspect, the human immune cells are pan-T cells. In some embodiments of any aspect, the human immune cells are T cells specific to viruses, other pathogens, or cancer antigens. In some embodiments of any aspect, the human immune cells are CAR-T cells.

[0012] In one aspect of any embodiment, the cells or cell populations described herein are generated by the methods of any embodiment.

[0013] In one aspect of any embodiment, the present invention describes engineered cells comprising a gene-edited PPIA gene, wherein the gene is edited in exon 5 of the gene, and wherein the gene-edited PPIA gene encodes a modified cyclophilic protein A.

[0014] In some embodiments of any aspect, the engineered cells are human cells. In some embodiments of any aspect, the engineered cells are immune cells. In some embodiments of any aspect, the engineered cells are T cells. In some embodiments of any aspect, the engineered cells are T cells specific to viruses, other pathogens, or cancer antigens. In some embodiments of any aspect, the engineered cells are sensitized in an antigen-specific manner by stimulation with antibodies, antigens from viruses, other pathogens, or cancer antigens. In some embodiments of any aspect, the engineered cells are regulatory T cells. In some embodiments of any aspect, the engineered cells are CAR-T cells. In some embodiments of any aspect, the engineered cells are generated by CRISPR / Cas-mediated gene editing of the PPIA gene. In some embodiments of any aspect, the engineered cells are generated by CRISPR / Cas-mediated gene editing of the PPIA gene, wherein the single-guide RNA targeting sequence GGTTTGGCAAAGTGAAAGA is used. In one aspect of any embodiment, a cell population comprising the engineered cells of any embodiment is described herein.

[0015] In one aspect of any embodiment, a pharmaceutical composition is described herein, the pharmaceutical composition comprising cells of any embodiment.

[0016] In one aspect of any embodiment, this document describes a method for treating a subject in need, the method comprising administering to the subject a cell or pharmaceutical composition of any embodiment.

[0017] In some embodiments of any aspect, an immunosuppressant is also administered to the subject in need. In some embodiments of any aspect, the immunosuppressant is a calcineurin inhibitor. In some embodiments of any aspect, the calcineurin inhibitor is cyclosporine or vorticol. Attached Figure Description

[0018] Figure 1 We demonstrated that terminal exon editing resulted in a narrow indel spectrum, with two main edits: a +1 bp edit leading to a frameshift, and a -1 bp edit leading to both frameshift and stop codon advancement. These CRISPR edits were stable in culture for 3–4 weeks, indicating no detrimental effect on cell viability.

[0019] Figure 2 Flow cytometry, Western blotting, and confocal microscopy demonstrated the effects of terminal exon editing on PPIA. ΔC T cells retained the expression of cyclophilin A.

[0020] Figure 3 The Jurkat cell line is shown, in which +1 indels (the most common) were isolated by plated single-cell cloning; it was demonstrated that this particular indel corresponds to a protein product that can be identified by flow cytometry.

[0021] Figure 4 This demonstrates a batch RNA-seq comparison of PPIA 4 hours after stimulation with anti-CD3 / CD28 beads (without drug). WT and PPIA ΔC When CD8 T cells were used, no differentially expressed genes were observed, which supports the claim that the editing had no detrimental effect on T cell activation.

[0022] Figure 5 This demonstrated a high percentage of indels in pan-T cells after CRISPR-Cas9 editing.

[0023] Figure 6 A schematic diagram of the mixed lymphocyte response function assay is shown.

[0024] Figure 7 The mixed lymphocyte response was demonstrated. 100,000 PPIAs were used. WT and PPIA ΔC Conventional T cells were co-cultured with 300,000 irradiated allogeneic PBMCs for 5 days. PPIA was assessed based on Cell Trace Violet (CTV) dilution. WT or PPIA ΔC Responder T cell division was normalized to a drug-free control. The data shown reflect CD8-gated responder T cells. Statistical analysis was performed using two-way ANOVA with Sidak post-hoc test.

[0025] Figure 8 PPIA is shown ΔCT was perfectly sensitive to tacrolimus and rapamycin, as expected, because PPIA editing should not affect sensitivity to these drugs.

[0026] Figure 9 This demonstrated a high percentage of indels in CD19 CAR-T cells after CRISPR-Cas9 editing.

[0027] Figure 10 A schematic diagram of CAR-T proliferation assay is shown.

[0028] Figure 11 Edited CD19 CAR T cells stimulated by NALM6 cells at a ratio of 1:0.1 are shown. PPIA was assessed on day 3 based on CTV dilution. WT or PPIA ΔC CAR T cell division data were normalized to a drug-free control. Statistical analysis was performed using two-way ANOVA with Sidak post-hoc test.

[0029] Figure 12 PPIA is shown WT or PPIA ΔC CAR-T cells were stimulated for 4 hours in the presence of protein transport inhibitors + / - PMA / ionomycin (left) or NALM6 cells (right), and stained for cytokine production. 100 ng / mL of CsA was used.

[0030] Figure 13 The diagram shows the PPIA WT or PPIA ΔC CAR-T cells and NALM6 cells were co-cultured for 4 hours with different effector-to-target ratios, and live NALM6 cells were subsequently evaluated to calculate “% kill”. This was performed on CD19 CAR-T cells with both 41BB and CD28 co-stimulatory domains.

[0031] Figure 14 This demonstrated a high percentage of indels in virus-specific T cells (VSTs) after CRISPR-Cas9 editing.

[0032] Figure 15 A schematic diagram is shown regarding the generation and evaluation of CMV VST.

[0033] Figure 16 The VST proliferation assay was read on day 4 after peptide aptamer stimulation and analyzed as described for pan-T cells and CAR T cells.

[0034] Figure 17 PPIA is shown WT or PPIA ΔC Virus-specific T cells were stimulated for 4 hours in the presence of protein transport inhibitors + / - PMA / ionomycin or pp65 aptamer and stained for cytokine production. 100 ng / mL CsA was used.

[0035] Figure 18 The high percentage of indels in CAR-Tregs after CRISPR-Cas9 editing was demonstrated.

[0036] Figure 19 PPIA is shown ΔC Tregs possess normally expressed Treg markers.

[0037] Figure 20 PPIA is shown ΔC Treg cells fully express the activation marker (CD70) in a CsA environment, while the marker is expressed in PPIA. WT Treg is suppressed by CsA. Detailed Implementation

[0038] As demonstrated herein, the inventors have discovered that modified cyclophilin A can be generated by gene editing of the peptidyl prolyl isomerase A (PPIA) gene encoding exon 5. Furthermore, the inventors have found that the modified cyclophilin A confers resistance to immunosuppressant drugs, particularly resistance to cyclosporine and vorticol. This document describes a method for engineering immune cells and preparing engineered immune cells by editing the PPIA to generate the modified cyclophilin A. This document also describes engineered cells and pharmaceutical compositions comprising the gene-edited PPIA gene, and pharmaceutical compositions comprising the cells. Finally, this document describes a method for using the cells and compositions in cell therapy to improve hematopoietic cell transplantation, solid organ transplantation, and the treatment of autoimmune diseases.

[0039] The peptidyl-prolyl isomerase A gene (PPIA) encodes cyclophilin A, a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of the proline imine peptide bond in oligopeptides and accelerate protein folding. Cyclophilin A is a widely distributed protein belonging to the immunophilin family. It is a key binding partner for cyclosporine and vorticol, allowing them to exert their immunosuppressive functions. Cyclophilin A also interacts with several HIV proteins, including p55 gag, Vpr, and capsid proteins, and has been shown to be essential for the formation of infectious HIV virions. The function of cyclophilin A is known to those skilled in the art, see, for example, Nigro P. et al., CellDeath Dis (2013), Satoh K. et al., Circ J., (2010), and Luban J. (2013) Cyclophilin A and HIV-1 Replication. In: Encyclopedia of AIDS, which are incorporated herein by reference.

[0040] The sequences of PPIA / cyclophilin A are known in many species, such as human PPIA (NCBI Gene ID: 5478), mRNA (e.g., NM_021130.5, SEQ ID NO: 1), and polypeptides (e.g., NP_066953.1, SEQ ID NO: 2). Antibodies for specific detection of cyclophilin A are available from, for example, RND Systems; see Human Cyclophilin A Antibody, MAB3589. The typical transcript NM_021130.5 has a total of 5 exons. PPIA can refer to human PPIA, including naturally occurring variants, molecules, and their alleles.

[0041] SEQ ID NO: 1 is the nucleic acid sequence encoding human PPIA variant 1.

[0042] SEQ ID NO: 2 is the amino acid sequence of human PPIA variant 1.

[0043] In one aspect of any embodiment, the present invention describes a method for engineering cells or for preparing engineered cells, the method comprising gene editing the cells by editing the PPIA gene. In some embodiments, the gene editing produces a modified cyclophilic protein A. In some embodiments, the gene editing targets the PPIA gene. In some embodiments, the gene editing targets exon 5 of the PPIA gene.

[0044] In one implementation, the gene editing system is a CRISPR-associated nuclease. CRISPR (clustered regularly spaced short palindromic repeats) Cas9-mediated gene disruption has been widely used to generate loss-of-function mutations in a variety of organisms, including mammals (Cong et al., 2013, Science, 339(6121):819-23; reviewed in Hsu et al., 2014, Cell, 157(6):1262-78). Cas9-based knockout screening has been applied to identify essential genes and genes involved in drug resistance in various cell lines. General information concerning CRISPR-Cas systems, their components, and the delivery of such components (including methods, materials, delivery solvents, carriers, particles, AAVs, and their manufacture and use, including in terms of dosage and formulation) is applicable to the practice of this invention, with reference to the following: U.S. Patent Nos. 8,999,641, 8,993,233, 8,945,839, 8,932,814, 8,906,616, 8,895,308, 8,889,418, 8,889,356, 8,871,445, 8,865,406, 8,795,965, 8,771,945, and 8,697,359; U.S. Patent Publications US 2014-0310830, US 2014-0287938, US 2014-0273234, US 2014-0273232, US 2014-0273231, US 2014-0256046, US 2014-0248702, US2014-0242700, US 2014-0242699, US 2014-0242664, US 2014-0234972, US 2014-0227787, US 2014-0189896, US 2014-0186958, US 2014-0186919, US 2014-0186843, US 2014-0179770 and US 2014-0179006, US 2014-0170753; European patent EP 2 784 162 B1 and EP 2 771468 B1; European patent applications EP 2 771 468 (EP13818570.7), EP 2 764 103 (EP13824232.6) and EP2 784 162 (EP14170383.5); and international application number WO 2014 / 093661, all of which are incorporated herein by reference in their entirety.

