A method for efficiently creating a quinoa hybrid line based on a salt-free vesicle phenotype
By obtaining salt vesicle deletion mutant parents through artificial mutagenesis and hybridizing them through natural cross-pollination, combined with screening the F1 generation using true leaf phenotype, the problems of difficult flower selection and emasculation and high cost of molecular identification in quinoa hybrid breeding were solved, achieving efficient and accurate hybrid breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHANDONG NORMAL UNIV
- Filing Date
- 2026-03-24
- Publication Date
- 2026-06-09
Smart Images

Figure CN122162699A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of agricultural technology, specifically relating to a method for efficiently creating quinoa hybrid lines based on salt-free vesicle phenotypes. Background Technology
[0002] Quinoa ( Chenopodium quinoa Quinoa (Willd.) is a halophytic crop belonging to the genus *Chenopodium* of the family Amaranthaceae. Thanks to its strong resistance to cold, drought, poor soil, and salinity, quinoa is distributed from sea level to an altitude of 4,500 meters.
[0003] Despite quinoa's numerous advantages, existing cultivated varieties still have significant drawbacks. Some varieties are unsuitable for the flowering period and local climate, making them susceptible to environmental influences that lead to poor pollination, reduced seed setting rate, and lower yield. Most varieties yield only 200-300 catties per mu (approximately 100-150 kg per hectare), failing to meet market demand. Furthermore, many varieties exhibit poor resistance to downy mildew, aphids, and other pests and diseases, and their grains lack dormancy characteristics, making them prone to sprouting during harvest if rain occurs, severely impacting yield and quality. There is also a need for improvement in traits such as saponin content, grain size, and color. Based on these issues, artificial hybridization to combine the superior traits of different varieties has become the main approach to creating new quinoa germplasm.
[0004] In recent years, with the deepening of quinoa research, the understanding of the function of epidermal vesicle cells has undergone significant changes. In 2020, Imamura et al. obtained a mutant with a significant reduction in quinoa epidermal vesicles through EMS mutagenesis and successfully cloned the REBC gene, which encodes the WD40 repeat protein controlling vesicle formation. Further genetic studies showed that the epidermal vesicle-deficient mutant and the non-mutant mutant did not differ significantly in salt tolerance. However, under drought conditions, the vesicles acted as water reservoirs, drawing water from leaf tissues and exacerbating water stress. In 2023, Moog et al. confirmed that the main function of epidermal vesicles is as a physical and chemical barrier against broad-spectrum arthropod herbivores and plant pathogens, overturning the traditional model that directly linked them to salt and drought tolerance. These findings have made vesicle density a new target for stress-resistance breeding.
[0005] Currently, quinoa hybridization breeding still relies on traditional manual operations, which presents significant technical bottlenecks: the small, clustered flowers make flower selection and emasculation difficult; the 10%-30% cross-pollination rate is easily affected by pollen from neighboring flowers; and F1 generation identification depends on phenotypic observation or cumbersome molecular markers, resulting in high costs and low efficiency. Based on this, this invention establishes a highly efficient quinoa hybridization and screening technology system using salt vesicle deletion as a visual marker. By simplifying hybridization operations and providing intuitive phenotypic screening, it significantly improves the efficiency of hybridization breeding, providing a new approach for the selection of superior quinoa varieties. Summary of the Invention
[0006] This invention discloses a method for efficiently creating quinoa hybrid lines based on a salt-free vesicle phenotype. A salt-vesicle-deficient mutant is obtained through artificial mutagenesis and used as a parent. This mutant is then cross-pollinated with normal parent inflorescences. The F1 generation of hybrids is then visually screened based on the restored salt vesicle phenotype in the true leaves of the offspring seedlings. This method simplifies the emasculation, pollination, and molecular identification processes, significantly improving the efficiency and accuracy of quinoa hybrid breeding and reducing operating costs.
[0007] This invention provides a method for efficiently creating quinoa hybrid lines based on salt-free vesicle phenotypes, employing the following technical solution: A method for efficiently creating quinoa hybrid lines based on salt-free vesicle phenotypes includes the following steps: (1) Using quinoa cultivar as parent 1, a mutant line with missing salt vesicles was created by artificial mutagenesis; (2) The salt vesicle-deficient parent 1 obtained in step (1) and the quinoa cultivar parent 2 with normal salt vesicles were cultivated at the same time. After both entered the flowering period, the inflorescences of both were attached and tied together, and cross-pollination was carried out by natural cross-pollination. (3) Harvest the seeds produced by the salt vesicle-deficient parent 1 and carry out germination culture. After the seedlings grow true leaves, observe the distribution of salt vesicles on the surface of the true leaves and screen out the lines that restore salt vesicles in the true leaves, thus obtaining the F1 generation lines of the successful hybridization of parent 1 and parent 2.
