Natural small molecule agonist of aconitase aco2 and applications thereof

Abstract

This invention provides a natural small-molecule agonist of cis-aconitase ACO2 and its application. Specifically, it discloses the application of 6-hydroxy-4β-(4-hydroxy-3-methoxyphenyl)-3α-hydroxymethyl-5-methoxy-3,4-dihydro-2-naphthaldehyde (isovitanyl) in the preparation of a cis-aconitase ACO2 protein agonist, and also discloses the application of 6-hydroxy-4β-(4-hydroxy-3-methoxyphenyl)-3α-hydroxymethyl-5-methoxy-3,4-dihydro-2-naphthaldehyde in the preparation of drugs for treating diseases related to human cis-aconitase ACO2 protein. Experimental results show that isovitanyl can directly bind to ACO2 protein, with a binding constant KD value of 9.73 μM, and can significantly improve the enzyme activity of ACO2. VA can provide a foundation for drug development to treat diseases related to ACO2, such as ischemic heart disease associated with pathological myocardial remodeling, diabetic cardiomyopathy and hypertensive myocardial hypertrophy, as well as ACO2 deficiency (a rare disease), Parkinson's disease, Alzheimer's disease, Huntington's disease, and cancer.

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical technology and relates to aconitase ACO2 agonists, specifically to a natural small molecule agonist of cis-aconitase ACO2 and its pharmaceutical uses. Background Technology

[0002] Aconitase 2 (ACO2), also known as mitochondrial aconitase, is one of the key enzymes in the tricarboxylic acid cycle (TCA cycle). This enzyme is encoded by a nuclear gene, synthesized in the cytoplasm, and then transported to the mitochondrial matrix to perform its function. ACO2 catalyzes the second step of the tricarboxylic acid cycle, namely the reversible isomerization reaction between citrate and isocitrate, which is accomplished via the intermediate cis-aconitate (Lauble H, Kennedy MC, Beinert H, Stout CD. Crystal structures of aconitase with trans-aconitate and nitrocitrate bound. Journal of Molecular Biology. 1994, 237 (4): 437-451.). Structurally, ACO2 belongs to the iron-sulfur protein family, and its active site contains a 4Fe-4S cluster. This iron-sulfur cluster not only participates in the catalytic reaction but also makes ACO2 highly sensitive to reactive oxygen species (ROS). When cells are under oxidative stress, this iron-sulfur cluster is easily destroyed, leading to loss of enzyme activity.

[0003] In terms of biological function, ACO2 ensures the stability of cellular energy metabolism by maintaining the normal operation of the tricarboxylic acid cycle. In addition, since mitochondria are the core organelles of cellular energy metabolism, the functional state of ACO2 is closely related to the cell's energy supply, especially in tissues with high energy demand (such as the brain, heart, and skeletal muscle).

[0004] In recent years, with the deepening of research on mitochondrial diseases, the association between ACO2 and various human diseases has been gradually revealed, mainly focusing on the following aspects:

[0005] 1. Nervous system diseases

[0006] The nervous system is extremely sensitive to energy metabolism, therefore, ACO2 dysfunction is closely related to a variety of neurological diseases. Previous studies have shown that ACO2 gene mutations can lead to syndromes such as optic nerve atrophy, ataxia, and intellectual disability (Padalko V, Posnik F, Adamczyk M. Mitochondrial Aconitase and Its Contribution to the Pathogenesis of Neurodegenerative Diseases. Int J Mol Sci. 2024 Sep 15;25(18):9950.). In the field of Parkinson's disease, the role of ACO2 has received significant attention—studies have shown that ACO2 may participate in regulating the pathogenesis of Parkinson's disease mediated by LRRK2 (leucine-rich repeat kinase 2), suggesting its important role in neurodegenerative diseases. Furthermore, during aging, decreased mitochondrial ACO2 activity leads to reduced energy synthesis, which may be related to age-related cognitive decline.

[0007] 2. Cardiovascular diseases

[0008] In recent years, the deep association between ACO2 and various human cardiovascular diseases has been gradually revealed. ACO2 plays a crucial protective role in both abdominal aortic aneurysm (AAA) and atherosclerosis (SunLY, Lyu YY, Zhang HY, Shen Z, Lin GQ, Geng N, Wang YL, Huang L, Feng ZH, GuoX, Lin N, Ding S, Yuan AC, Zhang L, Qian K, Pu J. Nuclear Receptor NR1D1 Regulates Abdominal Aortic Aneurysm Development by Targeting the Mitochondrial Tricarboxylic Acid Cycle Enzyme Aconitase-2. Circulation. 2022Nov 22;146(21):1591-1609.). Furthermore, in myocardial ischemia-reperfusion injury, ACO2 inactivation caused by oxidative stress is considered one of the important factors in mitochondrial dysfunction.