[0045] Any CRISPR-related nuclease can be used in the systems and methods of this invention. CRISPR nuclease systems are known to those skilled in the art, such as Cas9, Cas12, Cas12a, etc., see patents / patent applications 8,993,233, US2015 / 0291965, US 2016 / 0175462, US 2015 / 0020223, US 2014 / 0179770, 8,697,359; 8,771,945; 8,795,965; WO 2015 / 191693; US 8,889,418; WO 2015 / 089351; WO 2015 / 089486; WO2016 / 028682; WO 2016 / 049258; WO 2016 / 094867; WO 2016 / 094872; WO 2016 / 094874; WO2016 / 112242; US 2016 / 0153004; US 2015 / 0056705; US 2016 / 0090607; US 2016 / 0029604; 8,865,406; 8,871,445; each is incorporated herein by reference in its entirety. The nuclease can also be a bacteriophage Cas nuclease, such as CasΦ (e.g., Pausch et al., Science 369:333-7 (2020); which is incorporated herein by reference in its entirety).

[0046] In these methods, the Cas protein and one or more guide RNAs can be on the same or different vectors of the system and integrated into each cell, whereby each guide sequence targets a sequence within a contiguous genomic region in each cell of the cell population. The Cas protein is operatively linked to a regulatory element to ensure expression in the cells, more specifically, a promoter suitable for expression within the cells of the cell population. In a particular embodiment, the promoter is an inducible promoter, such as a doxycycline-inducible promoter. When transcribed within the cells of the cell population, the guide RNA containing the guide sequence directs the CRISPR-Cas system to bind specifically to the target sequence within the contiguous genomic region. Typically, binding to the CRISPR-Cas system induces cleavage of the Cas protein within the contiguous genomic region.

[0047] The full-length guide nucleic acid chain can be of any length. For example, the length of the guide nucleic acid chain can be about or greater than about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides. In some embodiments of the various aspects described herein, the length of the nucleic acid chain is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides. For example, the guide nucleic acid sequence is 10-30 nucleotides long. In some embodiments of the various aspects described herein, the guide nucleic acid sequence is 20 nucleotides long.

[0048] In addition to the sequence complementary to the target nucleic acid, in some embodiments, the guide nucleic acid (gNA) also includes a scaffold sequence. Expression of the gNA encoding both the target nucleic acid complementary sequence and the scaffold sequence has a dual function: binding (hybridizing) to the target nucleic acid and recruiting endonucleases to the target nucleic acid, thus generating site-specific CRISPR activity. In some embodiments, this chimeric gNA may be referred to as a single guide RNA (sgRNA).

[0049] In some embodiments of the various aspects described herein, the guide nucleic acid is designed using a wizard design tool (e.g., Benchling). TM Broad Institute GPP TM CasOFFinder TM CHOPCHOP TM CRISPOR TM Deskgen TM E-CRISP TM Geneious TM GenHub TM GUIDES TM (For example, for library design); HorizonDiscovery TM IDT TM Off-Spotter TM ; and Synthego TM (It is designed to be available on the World Wide Web.)

[0050] As described herein, the gene editing system is used to specifically target sequences within a contiguous genomic region of interest. This targeting typically involves introducing a vector system containing one or more vectors into each cell of a cell population. This vector system comprises an engineered, non-naturally occurring CRISPR-Cas system, which includes at least one Cas protein and one or more guide RNAs.

[0051] This article anticipates the use of the Cas9 / CRISPR system for genome editing in conjunction with the methods, cells, and compositions described herein. Clustered regularly spaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) systems are useful for RNA-programmable genome editing (see, for example, Jinek, M. et al., Science (2012) 337(6096):816-821).

[0052] Trans-activating crRNA (tracrRNA) is a small trans-coding RNA. It was first discovered in the human pathogen *Streptococcus pyogenes*. (See Deltcheva E et al. (2011). *Nature* 471(7340): 602-7). In bacteria and archaea, CRISPR / Cas (clustered regularly spaced short palindromic repeats / CRISPR-associated proteins) constitute an RNA-mediated defense system against viruses and plasmids. This defense pathway has three steps. First, a copy of the invading nucleic acid is integrated into a CRISPR locus. Next, CRISPRRNA (crRNA) is transcribed from this CRISPR locus. Then, the crRNA is incorporated into an effector complex, where the crRNA guides the complex to the invading nucleic acid, which is then degraded by the Cas protein. (See, for example, Terns MP and Terns RM (2011). *Curr Opin Microbiol* 14(3): 321-7). CRISPR activation occurs via several pathways, one of which requires tracrRNA, which plays a role in the maturation of crRNA. TracrRNA is complementary to and base-pairs with the precursor crRNA to form an RNA double strand. This double strand is cleaved by the RNA-specific ribonuclease RNase III to form a crRNA / tracrRNA hybrid. This hybrid acts as a guide for the endonuclease Cas9, which cleaves invading nucleic acids. (See, for example, Deltcheva E et al.; Jinek M et al. (2012), Science 337(6096): 816-21; and Brouns SJ (2012), Science 337(6096): 808-9).

[0053] In some embodiments of the various aspects described herein, the guide nucleic acid is designed to target the PPIA gene.

[0054] In some embodiments of the various aspects described herein, the guide nucleic acid targets exon 5 of the PPIA gene.

[0055] In some embodiments described herein, the guide nucleic acid targets exon 5 of the PPIA gene and produces a modified cyclophilin A gene product. The sequence of exon 5 is as follows:

[0056] In some embodiments of the various aspects described herein, the guide nucleic acid targeting sequence is GGTTTGGCAAAGTGAAAGA (SEQ ID NO: 4).

[0057] In some embodiments, the gene editing produces a modified gene product. In some embodiments, the gene editing produces a modified cyclophilic protein A. In some embodiments, the gene editing produces a modified gene product but does not affect protein expression. In some embodiments, the gene editing produces a functional gene product. In some embodiments, the gene editing has no negative impact on cellular function (i.e., T cell function).

[0058] As used herein, "modified" refers to an alteration of the product (e.g., cyclophilin A) such that the amino acid sequence differs from the native sequence (e.g., a sequence naturally present in cells). In some embodiments, the gene editing results in a frameshift, such as a frameshift in the PPIA gene. In some embodiments, the gene editing results in a frameshift in exon 5 of the PPIA gene. In some embodiments, the modified gene product (e.g., cyclophilin A) has altered residues near its C-terminus. In some embodiments, the modified gene product is truncated. In some embodiments, "modified" refers to truncated.

[0059] In some embodiments, the methods described herein produce engineered cells resistant to cyclosporine and vorticol.

[0060] As a result of gene editing, at least 10% (optionally, at least 20%, preferably at least 50%, such as 70%, at least 90%, at least 99%, or most preferably 100%) of the population of cells are resistant to the effects of immunosuppressants that can interact with cyclic protein A.

[0061] In some embodiments, gene editing is achieved using DNA-targeting molecules, such as DNA-binding proteins or DNA-binding nucleic acids, or complexes, compounds, or compositions containing them, that specifically bind to or hybridize to the gene, such as PPIA. In some embodiments, the DNA-targeting molecule comprises a DNA-binding domain, such as a zinc finger protein (ZFP) DNA-binding domain, a transcription activator-like protein (TAL) or TAL effector (TALE) DNA-binding domain, a clustered regularly spaced short palindromic repeat (CRISPR) DNA-binding domain, or a DNA-binding domain derived from a large number of meganucleases. Zinc finger, TALE, and CRISPR system binding domains can be engineered to bind to predetermined nucleotide sequences, for example, by engineering the recognition helical region of naturally occurring zinc finger or TALE proteins (by altering one or more amino acids). The engineered DNA-binding protein (zinc finger or TALE) is a non-naturally occurring protein. Reasonable design criteria include applying substitution rules and computer algorithms to process information in a database containing information on existing ZFP and / or TALE designs and binding data. See, for example, U.S. Patent Nos. 6,140,081; 6,453,242; and 6,534,261; also see WO 98 / 53058; WO 98 / 53059; WO 98 / 53060; WO 02 / 016536 and WO 03 / 016496 and U.S. Publication No. 2011 / 0301073.

[0062] In one embodiment, the engineered cell is an immune cell. For example, in some embodiments of the methods described herein, the cell type engineered to genetically edit cyclophilin A is an immune cell. As used herein, "immune cell" refers to a cell that plays a role in an immune response. Immune cells originate from the hematopoietic system and include lymphocytes (such as B cells and T cells); natural killer cells; myeloid cells (such as monocytes, macrophages, eosinophils, mast cells, basophils, and granulocytes). In some embodiments, the cell is a T cell; NK cell; NKT cell; lymphocytes (such as B cells and T cells); and myeloid cells (such as monocytes, macrophages, eosinophils, mast cells, basophils, and granulocytes). In some embodiments, the cell is a T cell. Those skilled in the art will be able to isolate and engineer immune cells using standard techniques in the art and described herein.

[0063] As used herein, "T cell" refers to a class of white blood cells that play an important role in the body's immune defense. Methods for identifying T cells include, but are not limited to, flow cytometry for assessing T cell-specific cell surface markers. T cell surface markers are known in the art and include, but are not limited to, CD3, CD8, CD4, CXCR3, CD25, CD28, CD127, CD152, and FoxP3. Various types of T cells are known in the art. These types include, but are not limited to, CD3... + T cells, CD5 + T cells, CD4 + CD8 + T cells, CD4 + CD8 - T cells, CD4 - CD8 + T cells, CD8 + T cells, T cell receptor (TCR) ab + T cells, TCRgd + T cells, NKT cells, CD27 + Lymphocytes, CD19 + B cells, CD20 + B cells, CD56 + NK cells, or CD16 + NK cells.

[0064] As used herein, the term “isolated cells” refers to the selective isolation or enrichment of target cells, cell types, or cell categories from a sample containing other cells, cell types, or cell categories, such that the resulting cell population has a high degree of cell purity, as determined by specific cell markers (e.g., CD8a for CD8-positive T cells or B cells).

[0065] While a higher degree of cell purity is preferred over a lower degree of purity, the term "isolated" as used herein does not require the resulting cell population to be 100% pure. Target cells (e.g., immune cells) or their cell population will generally be considered "isolated" as used herein if they contain at least 60% (e.g., CD-3 / 28 positive cells) of the target cell population produced by the isolation methods described herein, and preferably at least 70%, at least 80%, at least 90% or more. In some embodiments, the isolated cells are pan-T cells.

[0066] T cells are typically isolated from peripheral blood mononuclear cells (PBMCs) collected via leukapheresis. Major methods for T cell isolation on a clinical scale include (i) selecting T cell populations from immune-depleted, unwanted cells (e.g., proliferating cells or cancer cells) using antibody-conjugated magnetic beads (e.g., CliniMACS), and (ii) “scarless” selection using Streptamer technology, which is based on antigen-binding fragment (Fab) constructs immobilized on magnetic beads.

[0067] Methods for identifying and isolating specific types of T cells are known in the art, such as evaluating cell surface markers on T cells that distinguish T cell types (e.g., as described above).