[0008] Preferably, the artificial induction in step (1) is chemical induction, specifically: soaking the seeds of parent 1 in 0.8% (v / v) EMS at pH 6.5 for 12 hours, and obtaining the m0 generation population after termination with sodium thiosulfate; screening for salt vesicle deletion mutants in the m1 generation, and verifying their genetic stability in the m2 or m3 generation to obtain homozygous salt vesicle deletion parent 1.
[0009] Preferably, the inflorescence binding in step (2) specifically involves: adjusting the sowing time of parent 1 and parent 2 to synchronize their flowering periods, tightly binding the inflorescences of both parents during their flowering period, and maintaining this binding until the grains mature before harvesting the grains of parent 1 with the salt vesicle-deficient type.
[0010] Preferably, the specific method for screening the successful hybrid F1 line in step (3) is as follows: the seeds of the harvested salt vesicle-deficient parent 1 are germinated and sown. When the seedlings grow two true leaves, the distribution of salt vesicles on the surface of the true leaves is observed. The line that restores the normal distribution of salt vesicles on the surface of the true leaves is selected as the F1 generation line of the successful hybridization of parent 1 and parent 2.
[0011] Preferably, parent 1 is the quinoa cultivar "Real" or NL6, and parent 2 is a quinoa cultivar with normal salt vesicles.
[0012] Preferably, in step (1), when germinating the m2 or m3 generation seeds of the salt vesicle deletion mutant line, the number of germinating plants shall not be less than 20, so as to confirm the genetic stability of the mutant line.
[0013] Preferably, the culture conditions in step (2) are: temperature 22℃, light 16 hours / dark 8 hours, light intensity 3000-5000 lux, humidity 60%-70%.
[0014] In summary, the beneficial effects of the present invention are as follows: First, this invention greatly simplifies the hybridization process. By utilizing quinoa's natural cross-pollination characteristic, hybridization can be achieved simply by binding and attaching the inflorescences of the salt vesicle-deficient parent and the normal parent, completely eliminating the cumbersome flower selection, emasculation, and artificial pollination steps of traditional methods. This not only reduces reliance on operator skills and experience, and decreases manpower and time investment, but also effectively avoids hybridization failure caused by interference from pollen from neighboring flowers after emasculation. Practical verification shows that the operational efficiency of this method per unit time is more than 10 times that of traditional manual methods, creating conditions for large-scale quinoa hybridization breeding.
[0015] Secondly, this invention achieves efficient and accurate screening of hybrid offspring. Utilizing the characteristic that the salt vesicle-deficient phenotype can be visually identified at the seedling stage, the success of hybridization can be quickly determined simply by observing whether salt vesicles have recovered in the true leaves of the offspring seedlings. This method eliminates the need for complex molecular marker detection, avoiding misjudgments caused by phenotypic instability, significantly reducing identification costs, and shortening the breeding cycle. Furthermore, the salt vesicle-deficient phenotype is extremely rare in natural populations, and its recovery is highly specific, ensuring the reliability of the identification results and providing strong support for the rapid breeding of superior quinoa varieties. Attached Figure Description
[0016] Figure 1 The screening results for salt vesicle deletion mutants are shown in the figure. Figure 2 This is a diagram illustrating the genetic stability analysis of parent 1, which is a salt vesicle deletion type. Figure 3 A schematic diagram illustrating the process of binding and hybridizing parental inflorescences; Figure 4 This is a figure showing the results of screening F1 hybrid lines based on salt vesicle restoration phenotype; Figure 5 This is a diagram verifying the heterozygosity of SNP sites in the F1 hybrid line. Detailed Implementation
[0017] The present invention will be further described in detail below with reference to the embodiments.