[0009] 3. Tumor metabolic reprogramming

[0010] In the field of tumor biology, changes in ACO2 function are associated with tumor metabolic reprogramming. Alterations in ACO2 expression or activity have been observed in some tumor cells (Wang P, Mai C, Wei YL, Zhao JJ, Hu YM, Zeng ZL, Yang J, Lu WH, Xu RH, Huang P. Decreased expression of the mitochondrialmetabolic enzyme aconitase (ACO2) is associated with poor prognosis ingastric cancer. Med Oncol. 2013 Jun;30(2):552.), which may be related to the metabolic shift in tumor cells from oxidative phosphorylation to aerobic glycolysis (Warburg effect).

[0011] In summary, ACO2, as a key enzyme in mitochondrial energy metabolism, plays a central role in maintaining normal cellular function. Its dysfunction is closely related to neurological diseases, cardiovascular diseases, tumor metabolism, and even novel cell death mechanisms (copper death). However, research on direct drug regulation of ACO2 (agonists or inhibitors) is still in its early stages, and existing interventions are mostly non-specific or indirect. With further analysis of the three-dimensional structure of ACO2 and a clearer understanding of its mechanisms of action in disease development, the development of specific ACO2 regulators will become an important direction for future drug development, especially in areas such as neuroprotection, cardiovascular protection, and tumor metabolic intervention. Therefore, the discovery and exploitation of highly effective, low-toxicity, and selective ACO2 agonists can lay a solid foundation for the development of drugs for treating related diseases, and holds great potential.

[0012] Pathological myocardial remodeling is an important pathological process in heart disease, involving cardiomyocyte loss, extracellular matrix remodeling, and activation of the neuroendocrine system. This process is usually caused by long-term increased cardiac load, ischemia, inflammation, or other factors, leading to cardiomyocyte hypertrophy, collagen deposition, and ventricular wall thickening, thereby affecting the heart's systolic and diastolic functions (Maytin M, Colucci WS. Molecular and cellular mechanisms of myocardial remodeling. J Nucl Cardiol. 2002; 9(3):319-27.).

[0013] Pathological myocardial remodeling is a key pathological basis for cardiovascular diseases such as hypertensive cardiomyopathy (hypertension increases left ventricular pressure load, leading to myocardial cell hypertrophy and fibrosis, which in turn increases myocardial stiffness and disrupts systolic and diastolic function, increasing the risk of heart failure or cardiac arrest) (Zhan Ping, Li Jinguo. Hypertensive ventricular remodeling and its intervention strategies [J]. Medical Review, 2008, 14(10): 1507-1509.), ischemic cardiomyopathy and myocardial infarction (after myocardial ischemia or myocardial infarction, myocardial cells are lost, scar repair and tissue fibrosis occur, leading to ventricular remodeling, which further damages cardiac function), and heart failure (a clinical syndrome caused by abnormal cardiac structure or function due to valvular heart disease, myocardial infarction, hypertension, etc., in which the heart cannot effectively pump blood to meet the body's metabolic needs, and myocardial remodeling is the key pathological basis for its occurrence and development) (Wang Yajing. Research progress on the mechanism of heart failure after myocardial infarction [J]. Journal of Difficult Diseases, 2012, 11(9): 726-727.). In addition, it may also cause arrhythmias and other complications, which have a decisive impact on the incidence and mortality of heart disease (Wang Yanfen, Yu Junmin, Zhang Xiaobo, et al. Research progress on the pathogenesis of arrhythmias in patients with heart failure [J]. Journal of Cardiovascular and Pulmonary Diseases, 2018, 37(9):873-875.). With the aging of the population and the increase in the number of patients with chronic heart disease, the incidence of heart failure continues to rise, and the mortality rate remains high, which has brought a heavy burden to patients and the medical system (National Center for Cardiovascular Diseases, China Cardiovascular Health and Disease Report Writing Group, Hu Shengshou. Summary of China Cardiovascular Health and Disease Report 2023 [J]. Chinese Journal of Circulation, 2024, 39(7):625-660.).

[0014] Currently, the main drugs for treating myocardial remodeling include the following categories: ACEI / ARB drugs, such as ACEIs and ARBs, which improve myocardial remodeling by inhibiting the production of angiotensin II, reducing myocardial cell hyperplasia and hypertrophy, inflammatory cell adhesion, and fibrosis; β-blockers, such as metoprolol and bisoprolol, which improve myocardial remodeling by inhibiting excessive activation of the sympathetic nervous system, reducing cardiac load; sodium-glucose cotransporter 2 inhibitors (SGLT2i), such as empagliflozin, which can improve myocardial remodeling not only in diabetic patients but also in non-diabetic patients, with mechanisms including optimizing mitochondrial energy metabolism and reducing myocardial fibrosis; and aldosterone antagonists, which can counteract the pathological effects of excessive aldosterone, reduce aldosterone cardiotoxicity, and thus reduce myocardial remodeling (Chinese Medical Association Cardiovascular Physicians Branch, China Cardiovascular Health Alliance, Expert Consensus Working Group on Prevention and Treatment of Heart Failure after Myocardial Infarction. 2020 Expert Consensus on Prevention and Treatment of Heart Failure after Myocardial Infarction [J]). Chinese Journal of Circulation, 2020, 35(12):1166-1180. Yu F, McLean B, Badiwala M, Billia F. Heart Failure and Drug Therapies: A Metabolic Review. Int J Mol Sci. 2022 Mar 9;23(6):2960.