[0068] In some embodiments, this document provides a method for preparing engineered human immune cells, the method comprising: (a) isolating immune cells or T cells from a subject; (b) stimulating the immune cells or T cells with an antibody, a viral antigen, an antigen from another pathogen, or a cancer antigen; (c) isolating the stimulated immune cells or T cells based on the expression of a marker to obtain a composition of selected immune cells or T cells; (d) genetically editing the cells of the composition by introducing a ribonucleoprotein complex comprising Cas and sgRNA targeting PPIA to edit the PPIA gene encoding cyclophilin A; and (e) screening the engineered cells by culturing the cells in the presence of an immunosuppressant capable of interacting with cyclophilin A.

[0069] In some embodiments, the antibody used to stimulate T cells binds to a T cell-specific marker. In some embodiments, the antibody is an anti-CD3 and / or anti-CD28 antibody.

[0070] In some embodiments, the cells may be immune effector cells (IECs). As used herein, an "immune effector cell" is a cell capable of generating an immune response in vivo. Examples of immune effector cells include, but are not limited to, chimeric antigen receptor (CAR) T cells and antigen-specific T cells that target viruses, fungi, and / or bacteria.

[0071] In some embodiments, the cells may be T cells specific to viruses, other pathogens, or cancer antigens. For example, the T cells may be virus-specific T cells. The viruses may be, but are not limited to, viruses selected from the group consisting of: CMV, EBV, BKV, HPV, ADV, influenza virus, parvovirus, rubella virus, hepatitis viruses (HBV, HCV, HAV, HDV, HEV), Coxsackie virus, respiratory syncytial virus (RSV), and coronaviruses (e.g., but not limited to: MERS, SARS-CoV-1, and SARS-CoV-2). The T cells may also be multi-virus-specific T cells, such as T cells activated and selected by adding antigens from multiple viruses.

[0072] In another embodiment of the invention, the cell is a regulatory T cell, preferably a CD4 cell. + CD25 + Regulatory T cells, optionally CD4 + CD25 + CD127 - Regulatory T cells. They can be regulatory T cell products composed of a polyclonal library or regulatory T cell products that are specific to a specific antigen (such as a certain allogeneic MHC molecule, an autoantigen, or a virus (such as MERS, SARS-CoV1, and SARS-CoV-2)).

[0073] Chimeric antigen receptors (CARs) are recombinant proteins that allow T cells to be modified to express them, thereby recognizing specific proteins (antigens) on tumor cells. T cells engineered to express CARs (called CAR T cells) are expanded in the laboratory and given the ability to target desired targets. In some embodiments, the CAR T cells are infused into a subject in need. After infusion, the T cells proliferate in the subject and, guided by their engineered receptors, recognize and kill cells displaying antigens on their surface. Methods for engineering chimeric antigen receptor T cells (also known as CAR T cells) are known in the art. See, for example, U.S. Patents US7446190, US8399645, US8822647, US9212229, US9273283, US9447194, US9587020, US9932405, US10125193, US10221245, US10273300, US10287354; U.S. Patent Publication US20160152723; PCT Publications WO2009091826, WO201207900 0, WO2014165707, WO2015164740, WO2016168595A1, WO2017040945, WO2017100428, WO2017117112, WO2017149515, WO2018067992, WO2018102787, WO2018102786, WO2018165228, WO2019084288; The contents of each of these references are incorporated herein by reference in their entirety.

[0074] In some embodiments, methods for genetically modifying cells to express CAR may include, but are not limited to: transfecting or electroporating cells with a vector encoding CAR; transducing with a viral vector encoding CAR (e.g., retrovirus, lentivirus); gene editing using zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), large-scale nuclease-TALENs, or CRISPR-Cas; or any other method known in the art for genetically modifying cells to express CAR.

[0075] In one embodiment, the cells are obtained directly from the subject to be treated (i.e., autologous transplantation). In another embodiment, the transplantation can be non-autologous or allogeneic. As used herein, "allogeneic" refers to cells (e.g., CAR T cells) obtained from one or more different donors of the same species, wherein the genes at one or more loci are different. For example, the cell composition administered to the subject may be derived from umbilical cord blood obtained from one or more unrelated donor subjects, or from one or more non-identical siblings. In some embodiments, syngeneic cell populations may be used, such as cell populations obtained from genetically identical animals or from identical twins. In other embodiments of this aspect, the cells are autologous cells; that is, the cells are obtained from or isolated from the subject and administered to the same subject, i.e., the donor and recipient are the same person.

[0076] In some implementations, the antigen-binding region of the CAR targets an antigen associated with a disease or condition (such as, but not limited to, cancer, autoimmune disease, or heart disease).

[0077] For non-autologous transplantation, it is preferable to administer immunosuppressive drugs to the recipient to reduce the risk of transplanted cell rejection. Methods of cell administration include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, and epidural routes. The cells can be administered via any convenient route and can be administered in combination with other bioactive agents. Intravenous administration is preferred. The titer of therapeutic cells to be transplanted or administered and which will effectively treat a specific disease or condition will depend on the nature of the disease or condition and can be determined using standard clinical techniques. Additionally, in vitro assays may optionally be used to help determine the optimal dose range. The precise dose to be used in the formulation will also depend on the route of administration and the severity of the disease or condition, and should be determined based on the practitioner's judgment and the individual subject's circumstances.

[0078] In some respects, the methods provided herein include administering engineered cells to a subject. As described herein, the engineered cell composition may be administered according to any method known in the art, or may be incorporated into pharmaceutical compositions suitable for administration to a subject, for example, for in vivo delivery to a subject's tissues or organs.

[0079] The dosage range of therapeutic cell compositions includes amounts sufficient to produce the desired effect (e.g., treatment of a disease or its symptoms). The dosage should not be excessive, causing unacceptable adverse side effects. Typically, the dosage will vary depending on the specific characteristics of the therapeutic cell composition and the patient's age, condition, and sex. The dosage can be determined by someone skilled in the art and, unlike conventional cell therapies, can also be adjusted by an individual physician in case of any complication events.

[0080] In some embodiments, the therapeutic cell composition is delivered repeatedly or over a limited time period. In some embodiments, the dose is administered once daily or multiple times daily. The duration of treatment depends on the subject's clinical progress and response to the therapy.

[0081] Compositions containing therapeutic cell populations can be delivered to target cells or tissues via surgical implantation, intravenous administration, intra-arterial administration, intraperitoneal administration, limb perfusion (optionally, perfusion of isolated limbs of the leg and / or arm; see, for example, Arruda et al., (2005) Blood 105: 3458-3464) and / or direct intramuscular injection. Administration to muscles (e.g., the diaphragm) can be performed by any suitable method, including intravenous, intra-arterial, and / or intraperitoneal administration.

[0082] In some embodiments, this document provides engineered immune cell populations generated by the methods described herein, wherein the cells are gene-edited to produce modified cyclophilic protein A. In some embodiments, the cell population further comprises a pharmaceutically acceptable vector. These engineered immune cells can be cultured and expanded to increase the number of cells available for use.

[0083] In some implementations, the engineered immune cells described herein are useful in cell therapy and other medical treatments for subjects in need. For example, patients requiring cell or organ transplantation, particularly when the subject is also receiving immunosuppressants. Alternatively, the engineered immune cells described herein are useful in laboratories for biological research.

[0084] In some embodiments, this document provides methods for treating subjects in need, such as for treating cancer, autoimmune diseases, hematological disorders, or other genetic diseases and conditions in subjects.

[0085] Hematologic disorders are conditions that primarily affect the blood. Non-restrictive categories of these disorders or conditions include bone marrow-derived conditions such as hemoglobinopathies (congenital abnormalities in hemoglobin molecules or the rate of hemoglobin synthesis), examples of which include sickle cell disease, thalassemia, and methemoglobinemia; anemia (lack of red blood cells or hemoglobin), pernicious anemia; conditions that reduce cell counts, such as myelodysplastic syndromes, neutropenia (a decrease in the number of neutrophils), and thrombotic thrombocytopenic purpura (TTP); thrombocytosis; and hematologic malignancies such as lymphoma, myeloma, and leukemia. Lymphomas such as Hodgkin's disease, non-Hodgkin's lymphoma, Burkitt lymphoma, anaplastic large cell lymphoma, splenic marginal zone lymphoma, hepatosplenic T-cell lymphoma, and angioimmunoblastic T-cell lymphoma (AILT); myelomas such as multiple myeloma, Waldenström macroglobulinemia, and plasmacytoma; leukemias with increased defective white blood cells such as acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), acute myeloid leukemia (AML), chronic idiopathic myelofibrosis (MF), chronic myeloid leukemia (CML), T-cell prolymphocytic leukemia (T-PLL), B-cell prolymphocytic leukemia (B-PLL), chronic neutrophilic leukemia (CNL), hairy cell leukemia (HCL), T-cell large granular lymphocytic leukemia (T-LGL), and aggressive NK cell leukemia.

[0086] In some embodiments, one or more additional compounds may also be included in the therapeutic cell composition (i.e., a population of cells having modified cyclophilic protein A) to alleviate symptoms of disease or otherwise assist or support the function of the applied cells.

[0087] This document describes a method for treating autoimmune diseases, comprising administering to a patient in need an effective amount of immune cells or populations thereof, or combinations thereof, or pharmaceutical compositions as described herein. "Autoimmune disease" refers to a class of diseases in which antibodies of the subject react with host tissues, or in which immune effector T cells are autoreactive to endogenous autopeptides and cause tissue destruction. Thus, an immune response is generated against the subject's own antigens (called autoantigens). As used herein, "autoantigen" refers to antigens of normal host tissues. Normal host tissues do not include tumor cells.