[0018] Example Example 1 Using parent line 1 as the "Real" of the large white quinoa, a mutant library was created using the chemical mutagen ethyl methanesulfonate (EMS). The salt vesicle status of the true leaves of the seedlings was observed, and mutant lines lacking salt vesicles were screened as parent line 1 for subsequent operations. The specific steps are as follows: Weigh 100 g of *Chenopodium album* "Real" seeds and place them in a 1 L Erlenmeyer flask. Rinse the seeds three times with 300 mL of redistilled water using magnetic stirring for 30 minutes each time to ensure full water absorption. Then, evenly transfer the seeds to four 1 L Erlenmeyer flasks, each containing 300 mL of 100 mmol / L phosphate buffer (pH 6.5). Slowly add 0.8% (v / v) EMS and place the flasks in a refrigerator at 4°C with magnetic stirring for 12 hours. After adding 5% (m / v) sodium thiosulfate to neutralize the mutagen, pour out the solution and rinse the seeds 10 times with 300 mL of redistilled water each time. Sow the mutated seeds into a seedling substrate for cultivation. After germination, the seedlings are classified as generation m0. Approximately 9000 lines were obtained from generation m0. From these 9000 lines, approximately 90 lines were mixed to harvest generation m1 seeds, resulting in a total of 100 generation m1 mixed ponds. Germinated M1 generation seeds were used to screen for salt vesicle-deficient lines by observing the salt vesicle status of true leaves during the seedling stage (2-3 true leaves). (In this example, each mixed pool germinated 5,000-6,000 seeds, resulting in 500,000-600,000 M1 generation seedlings, and 12 salt vesicle-deficient mutants were identified.) The salt vesicle status of true leaves was observed in the offspring lines of the screened salt vesicle-deficient M1 lines, such as the M2 and M3 generations, and a certain number of offspring populations were counted.
[0019] like Figure 1 As shown, through EMS chemical mutagenesis of parent 1, namely the large white quinoa "Real" in the example, no lines with the salt vesicle deletion phenotype were found in the m0 generation. In the m1 generation, by observing the distribution of salt vesicles in true leaves, salt vesicle deletion mutants were screened. Figure 2 As shown, the distribution of salt vesicles in true leaves of the m2 and m3 generations (>10 plants) of the salt vesicle mutant was observed during the seedling stage (2-3 true leaves). The proportion of salt vesicle-deficient plants in both generations was 100%, indicating that the salt vesicle-deficient mutant line is a stable homozygous line that can be used for hybridization.
[0020] Example 2 The specific steps for hybridization between parent 1 (the salt vesicle-deficient strain of the "Real" m2 generation of large white quinoa) and parent 2 (the strain CM331 with normal salt vesicles) are as follows: Seeds of parent line 1 and parent line 2, namely the CM331 salt vesicle-deficient line of the "Real" m2 generation of quinoa, were sown in seedling soil in seedling pots measuring 8 cm long × 8 cm wide × 10 cm high, with 4 quinoa plants per pot. Both parents were cultured in an artificial climate chamber until flowering under the following conditions: temperature 22℃, 16 hours light to 8 hours dark, light intensity 3000-5000 lux, and humidity 60-70%. Figure 3 As shown, after the heading begins, place the seedling pots of the two parents next to each other, take the two inflorescences and fit them tightly together, so that some of the small flowers are attached and intertwined, and wrap them with fine wire to stabilize the attachment. During the inflorescence opening period, gently shake the tied inflorescences every day and cultivate them until the inflorescences wither, the grains fill and finally mature.
[0021] Example 3 The specific steps for screening F1 hybrid lines are as follows: Remove the bindings and harvest the spikes of salt vesicle-deficient quinoa “Real”, thoroughly dry them and separate the kernels; sow the harvested kernels and cultivate them in a greenhouse or artificial climate chamber. The seedling trays are 8 cm long × 8 cm wide × 10 cm high, with 4 quinoa plants per tray. The cultivation conditions are: temperature 22℃, 16 hours of light to 8 hours of darkness, light intensity 3000-5000 lux, and humidity 60-70%; when the seedlings grow to the two true leaf stage, observe the distribution of salt vesicles on the surface of the true leaves.
[0022] like Figure 4 As shown, in 10 seedlings of the M1 generation of large white quinoa “Real”, salt vesicles on the surface of the true leaves of the seedlings were found to have recovered, showing salt vesicle morphology and distribution characteristics similar to those of the non-mutant parent CM331. It was determined that the seedling was a successfully hybridized F1 generation plant.
[0023] Test case Test Example 1 Genomic DNA was extracted from leaves of parent 1, parent 2, and salt vesicle-recovered lines. Differential SNP sites between the two parent lines were amplified and sequenced. The specific steps are as follows: Quinoa genome was extracted using the CTAB method, as detailed below: Take approximately 0.1 g of quinoa plant leaves, grind them in liquid nitrogen, and transfer them to a 1.5 mL centrifuge tube. Add 500 μL of 2×CTAB extraction buffer (2% CTAB, 100 mmol / L Tris-HCl (pH 8.0), 20 mmol / L EDTA, 1.4 mol / L NaCl, 2% PVP, and add 0.2% β-mercaptoethanol before use), mix well, and incubate at 65℃ for 30 minutes. After cooling to room temperature, add an equal volume of chloroform, mix thoroughly, and centrifuge at 12000 rpm for 10 minutes. Transfer the supernatant to a new 1.5 mL centrifuge tube, add twice the volume of pre-cooled anhydrous ethanol, mix well, and centrifuge at 4℃ for 12000 rpm for 10 minutes. Remove the supernatant. Let the precipitate air dry for 10 minutes, then dissolve it in 50 μL of double-distilled water to obtain genomic DNA, which can be used for PCR experiments.