[0015] Although various drugs are currently available for the treatment of myocardial remodeling, several problems remain: these drugs primarily target neuroendocrine regulation and cardiac load, but lack specificity. While existing drugs can slow the progression of myocardial remodeling, they cannot reverse the pathological changes that have already occurred. In terms of long-term prognosis, even with drug treatment, patients' heart failure symptoms and quality of life show limited improvement, and the long-term prognosis remains poor, highlighting the necessity of further exploring new therapeutic targets and methods (Landmesser U, Wollert KC, Drexler H. Potential novel pharmacologicaltherapies for myocardial remodeling. Cardiovasc Res. 2009 Feb 15;81(3):519-27.). In summary, myocardial remodeling, as a key pathological process in cardiovascular disease, encompasses various conditions such as hypertensive heart disease, ischemic cardiomyopathy, and heart failure. Currently, the therapeutic effects of existing drugs are not satisfactory, and there is an urgent need for in-depth research and development of more effective therapeutic drugs in order to improve the prognosis of patients with pathological myocardial remodeling.

[0016] 6-Hydroxy-4β-(4-hydroxy-3-methoxyphenyl)-3α-hydroxymethyl-5-methoxy-3,4-dihydro-2-naphthaldehyde (vitedoin A, code VA) is a compound isolated from Vitex negundo L. seeds, a plant belonging to the genus Vitex of the Lamiaceae family (Zheng CJ, Tang WZ, Huang BK, Han T, Zhang QY, Zhang H, Qin LP. Bioactivity-guided fractionation for analgesic properties and constituents of Vitex negundo L. seeds. Phytomedicine, 2009, 16: 560–567.). The structural formula of the compound is shown in Formula 1.

[0017]

[0018] Formula I

[0019] Isovesin belongs to the benzonaphthalene type of lignans, which are characteristic components of Vitex species. Previous studies have shown that vitexin has antioxidant and osteoclast differentiation inhibitory activities (Ban YF, Wang Y, Qiao LM, Zhang CZ, Wang HR, He XH, Jia D, Zheng CJ. Total lignans from Vitexnegundo seeds attenuate osteoarthritis and their main component vitedoin Aalleviates osteoclast differentiation by suppressing ERK / NFATc1 signaling. Phytotherapy Research, 2023, 37(4), 1422-1434), and its isomer vitexin has anti-inflammatory, analgesic and antitumor biological activities (Zheng CJ, Li HQ, Ren SC, Xu CL, Rahman K, Qin LP, SunYH. Phytochemical and pharmacological profile of Vitex negundo. Phytotherapy Research, 2015, 29:633-647). However, to date, there has been no application of isovitexin in the preparation of drugs for treating ACO2-related diseases. Summary of the Invention

[0020] This invention addresses the aforementioned problems by investigating the activation effect of aconitase 2 (ACO2) by VA and its therapeutic effect on related diseases. Results show that 6-hydroxy-4β-(4-hydroxy-3-methoxyphenyl)-3α-hydroxymethyl-5-methoxy-3,4-dihydro-2-naphthaldehyde provided in this invention can serve as a natural small-molecule agonist for ACO2. Surface plasmon resonance (SPR) technology was used to determine the binding constant KD value of isovitexin to ACO2, which is 9.73 μM. This significantly enhances the enzyme activity of ACO2 in a concentration-dependent manner, indicating that VA exerts its effect by enhancing ACO2 activity.

[0021] Furthermore, using two classic animal models—isoproterenol-induced mouse myocardial remodeling and aortic arch constriction-induced mouse myocardial remodeling—and after continuous gavage administration for 30 days, combined with histopathological sections and biochemical index measurements, we comprehensively confirmed the good in vivo activity of vitexin A (VA) in improving pathological myocardial remodeling, providing a potential candidate drug for the development of drugs for the treatment of diseases related to pathological myocardial remodeling.

[0022] Therefore, the natural small molecule agonist isovitexin VA discovered in this invention can provide a foundation for drug development to treat diseases related to ACO2, such as ischemic heart disease associated with pathological myocardial remodeling, diabetic cardiomyopathy and hypertensive myocardial hypertrophy, as well as ACO2 deficiency (a rare disease), Parkinson's disease, Alzheimer's disease, Huntington's disease and tumors.

[0023] Based on the above research, the technical solution to be protected by this invention is as follows:

[0024] In a first aspect, the present invention provides the use of 6-hydroxy-4β-(4-hydroxy-3-methoxyphenyl)-3α-hydroxymethyl-5-methoxy-3,4-dihydro-2-naphthaldehyde, i.e., isovitexin, in the preparation of aconitase 2 (ACO2) protein agonists.

[0025] In a second aspect, the present invention provides an ACO2 protein agonist, the active component of which isovitalidin.