[0088] Non-limiting examples of treatable autoimmune diseases include pemphigus (pemphigus vulgaris, pemphigus foliaceus, or paraneoplastic pemphigus), Crohn's disease, idiopathic thrombocytopenic purpura (ITP), heparin-induced thrombocytopenia (HIT), thrombotic thrombocytopenic purpura (TTP), myasthenia gravis (MG), and chronic inflammatory demyelinating polyneuropathy (CIDP). Other non-restrictive autoimmune diseases include autoimmune thrombocytopenic purpura, immune neutropenia, antihemophilic factor FVIII inhibitors, antiphospholipid syndrome, Kawasaki syndrome, ANCA-related diseases, polymyositis, bullous pemphigoid, multiple sclerosis (MS), Guillain-Barré syndrome, chronic polyneuropathy, ulcerative colitis, diabetes, autoimmune thyroiditis, Graves' ophthalmopathy, rheumatoid arthritis, ulcerative colitis, primary sclerosing cholangitis, systemic lupus erythematosus (SLE), autoimmune encephalomyelitis, Hashimoto's thyroiditis, Goodpasture syndrome, autoimmune hemolytic anemia, scleroderma with anti-collagen antibodies, mixed connective tissue disease, pernicious anemia, idiopathic Addison's disease, autoimmune-related infertility, glomerulonephritis (e.g., crescentic glomerulonephritis, proliferative glomerulonephritis), insulin resistance, and autoimmune diabetes (type 1 diabetes; insulin-dependent diabetes). Autoimmune diseases are also considered to encompass atherosclerosis and Alzheimer's disease. In another embodiment, autoimmune diseases include hepatitis, autoimmune hemophilia, autoimmune lymphoproliferative syndrome (ALPS), autoimmune uveitis, glomerulonephritis, agammaglobulinemia, alopecia areata, amyloidosis, ankylosing spondylitis, autoimmune angioedema, autoimmune aplastic anemia, autoimmune autonomic dysfunction, autoimmune hyperlipidemia, autoimmune immunodeficiency, autoimmune inner ear disease (AIED), autoimmune myocarditis, autoimmune pancreatitis, autoimmune retinopathy, autoimmune urticaria, autoimmune urticarial neuropathy, autoimmune axonal neuropathy, Barlow's disease, Behcet's disease, and Kassym-Jowls disease. Hermann's disease, celiac disease, Chagas disease, chronic relapsing multifocal osteomyelitis (CRMO), Churg-Strauss syndrome, cicatricial pemphigoid, benign mucosal pemphigoid, Cogan syndrome, cold agglutinin disease, Coxsackie myocarditis, CREST disease, primary mixed cryoglobulinemia, herpetic dermatitis, dermatomyositis, Dervec disease (neuromyelitis optica), dilated cardiomyopathy, discoid lupus, Dereskir syndrome, endometriosis, eosinophilic angiocentric fibrosis, eosinophilic fasciitis, erythema nodosum, Evans syndrome, fibrotic alveolitis, giant cell arteritis (temporal arteritis), Hashimoto's encephalitis, Henoch-Schonlein purpura.purpura), herpes gestationis, idiopathic hypocomplementemic tubulointerstitial nephritis, multiple myeloma, multifocal motor neuropathy, NMDA receptor antibody encephalitis, IgG4-related disease, IgG4-related sclerotic disease, inflammatory aortic aneurysm, inflammatory pseudotumor, inclusion body myositis, interstitial cystitis, juvenile arthritis, Kuttner tumor, Lambert-Eaton syndrome, leukocytic clotting vasculitis, lichen planus, sclerosing lichen, woody conjunctivitis, linear IgA disease (LAD), and more. Mumtitis, chronic mediastinal fibrosis, Meniere's disease, microscopic polyangiitis, Mikulicz syndrome, Mooren's ulcer, Mucha-Habermann disease, multifocal fibrosis, narcolepsy, optic neuritis, Ormond's disease (retroperitoneal fibrosis), relapsing rheumatism, PANDAS (streptococcal-associated childhood autoimmune neuropsychiatric disorder), paraneoplastic cerebellar degeneration, paraproteinemic polyneuropathy, paroxysmal nocturnal hemoglobinuria (PNH), Parry Romberg syndrome, Parsonnage-Turner syndrome, periaorticitis, periarteritis, peripheral neuropathy, perivenous encephalomyelitis, POEMS syndrome, polyarteritis nodosa, type I, II and III autoimmune polyglandular syndrome, polymyalgia rheumatica, post-pericardiotomy syndrome, progesterone dermatitis, primary biliary cirrhosis, psoriasis, psoriatic arthritis, idiopathic pulmonary fibrosis, pyoderma gangrenosa, pure red cell aplasia, Raynaud's phenomenon, reflex sympathetic dystrophy, Reiter's syndrome, relapsing polychondritis, restless legs syndrome, rheumatic fever, Riedle's thyroiditis Thyroiditis, sarcoidosis, Schmidt syndrome, scleritis, Sjögren's syndrome, sperm and testicular autoimmunity, stiff-person syndrome, subacute bacterial endocarditis (SBE), Susac syndrome, sympathetic ophthalmia, aortitis, Tolosa-Hunt syndrome, transverse myelitis, undifferentiated connective tissue disease (UCTD), bullous dermatosis, vitiligo, Rasmussen encephalitis, Waldenstrom macroglobulinemia.

[0089] In various embodiments, the engineered immune cells described herein are optionally expanded in vitro prior to administration to a subject. In other embodiments, the engineered immune cells are optionally cryopreserved for a period of time and then thawed prior to administration to a subject.

[0090] In some embodiments, the additional compound may be a therapeutic agent. The therapeutic agent can be selected from any category suitable for the therapeutic purpose. In other words, the therapeutic agent can be selected based on the therapeutic purpose and the desired biological effect. Furthermore, the active ingredient of the therapeutic agent may be mixed with optional pharmaceutical additives, such as pharmaceutically acceptable excipients or carriers compatible with the active ingredient.

[0091] In one embodiment, the term "effective amount" as used herein refers to the amount of therapeutic cell population (e.g., those cells having modified cyclophilic protein A) required to alleviate at least one or more symptoms of a disease (e.g., an autoimmune disease), and relates to an amount of composition sufficient to provide the desired effect (e.g., treating a subject with a disease such as an autoimmune disease). Therefore, the term "therapeutic effective amount" refers to an amount of therapeutic cells or a composition thereof sufficient to promote a specific effect when administered to a typical subject (e.g., a subject with an autoimmune disease or at risk of such a disease). An effective amount as used herein may also include an amount sufficient to prevent or delay the development of disease symptoms, alter the course of disease symptoms (e.g., but not limited to, slowing the progression of disease symptoms), or reverse disease symptoms. It should be understood that, for any given situation, a person skilled in the art can determine an appropriate "effective amount" using routine experiments.

[0092] As used herein, “administration” means the delivery of a composition comprising therapeutic cells as described herein to a subject by a method or route that causes at least a portion of the cellular composition to be located at a desired site. The cellular composition may be administered by any suitable route that causes effective treatment in the subject, i.e., administration such that it is delivered to the subject at a desired location, where at least a portion of the composition is delivered to the desired site for a period of time. Administration methods include injection, infusion, drip, or ingestion. “Injection” includes, but is not limited to, intravenous, intramuscular, intraarticular, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, tracheal, subcutaneous, subepidermal, intra-articular, subcapsular, subarachnoid, intraspinal, intracerebrospinal, and intrasternal injection and infusion. For the delivery of therapeutic cells or compositions thereof, administration by injection or infusion is generally preferred.

[0093] In one implementation, the therapeutic cells described herein are administered systemically. As used herein, the phrases “systemic administration,” “via systemic administration,” “peripheral administration,” and “via peripheral administration” mean that the administration of the therapeutic cell population is not directly applied to a target site, tissue, or organ, but rather that it enters the subject’s circulatory system and is thus subjected to metabolism and other similar processes.

[0094] A skilled clinician can determine the therapeutic efficacy of a treatment comprising the therapeutic cell composition described herein for a given disease. However, a treatment is considered “effective” as used herein if any or all signs or symptoms of the disease change in a beneficial manner, or if other clinically accepted disease symptoms or markers improve or are alleviated, for example, by at least 10% improvement after treatment with the therapeutic cell. Efficacy can also be measured by the individual’s lack of deterioration (e.g., cessation or at least slowing of disease progression), which is assessed by hospitalization or the need for medical intervention. Methods for measuring these indicators are known to those skilled in the art and / or described herein. Treatment includes any treatment of a disease in an individual or animal (some non-limiting examples include humans or mammals) and includes: (1) suppressing the disease, such as preventing or slowing the progression of a given disease; or (2) alleviating the disease, such as causing symptom relief; and (3) preventing or reducing the likelihood of disease progression.

[0095] Following in vitro or ex vivo cell culture, isolation, or differentiation as described herein, isolated or enriched therapeutic cells are prepared for treatment and / or implantation. The cells are suspended in a physiologically compatible carrier, such as cell culture medium (e.g., Eagle's minimum essential medium), phosphate-buffered saline, or T-cell specific medium. The volume of the cell suspension to be implanted will vary depending on the implantation site, therapeutic target, and cell density in the solution.

[0096] Those skilled in the art will understand that the cell composition used to treat a given disease does not need to be a pure, homogeneous culture, such as a pure, homogeneous culture of therapeutic cells having modified cyclophilic protein A. Therefore, in one embodiment, the applied composition comprises at least 2% therapeutic cells. In other embodiments, the composition comprises at least 3%, at least 4%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or more of the therapeutic cells as described herein.

[0097] Cells can be administered to a subject via any suitable route that delivers the therapeutic cells to a desired location in the subject, where at least a portion of the cells remain viable. Preferably, at least 5% remain viable. In other embodiments, at least 10%, at least 20%, at least 30%, at least 40%, or at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% or more of the therapeutic cells remain viable after administration to the subject. The survival time of the therapeutic cells after administration to the subject can range from a few hours (e.g., 24 hours) to a few days, or from a few weeks to a few months.

[0098] To accomplish these administration methods, the therapeutic cell composition can be inserted into a delivery device that facilitates the introduction of the therapeutic cells into a subject by injection or implantation. Typically, the therapeutic cells are injected as a cell suspension into the target area. Alternatively, when contained in such a delivery device, the cells can be embedded in a solid or semi-solid support matrix.

[0099] In some embodiments, the composition containing therapeutic cells is repeatedly applied after given time intervals (e.g., one day, three days, one week, two weeks, three weeks, one month, or more). Treatment may be repeated as needed, for example, to establish or maintain the transplantation threshold level necessary for continued effective treatment. In some embodiments, the method is repeated two, three, four, five, or more times.

[0100] As used herein, a surface marker that is “specific” to a target cell, cell fraction, or cell population of interest is a polypeptide or other molecule expressed on the surface of the target cell or cell fraction that is unique to that target cell or cell fraction and thus allows for the identification and isolation of that cell or cell fraction using the methods described herein. In some embodiments, a single surface marker is sufficient to identify the target cell, for example, CD8a to identify CD8+. + T cells. In other embodiments, two or more markers may be used together to identify target cells, cell populations, or fractions. In other embodiments, a single marker may be used to identify a class of target cells. In other embodiments, cell surface markers may be membrane lipids, peptides, polypeptides, or proteins.

[0101] As used herein, the term "treatment" includes reducing or alleviating at least one adverse effect or symptom of a condition, disease, or ailment (e.g., cancer). For example, the term "treatment" refers to administering an effective amount of a composition, such as engineered cells of PPIA as described herein, to a subject, resulting in a reduction or improvement of at least one symptom of the subject's disease, such as a beneficial or desired clinical outcome. For the purposes of this disclosure, beneficial or desired clinical outcomes include, but are not limited to: reduction of one or more symptoms, reduction of disease extent, disease stabilization (e.g., no worsening), delay or slowing of disease progression, improvement or mitigation of disease status, and remission (whether partial or complete), whether detectable or undetectable. In some embodiments, treatment may refer to prolonged survival compared to expected survival without treatment. Therefore, those skilled in the art will recognize that treatment may improve a disease condition but may not completely cure the disease. Successful treatment can also be assessed by other indicators such as reduced need for medical intervention, reduced visits to hospitals or emergency rooms, reduced fatigue, or improved quality of life. In some embodiments, treatment may include prevention. However, in alternative embodiments, treatment does not include prevention.