[0024] SNP site identification methods: Primers were designed based on the genomic regions containing the differential SNP loci in the two parental lines. The upstream primer was ACCCAGACTGCCAATTTTGA, and the downstream primer was ACATGTTCGTTGCTGAAATAACT. PCR was performed using the extracted genomic DNA as a template (amplification system: 10 μL of 2×Taq master mix, 0.5 μL of each primer, 1 μL of template, total reaction volume 10 μL. Amplification program: preheating at 95℃ for 3 minutes; denaturation at 95℃ for 30 seconds, annealing at 56℃ for 30 seconds, extension at 72℃ for 30 seconds, 30 cycles; final extension at 72℃ for 3 minutes). The PCR products were subjected to agarose gel electrophoresis (0.8% agarose gel, 150 V for 15-20 minutes). The target band (approximately 900 bp) was excised and sent to a sequencing company for first-generation sequencing using the upstream primer. The genotype of the target SNP locus was determined based on the peak pattern of the sequencing results.
[0025] like Figure 5 As shown, the results indicate that, compared to the single peaks of the two parents, the two random F1 hybrid lines screened based on salt vesicle restoration phenotype both show superimposed peaks, indicating that they are in a heterozygous state, thus proving the effectiveness of the method described in this invention.
[0026] The above are all preferred embodiments of the present invention and are not intended to limit the scope of protection of the present invention. Therefore, all equivalent changes made in accordance with the structure, shape and principle of the present invention should be covered within the scope of protection of the present invention.
Claims
1. A method for efficiently creating quinoa hybrid lines based on salt-free vesicle phenotypes, characterized in that, Includes the following steps: (1) Using quinoa cultivar as parent 1, a mutant line with missing salt vesicles was created by artificial mutagenesis; (2) The salt vesicle-deficient parent 1 obtained in step (1) and the quinoa cultivar parent 2 with normal salt vesicles were cultivated at the same time. After both entered the flowering period, the inflorescences of both were attached and tied together, and cross-pollination was carried out by natural cross-pollination. (3) Harvest the seeds produced by the salt vesicle-deficient parent 1 and carry out germination culture. After the seedlings grow true leaves, observe the distribution of salt vesicles on the surface of the true leaves and screen out the lines that restore salt vesicles in the true leaves, thus obtaining the F1 generation lines of the successful hybridization of parent 1 and parent 2.
2. The method according to claim 1, characterized in that, In step (1), artificial induction is transformed into chemical mutagenesis, specifically as follows: the seeds of parent 1 are soaked in EMS at a concentration of 0.8% (v / v) for 12 hours under pH 6.5 conditions, and the m0 generation population is obtained after termination with sodium thiosulfate; salt vesicle deletion mutants are screened in the m1 generation, and their genetic stability is verified in the m2 or m3 generation to obtain homozygous salt vesicle deletion parent 1.
3. The method according to claim 1, characterized in that, In step (2), the inflorescence binding is specifically as follows: the sowing time of parent 1 and parent 2 is adjusted to synchronize the flowering period, and the inflorescences of both parents during their flowering period are tightly bound together and kept until the grains mature before harvesting the grains of parent 1 with salt vesicle deficiency.
4. The method according to claim 1, characterized in that, The specific method for screening successful hybrid F1 lines in step (3) is as follows: the seeds of the harvested salt vesicle-deficient parent 1 are germinated and sown. When the seedlings grow two true leaves, the distribution of salt vesicles on the surface of the true leaves is observed. The line that restores the normal distribution of salt vesicles on the surface of the true leaves is selected as the F1 generation line of parent 1 and parent 2.
5. The method according to any one of claims 1 to 4, characterized in that, The parent 2 is a quinoa cultivar with normal salt vesicles.
6. The method according to claim 2, characterized in that, When germinating the m2 or m3 generation seeds of the salt vesicle deletion mutant line described in step (1), the number of germinating plants shall not be less than 20, in order to confirm the genetic stability of the mutant line.
7. The method according to claim 1, characterized in that, The cultivation conditions described in step (2) are: temperature 22℃, light for 16 hours / darkness for 8 hours, light intensity 3000-5000 lux, and humidity 60%-70%.