[0026] In a third aspect, the present invention provides the application of isovitexin in the preparation of drugs for treating human ACO2 protein-related diseases, specifically in the preparation of drugs for inhibiting ACO2 protein expression, such as human ACO2 protein inactivation or deficiency.

[0027] Preferably, the human ACO2 protein-related diseases are selected from any one of the following types of diseases: pathological myocardial remodeling-related diseases, ACO2 deficiency (rare disease), neurodegenerative diseases, and tumors.

[0028] Furthermore, the pathological myocardial remodeling-related diseases include ischemic heart disease, diabetic cardiomyopathy, hypertensive myocardial hypertrophy, myocardial infarction, and heart failure. The drug treats pathological myocardial remodeling by activating ACO2 enzyme activity, improving mitochondrial energy metabolism, and inhibiting cardiomyocyte hypertrophy and myocardial fibrosis.

[0029] The neurodegenerative diseases mentioned include Parkinson's disease, Alzheimer's disease, and Huntington's disease.

[0030] The tumors are selected from solid tumors (hepatocellular carcinoma, renal cell carcinoma, lung cancer, colorectal cancer, head and neck cancer, pancreatic cancer, breast cancer, cervical cancer, prostate cancer, ovarian cancer, melanoma, gastric cancer, urothelial carcinoma, thyroid cancer) or non-solid tumors (leukemia) with altered ACO2 expression or activity, for chemotherapy sensitization and metabolic intervention.

[0031] In a fourth aspect, the present invention provides a pharmaceutical composition characterized in that it comprises a therapeutically effective amount of 6-hydroxy-4β-(4-hydroxy-3-methoxyphenyl)-3α-hydroxymethyl-5-methoxy-3,4-dihydro-2-naphthal or a salt thereof, and a pharmaceutically acceptable carrier or excipient.

[0032] Preferably, the dosage form of the pharmaceutical composition is a tablet, capsule, injection, granule, or oral liquid formulation. Furthermore, the pharmaceutical composition can be used in combination with other drugs for treating human ACO2 protein-related diseases.

[0033] In a preferred embodiment, the reference to "pharmaceutically acceptable salt" generally refers to any salt that is physiologically tolerable when used in a suitable manner for treatment (particularly when applied or used in humans and / or mammals). This generally means that it is non-toxic, particularly as a result of the presence of an anti-ion. These physiologically acceptable salts can be formed with cations or bases, and in the context of this invention, particularly when administered to humans and / or mammals, they should be understood as salts formed from at least one compound provided according to this invention, typically an acid (deprotonated), such as an anion, and at least one physiologically tolerable cation (preferably an inorganic cation). Specifically, in the context of this invention, this may include salts formed with alkali metals and alkaline earth metals, as well as salts formed with ammonium cations (NH4+), specifically including but not limited to salts formed with (mono) or (di) sodium, (mono) or (di) potassium, magnesium, or calcium. These physiologically acceptable salts may also be formed with anions or acids, and in the context of this invention, particularly when administered to humans and / or mammals, they should be understood as salts formed from at least one compound provided according to this invention, typically protonated, such as a cation, and at least one physiologically tolerable anion.

[0034] Salts of the VA include, but are not limited to, salts formed with the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, citric acid, tartaric acid, phosphoric acid, lactic acid, pyruvic acid, acetic acid, succinic acid, oxalic acid, fumaric acid, maleic acid, oxaloacetic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, or hydroxyethanesulfonic acid. Salts of halides are also applicable. Other salts include salts formed with alkali metals or alkaline earth metals (such as sodium, potassium, calcium, or magnesium).

[0035] In the pharmaceutical compositions of the present invention, the content of the active ingredient is generally a safe and effective amount, which should be adjustable by those skilled in the art. For example, the dosage of the active ingredient usually depends on the patient's weight, the type of application, the condition and severity of the disease. For example, the dosage of the active ingredient can usually be 1-1000 mg / kg / day, 20-200 mg / kg / day, 1-3 mg / kg / day, 3-5 mg / kg / day, 5-10 mg / kg / day, 10-20 mg / kg / day, 20-30 mg / kg / day, 30-40 mg / kg / day, 40-60 mg / kg / day, 60-80 mg / kg / day, 80-100 mg / kg / day, 100-150 mg / kg / day, 150-200 mg / kg / day, 200-300 mg / kg / day, 300-500 mg / kg / day, or 500-1000 mg / kg / day.

[0036] Those skilled in the art can determine the effective dosage based on the severity of the condition and the recipient's health status and age. The effective dosage typically varies between 0.01 ng / kg body weight and approximately 100 mg / kg body weight.

[0037] In a fourth aspect, this application provides a method for treating human ACO2 protein-related diseases, the method comprising: administering an effective amount of vitamin A or a pharmaceutically acceptable salt thereof to a subject.