[0102] The phrase “pharmaceutically acceptable” as used in this article means those compounds, materials, compositions, and / or dosage forms that, to a reasonable extent of medical judgment, are suitable for use in human and animal tissues without excessive toxicity, irritation, allergic reactions, or other problems or complications, in proportion to a reasonable benefit / risk ratio.

[0103] As used herein, the terms “pharmaceutically acceptable,” “physiologically tolerable,” and their grammatical variations are used interchangeably when referring to compositions, carriers, diluents, and reagents, and indicate that the material can be administered to or on mammals without producing undesirable physiological effects such as nausea, dizziness, stomach upset, etc. Unless this is desired, a pharmaceutically acceptable carrier will not promote an immune response to a reagent mixed with it. The preparation of pharmacological compositions containing an active ingredient dissolved or dispersed therein is well understood in the art and is not limited to formulations. Typically, such compositions are prepared as injectable, such as liquid solutions or suspensions; however, they may also be prepared in solid form, suitable for dissolution or suspension in a liquid prior to use. Formulations may also be emulsified or presented as liposome compositions. The active ingredient may be mixed with pharmaceutically acceptable and compatible excipients, and in amounts suitable for use in the treatment methods described herein. Suitable excipients include, for example, water, saline, dextran, glycerol, ethanol, etc., and combinations thereof. Furthermore, the composition may, if desired, contain small amounts of excipients, such as wetting agents or emulsifiers, pH buffers, etc., which enhance the effectiveness of the active ingredient. Therapeutic compositions as described herein may comprise pharmaceutically acceptable salts of their components. Pharmaceutically acceptable salts include acid addition salts (formed from the free amino groups of polypeptides) formed with inorganic acids (e.g., hydrochloric acid or phosphoric acid) or such organic acids (e.g., acetic acid, tartaric acid, mandelic acid, etc.). Salts formed with free carboxyl groups may also be derived from inorganic bases (e.g., sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide, or iron hydroxide) and such organic bases (e.g., isopropylamine, trimethylamine, 2-ethylaminoethanol, histidine, procaine, etc.). Physiologically tolerable carriers are well known in the art. Exemplary liquid carriers are sterile aqueous solutions containing no substances other than the active ingredient and water, or containing buffers (e.g., sodium phosphate at physiological pH), physiological saline, or both (e.g., phosphate-buffered saline). Furthermore, aqueous carriers may contain more than one buffer salt, as well as salts (e.g., sodium chloride and potassium chloride), dextrose, polyethylene glycol, and other substances. In addition to water, and where water is excluded, the liquid composition may also contain a liquid phase. Examples of such additional liquid phases are glycerol, vegetable oils (e.g., cottonseed oil), and water-oil emulsions. The amount of active agent that will be effective in the treatment of a particular condition or disease when used with the methods described herein will depend on the nature of the condition or disease and can be determined using standard clinical techniques.

[0104] In some embodiments, the composition of the engineered immune cells further comprises a pharmaceutically acceptable carrier.

[0105] As used herein, the term "subject" includes both humans and mammals. The term "mammal" is intended to encompass both the singular and plural forms of "mammal," and includes, but is not limited to, humans; primates such as apes, monkeys, orangutans, and chimpanzees; canines such as dogs and wolves; felines such as cats, lions, and tigers; equines such as horses, donkeys, and zebras; edible animals such as cattle, pigs, and sheep; ungulates such as deer and giraffes; rodents such as mice, rats, hamsters, and guinea pigs; and bears. In some preferred embodiments, the mammal is a human. Subjects can be of any age, including newborns, infants, children, adolescents, adults, or elderly subjects.

[0106] Subjects who are “in need” for treatment of a specific condition can be subjects who have the condition, have been diagnosed with the condition, or are at risk of developing the condition.

[0107] In some implementations, the subject is a patient, such as one requiring immunosuppression, for example due to transplantation or another unwanted immune response, such as autoimmunity, allergy, or nonspecific immunopathology. The patient may already be immunosuppressed or may be scheduled for immunosuppression in the future (e.g., after sample collection). However, the subject can also be a healthy subject.

[0108] In some embodiments, an immunosuppressant is also administered to the subject. In some embodiments, a calcineurin inhibitor is also administered to the subject. In some embodiments, cyclosporine or vorticol is also administered to the subject.

[0109] As used herein, the term “comprising” refers to compositions, methods and their respective components that are essential to the claimed technology, but is open to including unspecified elements, whether or not such elements are essential.

[0110] As used herein, the term "consisting essentially of" refers to those elements required for a given implementation. This term allows for the presence of additional elements that do not substantially affect the basic, novel, or functional features of that implementation of the invention.

[0111] The term "consisting of" refers to the compositions, methods, and their respective components described herein, excluding any elements not listed in the description of this embodiment.

[0112] Unless the context clearly specifies otherwise, as used in this specification and the appended claims, the singular forms “a / an” and “the” include plural references. Thus, for example, references to “the method” include one or more methods and / or steps of the type described herein, and / or methods and / or steps that will become apparent to those skilled in the art upon reading this disclosure, etc.

[0113] Unless otherwise stated in the operational examples or elsewhere, all figures used herein to represent amounts of components or reaction conditions should be understood to be modified by the term “about” in all cases. When used with percentages, “about” may mean ±1%.

[0114] As used herein, the term "cell" refers to a single cell as well as a cell population (i.e., more than one cell). A population can be a homogeneous population containing only one cell type, such as an engineered population of immune cells. As used herein, the term "population" refers to a homogeneous population or a population containing one cell type as the majority (e.g., at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%). Alternatively, the population can contain more than one cell type, such as a mixed cell population. This is not intended to limit the number of cells in a population; for example, a mixed cell population can contain at least one differentiated cell type. In this invention, there is no limitation on the number of cell types that a mixed cell population can contain.

[0115] As used herein, the term "isolated" means placing cells in conditions outside their natural environment. The term "isolated" does not preclude the subsequent use of these cells in combination or mixture with other cells.

[0116] As used herein, “cell surface marker” refers to any molecule expressed on the cell surface. Cell surface expression typically requires molecules to have transmembrane domains. Some molecules that are not normally present on the cell surface can be engineered for expression on the cell surface using recombinant technologies. Many naturally occurring cell surface markers are referred to as “CD” or “differentiation cluster” molecules. Cell surface markers often provide antigenic determinants that antibodies can bind to.

[0117] As used herein, the term "nucleic acid" or "nucleic acid sequence" refers to any molecule, preferably a polymer molecule, that contains units of ribonucleic acid, deoxyribonucleic acid, or the like. Nucleic acids can be single-stranded or double-stranded. A single-stranded nucleic acid can be one strand of denatured double-stranded DNA. Alternatively, it can be a single-stranded nucleic acid not derived from any double-stranded DNA. In one aspect, the nucleic acid can be DNA. In another aspect, the nucleic acid can be RNA. Suitable DNA may include, for example, genomic DNA or cDNA. Suitable RNA may include, for example, mRNA, iRNA, miRNA, siRNA, etc.

[0118] For example, nucleic acids can be selected from the group consisting of: nucleic acids encoding proteins of interest, oligonucleotides, nucleic acid analogs (e.g., peptide nucleic acids (PNAs), pseudo-complementary PNAs (pc-PNAs), and locked nucleic acids (LNAs)). Such nucleic acid sequences include, for example, but not limited to: nucleic acid sequences encoding proteins (e.g., proteins that act as transcriptional repressors), antisense molecules, ribozymes, small repressive nucleic acid sequences (e.g., but not limited to RNAi, shRNAi, siRNA, microRNAi (miRNA)), and antisense oligonucleotides.

[0119] As used herein, the term "engrafting" in relation to the recipient host refers to the initiation of new hematopoietic cells that originate from the engrafted cells and produce healthy hematopoietic stem cells that appear in the recipient's bloodstream at least 10 days after engraftment. Engrafting can occur as early as 10 days post-transplantation, but is more common around 14–20 days.

[0120] The terms “reduction,” “reduced,” or “inhibition” are used herein to refer to a reduction in a statistically significant amount. In some implementations, “reduction” or “inhibition” generally means a reduction of at least 10% compared to a reference level (e.g., in the absence of a given treatment or agent), and may include, for example, a reduction of at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or more. As used herein, “reduction” or “inhibition” does not cover complete inhibition or reduction compared to a reference level. “Complete inhibition” means 100% inhibition compared to a reference level. Reduction is preferably as low as a level acceptable as within the normal range for an individual without a given condition.

[0121] The terms “increased / increase,” “enhancement,” or “activation” are used herein to refer to an increase in a statistically significant amount. In some implementations, the terms “increased,” “enhancement,” or “activation” may mean an increase of at least 10% compared to a reference level, such as at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or an increase of up to and including 100%, or any increase between 10% and 100%, or an increase of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times, or any increase between 2 times and 10 times, or greater, compared to a reference level. In the context of a biomarker or symptom, “increased” refers to a statistically significant increase in such a level.

[0122] The alteration of a natural amino acid sequence can be achieved using any of a variety of techniques known to those skilled in the art. A mutation can be introduced, for example, at a specific locus by synthesizing an oligonucleotide containing the mutated sequence, the oligonucleotide having restriction sites flanking it that allow it to link to fragments of the natural sequence. After linking, the resulting reconstructed sequence encodes an analogue with the desired amino acid insertion, substitution, or deletion. Alternatively, a site-directed oligonucleotide mutagenesis procedure can be employed to provide an altered nucleotide sequence with a specific codon, modified according to the desired substitution, deletion, or insertion. Techniques for making such modifications are well-established and include, for example, those disclosed by Walder et al. (Gene 42:133, 1986); Bauer et al. (Gene 37:73, 1985); Craik (BioTechniques, January 1985, 12-19); Smith et al. (Genetic Engineering: Principles and Methods, Plenum Press, 1981); and U.S. Patent Nos. 4,518,584 and 4,737,462, which are incorporated herein by reference in their entirety. Any cysteine ​​residues not involved in maintaining the correct conformation of the polypeptide can also be substituted (usually with serine) to improve the oxidative stability of the molecule and prevent aberrant crosslinking. Conversely, cysteine ​​bonds can be added to the polypeptide to improve its stability or promote oligomerization.

[0123] The term "expression" refers to the cellular processes involved in the production of RNA and proteins, and the secretion of proteins when appropriate, including, where applicable, transcription, transcript processing, translation, and protein folding, modification, and processing. Expression can refer to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from nucleic acid fragments or fragments of the present invention, and / or the translation of mRNA into polypeptides.

[0124] In some embodiments, the peptides, nucleic acids, or cells described herein may be engineered. As used herein, “engineered” refers to an aspect that has been artificially manipulated. For example, a peptide is considered “engineered” when at least one aspect of it (e.g., its sequence) has been artificially manipulated to differ from its naturally occurring aspect. By convention and as understood by those skilled in the art, progeny of engineered cells are often still referred to as “engineered” even if the actual manipulation was performed on the previous entity.