[0038] The role and effect of invention

[0039] The present invention provides the application of 6-hydroxy-4β-(4-hydroxy-3-methoxyphenyl)-3α-hydroxymethyl-5-methoxy-3,4-dihydro-2-naphthaldehyde in the preparation of ACO2 protein agonists and its application in the preparation of drugs for treating diseases related to human ACO2 protein, wherein the diseases related to human ACO2 protein include ischemic heart disease associated with pathological myocardial remodeling, diabetic cardiomyopathy and hypertensive myocardial hypertrophy, as well as ACO2 deficiency (a rare disease), Parkinson's disease, Alzheimer's disease, Huntington's disease, and tumors (chemosensitization, metabolic intervention), etc.

[0040] The 6-hydroxy-4β-(4-hydroxy-3-methoxyphenyl)-3α-hydroxymethyl-5-methoxy-3,4-dihydro-2-naphthal provided by this invention can serve as a natural small-molecule agonist for ACO2. The binding constant KD value of the compound isovitexin with ACO2, measured using surface plasmon resonance (SPR) technology, is 9.73 μM, which significantly enhances the enzyme activity of ACO2. The natural small-molecule agonist isovitexin VA discovered in this invention can provide a foundation for drug development to treat diseases related to ACO2, such as ischemic heart disease associated with pathological myocardial remodeling, diabetic cardiomyopathy and hypertensive myocardial hypertrophy, as well as ACO2 deficiency (a rare disease), Parkinson's disease, Alzheimer's disease, Huntington's disease, and tumors. Using two classic animal models—isoproterenol-induced mouse myocardial remodeling and aortic arch constriction-induced mouse myocardial remodeling—and after 30 days of continuous gavage administration, combined with histopathological sections and biochemical index measurements, we comprehensively confirmed the good in vivo activity of vitexin A (VA) in improving pathological myocardial remodeling, providing a potential candidate drug for the development of drugs for the treatment of diseases related to pathological myocardial remodeling.

[0041] The compound of this invention, vitexin VA, is the first natural small molecule agonist of ACO2 discovered since it was first reported in the literature. It is expected to become a first-in-class therapeutic drug for diseases related to human ACO2 protein. Further structural optimization is possible, and it has a very good application prospect. Attached Figure Description

[0042] Figure 1 This study investigated the effects of Vitedoin A (VA) on the clinical involution (CWI) of mice induced by various methods for pathological myocardial remodeling. (A) Pathological myocardial remodeling model induced by subcutaneous injection of Iso in mice; (B) Pathological myocardial remodeling model induced by TAC surgery in mice; n=5-8, ***P<0.001, **P<0.01, *P<0.05;

[0043] Figure 2 This study investigated the effect of different doses of Vitedoin A (VA) on Iso subcutaneous injection-induced myocardial remodeling in mice using H&E staining. (A) Typical H&E staining images of cross-sections of mouse heart tissue in each group under low magnification. (B) Typical H&E staining images of cross-sections of mouse heart tissue in each group under high magnification.

[0044] Figure 3 This study investigated the effect of different doses of Vitedoin A (VA) on TAC-induced myocardial remodeling in mice using H&E staining. (A) Typical H&E staining images of cross-sections of mouse heart tissue in each group under low magnification. (B) Typical H&E staining images of cross-sections of mouse heart tissue in each group under high magnification.

[0045] Figure 4 This study investigated the effect of Vitedoin A (VA) treatment on Iso-induced myocardial fibrosis in mice. (A) Typical image of a whole-heart cross-section stained with Sirius red in a low-power microscopic section of mouse heart tissue; (B) Typical image of a local tissue section stained with Sirius red in a high-power microscopic section of mouse heart tissue; (C) Statistical analysis of the proportion of cardiac collagen fibers in each group. n=3-5, ****P<0.0001, **P<0.01;

[0046] Figure 5 This study evaluated the effect of Vitedoin A (VA) treatment on TAC-induced myocardial fibrosis in mice using Sirius red staining. (A) Typical images of Sirius red staining of cardiac tissue sections from both groups of mice; (B) Statistical analysis of the proportion of collagen fibers in the two groups. n=5, *P<0.05;

[0047] Figure 6 This study investigated the effect of Vitedoin A (VA) on the expression of myocardial fibrosis markers mRNA in mice with pathological myocardial remodeling induced by different methods. (A) Iso-induced pathological myocardial remodeling model, (B) TAC-induced pathological myocardial remodeling model. n=3, ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05;

[0048] Figure 7 This study investigated the effect of Vitedoin A (VA) on the mean cardiac subcutaneous atrial fibrillation (CSA) in mice with Iso-induced pathological myocardial remodeling. (A) Typical WGA-stained heart sections from each group under high magnification. (B) Statistical analysis of mean CSA in each group. n=3–5, ***P<0.001, *P<0.05;

[0049] Figure 8 This study investigated the effect of Vitedoin A (VA) on the mean cardiac subcutaneous atrophy (CSA) of mice undergoing transarterial cardiac remodeling (TAC). (A) High-power microscopy, typical WGA-stained images of heart sections from each group of mice. (B) Statistical analysis of the mean CSA of each group of animals. n=4, **P<0.01;

[0050] Figure 9 This study investigated the effect of Vitedoin A (VA) on the expression of mRNA markers of cell hypertrophy in mice induced by different surgical procedures for pathological myocardial remodeling. (A) Iso-induced pathological myocardial remodeling model, (B) TAC-induced pathological myocardial remodeling model. n=3, ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05.

[0051] Figure 10 The effect of Vitedoin A (VA) on the stability of ACO2 protein in cell heat transfer experiments.

[0052] Figure 11 The surface plasmon resonance (SPR) analysis of recombinant Aconitase 2 (ACO2) protein and Vitedoin A (VA) was performed.

[0053] Figure 12 This is an assay for the activity of Aconitase 2 protease. Detailed Implementation

[0054] Experimental methods in the following examples, unless otherwise specified, are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0055] In this invention, the therapeutic effects of Vitedoin A (VA), the main active ingredient of Vitex negundo, on pathological myocardial remodeling induced by Iso injection and TAC surgery in mice were investigated at different dosages to determine the therapeutic effects of Vitedoin A (VA), the main active ingredient of Vitex negundo total lignans, on pathological myocardial remodeling induced by Iso injection and TAC surgery.

[0056] The present invention will now be described in detail with reference to the embodiments and accompanying drawings, but the implementation of the present invention is not limited thereto.

[0057] Example 1: Preparation of Vitedoin A (VA)

[0058] 1.1. Preparation of total lignans from Vitex negundo fruit

[0059] After properly pulverizing Vitex negundo seeds and passing them through a No. 1 sieve, the extract was refluxed twice at 75°C with 10 times the volume of 70% ethanol for 1 hour each time. The extract was then filtered to obtain the total lignan extract. The total lignan extract was concentrated to a density of approximately 1 g / L, and extracted twice with an aqueous phase:ethyl acetate (v:v) ratio of 1:4. The extracts were combined. The ethyl acetate fraction was dried under reduced pressure, dissolved in 4% ethanol-water mixture, and loaded onto LX-3020 macroporous resin at a concentration of 1.5 g / L total lignans. The resin was eluted with 20% ethanol for 4 BV to remove impurities and 40% ethanol for 8 BV. The 40% ethanol fraction was combined, concentrated under reduced pressure at 50°C, dried under vacuum at 45°C, and passed through an 80-mesh sieve to obtain the total lignan raw material powder.

[0060] 1.2. Separation and Purification

[0061] The total lignans were loaded onto a normal-phase silica gel column using dichloromethane:methanol = 20:1 as the mobile phase. Thin-layer chromatography (TLC) was used to monitor the eluent, and the eluents rich in vitamin A (VA) were combined. After the solvent was recovered and evaporated to dryness, the eluent was loaded onto a normal-phase silica gel column using 100% ethyl acetate as the mobile phase. TLC was used to monitor the eluent, and the eluents rich in VA were combined. After the solvent was recovered and evaporated to dryness, the eluent was dissolved in methanol and loaded onto a reversed-phase C18 silica gel column using methanol:water = 2:3 as the mobile phase. TLC was used to monitor the eluent, and the eluents rich in VA were combined. The combined eluents were concentrated under reduced pressure, and the concentrate was crystallized at 4°C. After filtration, high-purity vitexin yellow needle-like crystals were obtained, and the supernatant was the component rich in VA. The VA-rich components were loaded onto a normal-phase silica gel column. Ethyl acetate:petroleum ether = 1:1 was used as the mobile phase. Thin-layer chromatography was used to monitor the eluent. The eluent containing only VA was combined, concentrated under reduced pressure, and dried to obtain a high-purity VA powder compound.

[0062] Combination 1 H-NMR, 13 C-NMR, DEPT 1 H- 1 Spectroscopic data from HCOSY, HSQC, HMBC, and NOESY (Zheng CJ, Huang BK, Han T, Zhang QY, Zhang H, Rahman K, Qin LP. Nitricoxides cavenging lignans from Vitexnegundo seeds. J. Nat. Prod., 2009, 72(9): 1627–1630), the chemical structure of VA is shown below:

[0063] .

[0064] Example 2: In vivo activity and target study of isovitedoin A (VA)

[0065] 2.1. Isoproterenol (Iso) solution induction of model and Vitedoin A (VA) administration by gavage

[0066] Thirty male C57 mice were randomly selected, with 6 mice chosen as the normal control group (Sham). The remaining 24 mice were randomly divided into three groups: a model control group (model), a low-dose administration group, and a high-dose administration group, with 8 mice in each group. The remaining 24 mice were subcutaneously injected with isoproterenol solution in their backs, at a dose of 5 mg / kg on day 1, and 2.5 mg / kg subcutaneously from day 2 to day 30. The normal control group mice were subcutaneously injected with physiological saline at a dose of 10 mL / kg for 30 days. The modeling method and grouping of the VA group were the same as those of the TOV group.