[0125] In some embodiments, the engineered immune cells described herein are exogenous. In some embodiments, the engineered immune cells described herein are ectopic. In some embodiments, the engineered immune cells described herein are not endogenous.

[0126] The term "exogenous" refers to a substance present in a cell but not of its natural origin. As used herein, "exogenous" may refer to nucleic acids (e.g., nucleic acids encoding polypeptides) or polypeptides that have been introduced into a biological system (such as a cell or organism) through artificial processes, where the nucleic acids or polypeptides are not normally present, but it is desirable to introduce them into such cells or organisms. Alternatively, "exogenous" may refer to nucleic acids or polypeptides that have been introduced into a biological system (such as a cell or organism) through artificial processes, where the nucleic acids or polypeptides are present in relatively low amounts, and it is desirable to increase the amount of the nucleic acids or polypeptides in the cells or organism, for example, to produce ectopic expression or levels. Conversely, the term "endogenous" refers to a substance that is natural to a biological system or cell. As used herein, "ectopic" refers to a substance present in an abnormal location and / or in an abnormal amount. Ectopic substances can be substances that are normally present in a given cell but in much smaller amounts and / or present at different times. Ectopic also includes substances (such as polypeptides or nucleic acids) that are not naturally present or expressed in their natural environment within a given cell.

[0127] Nucleic acids encoding polypeptides as described herein (e.g., CAR polypeptides) may be contained in vectors. As used herein, the term "vector" refers to a nucleic acid construct designed for delivery to a host cell or for transfer between different host cells. As used herein, vectors may be viral or non-viral. The term "vector" encompasses any genetic element capable of replicating and transferring a gene sequence into a cell when associated with appropriate control elements. Vectors may include, but are not limited to, cloning vectors, expression vectors, plasmids, bacteriophages, transposons, granules, chromosomes, viruses, virions, etc.

[0128] The vector may be recombinant, for example, it contains sequences derived from at least two different sources. In some embodiments, the vector contains sequences derived from at least two different species. In some embodiments, the vector contains sequences derived from at least two different genes, for example, it contains a fusion protein or nucleic acid encoding an expression product, which is operatively linked to at least one non-natural (e.g., heterologous) genetic control element (e.g., promoter, repressor, activator, enhancer, response element, etc.).

[0129] In some embodiments, the vectors or nucleic acids described herein are codon-optimized. For example, the natural or wild-type sequence of the nucleic acid has been altered or engineered to include alternative codons, such that the altered or engineered nucleic acid encodes a polypeptide expression product identical to the natural / wild-type sequence, but will be transcribed and / or translated with increased efficiency in the desired expression system. In some embodiments, the expression system is an organism (or cells obtained from such an organism) other than the source of the natural / wild-type sequence. In some embodiments, the vectors and / or nucleic acid sequences described herein are codon-optimized for expression in mammals or mammalian cells (e.g., mouse, rodent, or human cells). In some embodiments, the vectors and / or nucleic acid sequences described herein are codon-optimized for expression in human cells. In some embodiments, the vectors and / or nucleic acid sequences described herein are codon-optimized for expression in yeast or yeast cells. In some embodiments, the vectors and / or nucleic acid sequences described herein are codon-optimized for expression in bacterial cells. In some embodiments, the vectors and / or nucleic acid sequences described herein are codon-optimized for expression in *E. coli* cells.

[0130] As used herein, the term "expression vector" refers to a vector that directs the expression of RNA or polypeptide from a sequence of transcriptional regulatory sequences linked to the vector. The expressed sequence will typically (but not necessarily) be heterologous to the cell. Expression vectors may contain additional elements, such as having two replication systems, thus allowing them to be maintained in two organisms, for example, for expression in human cells and for cloning and amplification in a prokaryotic host.

[0131] As used herein, the term "viral vector" refers to a nucleic acid vector construct that contains at least one element of viral origin and has the ability to be packaged into viral vector particles. Viral vectors may contain nucleic acids encoding polypeptides as described herein, replacing non-essential viral genes. Vectors and / or particles can be used for the purpose of transducing any nucleic acid into cells in vitro or in vivo. Many forms of viral vectors are known in the art. Non-limiting examples of viral vectors of the present invention include AAV vectors, adenovirus vectors, lentiviral vectors, retroviral vectors, herpesvirus vectors, alphavirus vectors, poxvirus vectors, baculovirus vectors, and chimeric virus vectors.

[0132] It should be understood that, in some embodiments, the vectors described herein can be combined with other suitable compositions and therapies. For example, the use of suitable free vectors provides a means of maintaining the nucleotides of interest in the form of high-copy-number extrachromosomal DNA in a subject, thereby eliminating the potential impact of chromosomal integration.

[0133] The grouping of alternative elements or embodiments of the invention disclosed herein should not be construed as limiting.

[0134] Each member of a group may be mentioned and claimed individually or in any combination with other members of the group or other elements found herein. For convenience and / or patentability reasons, one or more members of a group may be included in or removed from the group. When any such inclusion or removal occurs, the specification herein is deemed to include the modified group, thereby satisfying the written description of all Markush groups used in the appended claims.

[0135] Unless otherwise defined herein, the scientific and technical terms used in connection with this application should have the meanings commonly understood by one of ordinary skill in the art to which this disclosure pertains. It should be understood that the invention is not limited to the specific methodologies, schemes, and reagents described herein, and therefore can be varied. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the invention, which is defined only by the claims. Definitions of commonly used terms in immunology and molecular biology can be found in: The Merck Manual of Diagnosis and Therapy, 20th edition, Merck Sharp & Dohme Corp., 2018 (ISBN 0911910190, 978-0911910421); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (ed.), WW Norton & Company, 2016 (ISBN 0815345054, 978-0815345053); Lewin's Genes XI, Jones & Bartlett Publishers, 2014 (ISBN-1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, ElsevierScience Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (editor) Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (Ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (Ed.), John Wiley and Sons Sons, Inc., 2005; and Current Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737); its contents are incorporated herein by reference in their entirety.

[0136] Other terms are defined within the description of various aspects of the invention herein.

[0137] All patents and other publications (including references, granted patents, published patent applications, and co-pending patent applications) cited in their entirety herein are expressly incorporated herein by reference for descriptive and disclosure purposes, such as methodologies described in such publications that can be used in conjunction with the techniques described herein. These publications are provided solely because their publications predate the filing date of this application. In this respect, nothing should be construed as an admission that the inventor has no right to bring this disclosure forward by virtue of a prior invention or any other reason. All statements regarding the dates of these documents or all descriptions regarding their contents are based on information available to the applicant and do not constitute any admission of the accuracy of the dates or contents of these documents.

[0138] The description of embodiments of this disclosure is not intended to be exhaustive or to limit this disclosure to the precise forms disclosed. As those skilled in the art will recognize, while specific embodiments and examples of this disclosure have been described herein for illustrative purposes, various equivalent modifications are possible within the scope of this disclosure. For example, although method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or may perform functions substantially simultaneously. The teachings of this disclosure provided herein may be applied to other procedures or methods as appropriate. The various embodiments described herein may be combined to provide further embodiments. If necessary, aspects of this disclosure may be modified to incorporate the combinations, functions, and concepts of the foregoing references and applications, thereby providing further embodiments of this disclosure. These and other changes may be made to this disclosure based on the detailed description. All such modifications are intended to be included within the scope of the appended claims.

[0139] Specific elements of any of the foregoing embodiments may be combined with or substituted for elements in other embodiments. Furthermore, although advantages relating to certain embodiments of this disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments necessarily need to exhibit such advantages to fall within the scope of this disclosure.