[0067] Dosage regimen: VA was dissolved in 0.1% CMC-Na solution. Starting from the second day, mice were administered 0.1% CMC-Na solution by gavage to the control group, 10 mg / kg in the low-dose group, and 40 mg / kg in the high-dose group. Administration was performed at fixed times daily for 30 consecutive days.

[0068] 2.2. Aortic coarctation (TAC) surgical modeling and administration of Vitedoin A (VA) via gavage

[0069] Forty C57 mice were anesthetized with intraperitoneal injection of 0.8% sodium pentobarbital (80 mg / kg) and then underwent thoracic aortic coarctation (TAC). The specific surgical procedure was as follows: After the animals were fixed in a supine position, a combined cervical-thoracic incision (approximately 0.8 cm) was made, and the sternothyroid muscle was meticulously dissected to expose the aortic arch. Using microsurgical techniques, a 26GL catheter was inserted between the left common carotid artery and the brachiocephalic artery as a coarctation template, and aortic arch coarctation was performed using 6-0 silk sutures. Postoperative confirmation criteria included: ultrasound examination showing a peak blood flow velocity at the stenosis ≥ twice that of normal mice.

[0070] Administration regimen: After surgery, mice were housed in the animal facility for 3 days and administered 5000 U of penicillin sodium intramuscularly daily. Aortic arch blood flow velocity was measured by ultrasound. Mice meeting the inclusion criteria were randomly divided into a model control group (model) and a treatment group. Vitamin A was dissolved in 0.1% CMC-Na solution. Starting from day 4, mice in the model control group were administered 0.1% CMC-Na solution via gavage, while mice in the treatment group received 40 mg / kg of vitamin A solution. Administration was performed once daily at a fixed time for 30 consecutive days.

[0071] 2.3. mRNA expression detection

[0072] 2.3.1. RNA extraction from cardiac tissue and cells

[0073] Randomly select heart samples and weigh 5-10 mg of heart tissue into a 2 mL enzyme-free homogenizing tube containing steel balls. Add 1 mL of pre-chilled TRIzol Reagent lysis buffer. Place the sample-containing homogenizing tube into a high-throughput homogenizer and homogenize for 2 min, twice (pre-chill the plate before homogenization), until the homogenized liquid is turbid and there is no visible solid tissue. Remove the homogenizing tube from the high-throughput homogenizer and incubate on ice for 10 min, then centrifuge at 12000 × g for 15 min at 4℃. Carefully remove the homogenizing tube and transfer the supernatant to a brand new 1.5 mL enzyme-free EP tube.

[0074] After incubating the supernatant of the lysed sample at room temperature for 5 min, chloroform was added at a ratio of 1:3 (v / v), and the mixture was vortexed for 15 s to form an emulsion. After standing for 3 min, the emulsion was centrifuged at 12000 × g for 15 min at 4 °C until the layers separated. The upper aqueous phase was transferred to a new 1.5 mL EP tube, and an equal volume of isopropanol was added and gently inverted to mix. After standing at room temperature for 10 min, the emulsion was centrifuged at 12000 × g for 15 min at 4 °C to obtain the RNA precipitate. The precipitate was washed with 75% ethanol (prepared with DEPC water), centrifuged at 7500 × g for 5 min at 4 °C, and dried for 30 min. After the precipitate became clear, 20 μL of DEPC water was added to dissolve it (gently pipetting and aspirating ≥10 times).

[0075] 2.3.2. RNA Reverse Transcription

[0076] Before reverse transcription of RNA into cDNA, the concentration of RNA in the sample is quantified using a nucleic acid protein concentration analyzer. The specific procedure should be followed according to the analyzer's instruction manual. Then, reverse transcription is performed using a kit. The reverse transcription reaction solution system is prepared according to the components shown in Table 1, and RNA reverse transcription is performed under the conditions shown in Table 2.

[0077] Table 1. RNA reverse transcription reaction solution system (10 μL)

[0078] Components content 5×Primer Script RT Master Mix 2 μL Total RNA 500 ng DEPC water Up to 10 μL

[0079] Table 2 Conditions for RNA reverse transcription

[0080] step temperature Duration 1 37 15 min 2 85 5 s 3 4 continued

[0081] The operation requires a low-temperature environment, so it should be performed on ice. After the system is prepared, briefly centrifuge to mix and then perform reverse transcription. The obtained cDNA sample can be used directly for RT-qPCR or stored at -20°C.

[0082] 2.3.3. RT-qPCR Experiment

[0083] Configure the reaction system according to the components described in Table 3, and perform the PCR reaction according to the reaction conditions described in Table 4. Primer information is shown in Table 5.