[0140] In some implementations, this technology may be defined in any of the following numbered paragraphs: 1. A method for engineered human immune cells, the method comprising: The cells were genetically edited by editing exon 5 of the gene encoding cyclophilin A (PPIA), wherein the gene editing produced a truncated cyclophilin A. 2. The method according to paragraph 1, wherein the gene editing includes introducing a ribonucleoprotein complex into the cell, the ribonucleoprotein complex comprising a CRISPR-associated protein (Cas) and a single guide RNA (sgRNA) targeting exon 5 of the PPIA gene. 3. The method according to paragraph 2, wherein the sgRNA targeting sequence is GGTTTGGCAAAGTGAAAGA. 4. The method according to any one of the preceding paragraphs, wherein the human immune cell is a T cell. 5. A method for preparing engineered human immune cells, the method comprising: a) Isolate immune cells or T cells from the subject. b) Stimulate the immune cells or T cells with antigens of viral origin, antigens of other pathogens, or cancer antigens. c) Isolating stimulated immune cells or T cells based on marker expression to obtain a composition of selected immune cells or T cells. d) Gene editing of the cells of the composition by introducing a ribonucleoprotein complex into the cells of the composition to edit the PPIA gene encoding cyclophilin A, wherein the ribonucleoprotein complex comprises a CRISPR-associated protein (Cas) and a single-guide RNA (sgRNA) targeting exon 5 of the PPIA gene, and e) In the presence of an immunosuppressant that can interact with cyclic protein A, the engineered cells are screened by culturing the cells. 6. The method according to paragraph 5, wherein the sgRNA targeting sequence is GGTTTGGCAAAGTGAAAGA. 7. The method according to paragraph 5, wherein the engineered human cells are pan-T cells. 8. The method according to paragraph 5, wherein the engineered human cell is a T cell specific to a virus, other pathogen, or cancer antigen. 9. The method according to paragraph 5, wherein the engineered human cell is a CAR-T cell. 10. Cells or cell populations produced by any of the methods described in any of the preceding paragraphs. 11. An engineered cell comprising a gene-edited PPIA gene, wherein the gene is edited in exon 5 of the gene, and wherein the gene-edited PPIA gene encodes a truncated cyclophilic protein A. 12. The cell described in paragraph 11, wherein the cell is a human cell. 13. The cells described in paragraph 11 or paragraph 12, wherein the cells are immune cells. 14. The cell according to any one of paragraphs 11-13, wherein the cell is a T cell. 15. The cell according to any one of paragraphs 11-14, wherein the cell is a T cell specific to a virus, other pathogen, or cancer antigen. 16. The cell according to any one of paragraphs 11-15, wherein the cell is sensitized in an antigen-specific manner by stimulation with antigens from viruses, other pathogens, or cancer antigens. 17. The cell according to any one of paragraphs 11-16, wherein the cell is a regulatory T cell. 18. The cell according to any one of paragraphs 11-17, wherein the cell is a CAR-T cell. 19. The cell according to any one of paragraphs 11-18, wherein the cell is generated by gene editing of the PPIA gene mediated by CRISPR / Cas. 20. The cell according to any one of paragraphs 11-19, wherein the cell is generated by CRISPR / Cas-mediated gene editing of the PPIA gene, wherein the single guide RNA targeting sequence GGTTTGGCAAAGTGAAAGA is used. 21. A cell population comprising the cells described in any one of paragraphs 11-20. 22. A pharmaceutical composition comprising the cells described in any one of the preceding paragraphs. 23. A method for treating a subject in need, the method comprising administering to the subject the cells described in paragraph 21 or the pharmaceutical composition described in paragraph 22. 24. The method according to paragraph 23, wherein an immunosuppressant is also administered to the subject. 25. The method according to paragraph 24, wherein the immunosuppressant is a calcineurin inhibitor. 26. The method according to paragraph 25, wherein the calcineurin inhibitor is cyclosporine or vorticol. 27. A method for engineered human immune cells, the method comprising: The cells were genetically edited by editing exon 5 of the gene encoding cyclophilin A (PPIA), wherein the gene editing produced modified cyclophilin A. 28. The method according to paragraph 27, wherein the gene editing includes introducing a ribonucleoprotein complex into the cell, the ribonucleoprotein complex comprising a CRISPR-associated protein (Cas) and a single guide RNA (sgRNA) targeting exon 5 of the PPIA gene. 29. The method according to paragraph 28, wherein the sgRNA targeting sequence is GGTTTGGCAAAGTGAAAGA. 30. The method according to any one of paragraphs 27-30, wherein the human immune cell is a T cell. 31. A method for preparing engineered human immune cells, the method comprising: a) Isolate immune cells or T cells from the subject. b) Stimulate the immune cells or T cells with antibodies, viral antigens, antigens from other pathogens, or cancer antigens. c) Isolate the stimulated immune cells or T cells based on marker expression to obtain a composition of selected immune cells or T cells. d) Gene editing of the cells of the composition by introducing a ribonucleoprotein complex into the cells of the composition to edit the PPIA gene encoding cyclophilin A, the ribonucleoprotein complex comprising a CRISPR-associated protein (Cas) and a single-guide RNA (sgRNA) targeting exon 5 of the PPIA gene, and e) In the presence of an immunosuppressant that can interact with cyclic protein A, the engineered cells are screened by culturing the cells. 32. The method according to paragraph 31, wherein the sgRNA targeting sequence is GGTTTGGCAAAGTGAAAGA. 33. The method according to paragraph 31, wherein the engineered human cell is a pan-T cell. 34. The method according to paragraph 31, wherein the engineered human cell is a T cell specific to a virus, other pathogen, or cancer antigen. 35. The method according to paragraph 31, wherein the engineered human cell is a CAR-T cell. 36. Cells or cell populations produced by any one of paragraphs 27-36. 37. An engineered cell comprising a gene-edited PPIA gene, wherein the gene is edited in exon 5 of the gene, and wherein the gene-edited PPIA gene encodes a modified cyclophilic protein A. 38. The cell described in paragraph 37, wherein the cell is a human cell. 39. The cells described in paragraph 37 or paragraph 38, wherein the cells are immune cells. 40. The cell according to any one of paragraphs 37-39, wherein the cell is a T cell. 41. The cell according to any one of paragraphs 37-40, wherein the cell is a T cell specific to a virus, other pathogen, or cancer antigen. 42. The cell according to any one of paragraphs 37-41, wherein the cell is sensitized in an antigen-specific manner by stimulation with an antigen from a virus, other pathogen, or cancer antigen. 43. The cell according to any one of paragraphs 37-42, wherein the cell is a regulatory T cell. 44. The cell according to any one of paragraphs 37-43, wherein the cell is a CAR-T cell. 45. The cell according to any one of paragraphs 37-44, wherein the cell is generated by gene editing of the PPIA gene mediated by CRISPR / Cas. 46. ​​The cell according to any one of paragraphs 37-45, wherein the cell is generated by CRISPR / Cas-mediated gene editing of the PPIA gene, wherein the single guide RNA targeting sequence GGTTTGGCAAAGTGAAAGA is used. 47. A cell population comprising the cells described in any one of paragraphs 37-46. 48. A pharmaceutical composition comprising the cells described in any one of paragraphs 27-47. 49. A method for treating a subject in need, the method comprising administering to the subject the cells described in paragraph 47 or the pharmaceutical composition described in paragraph 48. 50. The method according to paragraph 49, wherein an immunosuppressant is also administered to the subject. 51. The method according to paragraph 50, wherein the immunosuppressant is a calcineurin inhibitor. 52. The method according to paragraph 51, wherein the calcineurin inhibitor is cyclosporine or vorticol.

[0141] The techniques described herein are further illustrated by the following embodiments, which should in no way be construed as further limitations. Example Example 1 method Immune cell isolation

[0142] Peripheral blood mononuclear cells (PBMCs) were isolated from healthy human donors using a Ficoll gradient (n=10). T cells were isolated using a pan-T cell isolation kit (Miltenyi), where applicable. Cells were cultured in X-VIVO 15 (Lonza) medium supplemented with 10% fetal bovine serum, 1% penicillin / streptomycin, 2 mM Glutamax, and 50 μM β-mercaptoethanol. IL-2 (R&D) was added to reach 100 IU / mL for T cell expansion with 1:1 anti-CD3 / 28 Dynabeads, and 25 IU / mL was reached upon removal of the magnetic beads. No cytokines were added during cell proliferation assays. Virus-specific T cell production

[0143] PBMCs from HLA-A*02 positive donors (n=3) were resuspended in 50 μL of pp65 peptide mixture (JPT Technology) at a peptide concentration of 1 ng / μL. After 60 minutes of incubation, cells were seeded at 1 million cells / mL in 24-well plates containing IL-4 and IL-7 (both 10 ng / mL). Fresh medium containing cytokines was added every three days. Amplified CD8 was assessed using HLA-A*02-specific dextran multimer (dextramer) NLVPMVATV (Immudex). + CMV specificity in T cells. CAR-T generation

[0144] Purchase a plasmid encoding a lentiviral construct of anti-CD19-CD28-CD3z CAR from Vector Builder. Perform viral packaging. Stimulate freshly isolated pan-T cells with anti-CD3 / CD28 Dynabeads and transduce with lentivirus on day +2 using a standard protocol. CRISPR editor

[0145] As described above, pan-T cells, CAR-T cells, or VST cells were generated using freshly isolated PBMCs. Pan-T cells were CRISPR-edited two days after stimulation with anti-CD3 / CD28 Dynabead, and CAR-T cells were edited after a further two days of Dynabead stimulation following viral transduction. PBMCs stimulated with pp65 peptide were edited three days after exposure to a viral peptide mixture. CRISPR editing was performed according to the manufacturer's protocol (IDT). In short, guide RNA (gRNA) was prepared by annealing tracr RNA (IDT) with negative control cRNA (IDT) or cRNA for PPIA (GTGTTTGGCAAAGTGAAAGA) at 95°C for 5 minutes. Subsequently, to prepare ribonucleoproteins, the gRNA was combined with the Cas9 enzyme (IDT) for 15 minutes before electroporation using a standard protocol. DNA samples were taken on days 3–5 and at week 3 and sequenced using AzentaLife Sciences (PPIA primers, forward: TGTGGTTGCCAGTCATAGTGAT and reverse: CAGCGAGAGCACAAAGATTCTA). Gene editing (frameshift) efficiency was determined using Synthego ICE. Protein verification of cyclic proteins

[0146] Flow cytometry was performed using two different antibodies against cyclophilin A. For both, cells were first fixed with BD Cytofix and then permeabilized with BD Cytoperm. In the double staining protocol, cells were first labeled with a 1:100 dilution of rabbit cyclophilin A polyclonal antibody (Fisher; catalog number PA1-025), followed by a 1:300 dilution of donkey anti-rabbit IgG H&L (Alexa Fluor® 488; Abcam). In the single staining protocol, a 1:50 dilution of CoraLite® 594-conjugated cyclophilin A monoclonal antibody (Proteintech) was used. Preparation of calcineurin inhibitors

[0147] First, cyclosporine and vorticol (Millipore-Sigma) powders were reconstituted in dimethyl sulfoxide (DMSO) at 50 mg / mL and 5 mg / mL, respectively. They were then further diluted with DMSO to a working solution of 1 mg / mL. Tacrolimus (Prograf 5 mg / mL) and rapamycin (LC laboratories) were also used in the experiments. Mixed lymphocyte response (MLR)

[0148] Following the manufacturer's instructions (variation: 1 μL CTV per 10 million cells), CRISPR-edited pan-T cell "responders" were labeled with Cell Trace Violet (CTV; Thermofisher). In 96-well U-shaped plates, 100,000 edited responder T cells were plated with 300,000 HLA-A*02-differentiated (30 Gy) irradiated (PBMCs) "stimulators" at a total volume of 200 μL. Cyclosporine, vorticol, tacrolimus, and rapamycin were added at different doses on the day of experimental setup. The assay was read on a BDFortessa flow cytometer on day 5 after staining for CD4 (L200), CD8 (RPA-T8), and HLA-A*02 (BB7.2). CAR-T and VST proliferation assays

[0149] Edited CAR-T cells were statically incubated (Dynabeads removed) for one week, then stained with CTV and co-cultured with a CD19-positive NALM-6 (ATCC) cell line with Beta-2-microglobulin knockout to focus on CAR-specific proliferation (vs. allogeneic proliferation). Cells were collected on day 3 of co-culture for flow cytometry analysis. For the VST assay, cells were CTV-labeled and restimulated with a fresh pp65 peptide mixture 7–10 days after CRISPR editing of aptamer-stimulated PBMCs, either by pre-incubating VST with aptamers or by co-culturing VST with aptamers loaded on autologous PHA blast cells. Samples were collected on day 4 for flow cytometry analysis. Proliferation data analysis

[0150] First, flow cytometry data were analyzed using FlowJo version 10.7.1. Since the percentage inhibition of the drug is achieved through (… The normalized values ​​were calculated. The data were plotted using GraphPad Prism v9 and a two-way ANOVA with multiple comparisons (Šidák or Tukey post-hoc tests). CAR-T and VST cytokine stimulation assays

[0151] Cytokine proliferation assays were performed by adding a protein transport inhibitor mixture (eBioscience) to quiescent CAR-T and VST cells. For stimulation, pp65 pepmix (for VST) or PMA / ionomycin was added as part of the cell stimulation mixture (eBioscience; VST, CAR-T). Intracellular staining was performed using the BD Cytofix / Cytoperm kit and the following antibodies: FITC anti-human TNF-α (MAb11), BV421 anti-human IL-2 (MQ1-17H12), and BDHorizon. TM BV711 mouse anti-human IFN-γ (B27). CAR-T cytotoxicity assay

[0152] Edited CAR-T cells were statically cultured for one week and then co-cultured with NALM6 cells for 4 hours. Following this, after adding Precision Counting Beads (Biolegend), the cells were stained with Caspase 3 / 7 (Thermofisher), Zombie Aqua (Biolegend), and anti-CD19 antibody (HIB19). Live, CD19-positive cells were then stained. + The number of cells (normalized to count events of microbeads) was used based on 100% 1 – (NALM6) 混合 / NALM6 单独 To calculate the percentage kill (based on CAR-T co-culture and NALM6 single culture). Example 2 Cyclosporine and vorticol-resistant immune effector cells improve prognosis after stem cell transplantation

[0153] Recurrence of underlying malignancies and complications associated with viral reactivation are leading causes of morbidity and death after allogeneic hematopoietic cell transplantation (HCT). Immune effector cells (IECs) are increasingly being used to prevent and treat these complications. These include anti-CD19 CAR-T cells for B-ALL relapse after HCT, and virus-specific T cells (VSTs) targeting EBV, CMV, etc. However, in the early post-HCT period, the efficacy of these IECs may be impaired by the suppressive effects of immunosuppressants used to prevent graft-versus-host disease (GVHD).

[0154] A commonly used immunosuppressant for GVHD prophylaxis is the calcineurin inhibitor cyclosporine (CsA). The structural analogue vorticol (VCS) is currently FDA-approved for lupus nephritis and is undergoing trials for preventing rejection after solid organ transplantation. Given its favorable pharmacodynamics and toxicity profile compared to CsA and tacrolimus, VCS holds promise as an important option for HCT patients. Both CsA and VCS interact with calcineurin only in the presence of their immunophile-binding chaperone—cyclophilin A (PPIA). Tacrolimus and sirolimus interact with different immunophiles, such as FKBP12. This creates an opportunity to derive IECs resistant to a class of CNIs (CsA / VCS) but sensitive to other immunosuppressants (an important safety feature). The IECs described in this article are CsA / VCS-resistant, generated through CRISPR / Cas9 editing of PPIA. In the presence of CsA and VCS, these cells exhibit excellent proliferation and retain effector function.

[0155] This article describes immune cells resistant to both CsA and VCS, generated through CRISPR-mediated PPIA editing. In a functional in vitro assay using escalating doses of CsA and VCS, the proliferation, cytotoxicity, and cytokine production of PPIA-edited conventional T cells (Tcon), CMV (pp65)-specific VSTs, and CD19 CAR-T cells were compared with those of wild-type cells.

[0156] PPIA-edited Tcon cells demonstrated high editing efficiency (88%–92%), high viability, and robust expansion in cultures. Indeed, the efficiency of PPIA editing remained in cultures for several weeks, suggesting no survival disadvantage for cells carrying this deletion. Importantly, when PPIA-edited cells were used as responders in mixed lymphocyte responses in the presence of CsA, the edited cells demonstrated drug-mediated CD4+ activation on the dose-response curve. + and CD8 + Significant resistance to T cell proliferation inhibition (p < 0.01). Similar results were observed for VCS; PPIA-edited cells showed significant resistance to VCS-mediated inhibition at doses that were originally highly inhibitory (p < 0.0001).

[0157] CRISPR-edited VST and CD19 CAR-T cells showed similar editing efficiency to Tcon. Consistent with previous results, at all tested doses, CMV-specific PPIA-edited responder VST exhibited significant resistance to CsA proliferation inhibition compared to wild-type cells (p=0.0004, not shown). CD19 was then used... + The NALM6 cell line was used as a stimulant to evaluate proliferation in edited CAR-T cells in the presence of the drug. At escalating doses, the division of PPIA-edited responder CD19 CAR-T cells was almost entirely unaffected by CsA and VCS. For example, at an effector-to-target (E:T) ratio of 1:0.1 and a CsA dose of 50 ng / mL, wild-type CD8... + CAR-T cell division was inhibited in 40.6 ± 2.3% of cells, while in PPIA-edited CD8 cells... + CAR-T cell inhibition was -0.2 ± 0.4% (p < 0.0001). In CD4... + Similar findings were observed in responder CAR-T cells (p < 0.0001, not shown). PPIA-edited CAR-T cells also demonstrated full cytotoxicity, with no significant difference in % kill between the wild-type and PPIA-edited groups at three different E:T ratios. For example, at a 1:1 E:T ratio, the wild-type group and the PPIA-edited group showed 59 ± 15% kill and 55 ± 12% kill, respectively (not shown).

[0158] These data demonstrate that PPIA editing is an effective strategy for engineering cells resistant to CsA and VCS in cell therapy. Furthermore, these data show that PPIA-edited conventional T cells, VST cells, and CAR-T cells exhibit significant resistance to the original inhibitory effects on T cell proliferation (a hallmark of both CsA and VCS). Engineering CNI resistance into IECs will enhance the ability to utilize these cells early post-transplantation to prevent or treat malignant relapse and viral reactivation. Example 3

[0159] Cell therapy is emerging as a potential end-of-life treatment strategy for patients with graft-versus-host disease, post-transplant organ rejection, autoimmune diseases, and certain infections. However, discontinuing current maintenance medications before receiving cell therapy may be unsafe for patients. These maintenance regimens typically include a class of drugs called calcineurin inhibitors (CNIs). CNIs work by inhibiting T-cell activation and proliferation and may have adverse effects on novel T-cell therapies.

[0160] The two main calcineurin inhibitors are cyclosporine (CsA) and tacrolimus (Tac). Vocyclosporine (VCS), a modified version of cyclosporine, is approved for use in adults with lupus nephritis and is being investigated in cases of kidney allogeneic transplant rejection. FKBP12 and CypA (cyclophilin A) are immunophilin binding chaperones that allow their respective drugs to interact with calcineurin.

[0161] The need for methods to confer CNI resistance to T-cell therapies so that they can have the greatest therapeutic benefit has not yet been met.

[0162] Previous methods of knocking out the immunoglobulin FKBP12 (which binds to the calcineurin inhibitor tacrolimus) are less than ideal for regulatory T-cell therapy. FKBP12 also interacts with the mTOR pathway and confers resistance to rapamycin (also known as sirolimus), a drug used to expand regulatory T-cell products in vitro to promote their regulatory T-cell phenotype. Therefore, making cells resistant to rapamycin would be detrimental to regulatory T-cell therapy. Another approach explored is site-directed mutation of the calcineurin protein, preventing it from binding to drugs. However, this is a more challenging approach for clinical-scale implementation and carries a greater risk of off-target gene editing.

[0163] As described in this article, gene editing of cyclophilin A (PPIA) produces engineered cyclosporine / vorticol resistant cells. This method relies on CRISPR-Cas9-mediated editing of the last exon (exon 5) of the gene. This results in a low nonsense-mediated decay rate but leads to a protein lacking key amino acids near the C-terminus for CypA-CsA-calcineurin interaction; thus, some homeostatic functions of CypA are preserved while still achieving drug resistance. The in vitro preclinical data described in this article demonstrate that CRISPR-based modification of cyclophilin A is highly effective in conferring drug resistance to T cells. While CRISPR-Cas9 has been demonstrated, various gene editing techniques can be used to achieve the same objective.

[0164] CRISPR editing of the C-terminal exons of PPIA resulted in a high rate of frameshifts, generating cyclosporine and vorticol-resistant cells. This was demonstrated in CAR-T cells, virus-specific T cells, and regulatory T cells, all of which can constitute a key therapy for patients who have undergone transplantation and are receiving cyclosporine maintenance therapy. Importantly, these edits did not negatively affect cell behavior. This editing strategy holds great promise for enhancing the performance of various cell therapies.

Claims

1. A method for engineered human immune cells, the method comprising: Gene editing was performed on the cells by editing exon 5 of the gene encoding cyclophilin A (PPIA), wherein... The gene editing produces a modified cyclophilic protein A.

2. The method according to claim 1, wherein, The gene editing involves introducing a ribonucleoprotein complex into the cell, the ribonucleoprotein complex comprising a CRISPR-associated protein (Cas) and a single guide RNA (sgRNA) targeting exon 5 of the PPIA gene.

3. The method according to claim 2, wherein, The sgRNA targeting sequence is GGTTTGGCAAAGTGAAAGA.

4. The method according to any one of the preceding claims, wherein, The human immune cells mentioned are T cells.

5. A method for preparing engineered human immune cells, the method comprising: a) Isolate immune cells or T cells from the subject. b) Stimulate the immune cells or T cells with antibodies, viral antigens, antigens from other pathogens, or cancer antigens. c) Isolate the stimulated immune cells or T cells based on marker expression to obtain a composition of selected immune cells or T cells. d) Gene editing of the cells of the composition by introducing a ribonucleoprotein complex into the cells of the composition to edit the PPIA gene encoding cyclophilin A, the ribonucleoprotein complex comprising a CRISPR-associated protein (Cas) and a single-guide RNA (sgRNA) targeting exon 5 of the PPIA gene, and e) In the presence of an immunosuppressant that can interact with cyclic protein A, the engineered cells are screened by culturing the cells.

6. The method according to claim 5, wherein, The sgRNA targeting sequence is GGTTTGGCAAAGTGAAAGA.

7. The method according to claim 5, wherein, The engineered human cells are pan-T cells.

8. The method according to claim 5, wherein, The engineered human cells are T cells that are specific to viruses, other pathogens, or cancer antigens.

9. The method according to claim 5, wherein, The engineered human cells are CAR-T cells.

10. A cell or cell population, said cell or cell population being generated by the method of any one of the preceding claims.

11. An engineered cell, said engineered cell comprising a gene-edited PPIA gene, wherein, The gene editing is performed in exon 5 of the gene, and wherein the gene-edited PPIA gene encodes a modified cyclophilic protein A.

12. The cell according to claim 11, wherein, The cells in question are human cells.

13. The cell according to claim 11 or 12, wherein, The cells in question are immune cells.

14. The cell according to any one of claims 11-13, wherein, The cells in question are T cells.

15. The cell according to any one of claims 11-14, wherein, The cells are T cells that are specific to viruses, other pathogens, or cancer antigens.

16. The cell according to any one of claims 11-15, wherein, The cells are sensitized in an antigen-specific manner by stimulation with antigens from viruses, other pathogens, or cancer antigens.

17. The cell according to any one of claims 11-16, wherein, The cells in question are regulatory T cells.

18. The cell according to any one of claims 11-17, wherein, The cells in question are CAR-T cells.

19. The cell according to any one of claims 11-18, wherein, The cells were generated through CRISPR / Cas-mediated gene editing of the PPIA gene.

20. The cell according to any one of claims 11-19, wherein, The cells were generated through CRISPR / Cas-mediated gene editing of the PPIA gene, wherein the single guide RNA targeting sequence GGTTTGGCAAAGTGAAAGA (SEQ ID NO: 4) was used.

21. A cell population comprising the cells of any one of claims 11-20.

22. A pharmaceutical composition comprising cells according to any one of the preceding claims.

23. A method for treating a subject in need, the method comprising administering to the subject the cells of claim 21 or the pharmaceutical composition of claim 22.

24. The method according to claim 23, wherein, Immunosuppressants were also administered to the subjects.

25. The method according to claim 24, wherein, The immunosuppressant is a calcineurin inhibitor.

26. The method according to claim 25, wherein, The calcineurin inhibitor is cyclosporine or vorticol.

Images