[0084]

[0085]

[0086] 2.3.4. Primer sequence information

[0087] Table 5 Summary of Primer Information

[0088] Primer names (F: Forward; R: Reverse) Sequence (5'-3') COL1A1-F CCCTGAAGTCAGCTGCAT (SEQ ID NO.1) COL1A1-R ATATTCTTCTGGGCAGAA (SEQ ID NO.2) COL3A1-F TGGTCCTCAGGGTGTAAAGG (SEQ ID NO.3) COL3A1-R GTCCAGCATCACCTTTTGG (SEQ ID NO.4) αSMA-F GGACGTACAACTGGTATTGTGC (SEQ ID NO.5) αSMA-R TCGGCAGTAGTCACGAAGGA (SEQ ID NO.6) GAPDH-F TGAAGCAGGCATCTGAGGG (SEQ ID NO.7) GAPDH-R CGAAGTGGAAGAGTGGGAG (SEQ ID NO.8) ANP-F ACAGCCAAGGAGGAAAAGGC (SEQ ID NO.9) ANP-R CCACAGTGGCAATGTGACCA (SEQ ID NO.10) BNP-F AAGTCCTAGCCAGTCTCCAGA (SEQ ID NO.11) BNP-R GAGCTGTCTGGGCCATTTC (SEQ ID NO.12) β-MHC-F GATGTTTTTGTGCCCGATGA (SEQ ID NO.13) β-MHC-R ACCGTCTTGCCATTCTCCG (SEQ ID NO.14)

[0089] 2.4. Surface Plasmon Resonance (SPR) Experiment

[0090] Recombinant Aconitase 2 (ACO2) protein was immobilized on a CM5 chip via an amino-coupled cross-linking reaction. AVA samples were dissolved in PBS buffer containing 5% DMSO to prepare a series of concentration gradients of AVA solutions. The samples were injected into the SPR system at a rate of 30 μL / min, and the binding time between the sample and recombinant ACO2 protein was set to 60 s, with a dissociation time of 300 s. The interaction mode and kinetic constants between the sample and protein were obtained using the 1:1 steady-state affinity model in the evaluation software of the Biacore T200 system.

[0091] 2.5. Detection of aconitase (ACO2) activity

[0092] 2.5.1. Extraction of cis-aconitase from cytoplasm and mitochondria

[0093] Add 0.5 mL of Reagent I and 5 μL of Reagent III to the cells and homogenize them on ice using a homogenizer or mortar. Centrifuge at 600 × g for 5 min at 4 °C. Transfer the supernatant to another centrifuge tube and centrifuge at 11000 × g for 15 min at 4 °C. Add 200 μL of Reagent II and 2 μL of Reagent III to the precipitate and sonicate on ice (300 W, 3 s, 9 s interval, repeated 15 times). Centrifuge at 5000 × g for 2 min at 4 °C. Collect the supernatant and place it on ice for analysis. This step is used to determine the cis-aconitase activity in mitochondria and to measure the protein concentration.

[0094] 2.5.2. Measurement Procedure:

[0095] Preheat the microplate reader for at least 30 minutes, adjust the wavelength to 240 nm, and preheat the reagent kit to 25°C for at least 15 minutes. See Table 6 for relevant procedures.

[0096] Table 6 Measurement Procedure

[0097]

[0098] Based on the sample protein concentration, ACO enzyme activity (U / mg prot) = [∆A×Vtotal:(ε×d)×102]2 9 (Vsample × Cp) ÷ T × N = 555.55 × ∆A ÷ Cp × N

[0099] Vreaction_total: Total volume of the reaction system, L; ε: Extinction coefficient of cis-aconitine, 3.6 L / mmol / cm; d: Hematoxylin and eosinophilic path length of 1 mL quartz, 1 cm; Vsample: Volume of sample added, 0.1 mL; Vsample_total: Total volume of mitochondrial sample, 0.606 mL; T: Reaction time, 5 min; Cpr2: Protein concentration of sample, mg / mL: 10 6 Unit conversion factor, 1 mmol = 1 × 10 6 nmol; N: dilution factor; W: sample mass, g.

[0100] 2.6. Cell thermal transfer (CETSA) experiment

[0101] Cells were cultured until they reached a good growth state and a density of approximately 80%, and then treated with vitamin A for 24 h. Cells were digested with 0.25% trypsin-EDTA, centrifuged (1000×g, 5 min, room temperature) to pellet the cells, and resuspended in 1 ml of PBS containing 1% protein inhibitor / PMSF. The supernatant was discarded after centrifugation. The cells were then resuspended again in PBS containing 1% protein inhibitor / PMSF, mixed thoroughly, aliquoted into PCR tubes, heated at a gradient temperature (40-60℃) for 3 min, and cooled to 4℃. The cells were subjected to five freeze-thaw cycles in liquid nitrogen, centrifuged, and the supernatant was collected. SDS-PAGE Loading Buffer was added, and the cells were incubated at 95℃ for 10 min. Western blotting was performed using an SDS-PAGE gel.

[0102] 2.7. Statistical Analysis

[0103] Data analysis in this study was performed using GraphPad Prism 8.0 software, and data visualization followed international biomedical charting standards. Experimental data were presented as mean ± standard error (Mean ± SEM). Independent samples t-tests were used for comparisons between normally distributed groups with homogeneous variances; otherwise, rank-sum tests were used. One-way ANOVA was used for univariate comparisons among multiple groups.

[0104] 2.7. Results

[0105] 2.7.1. Vitedoin A (VA) reduced CWI in mice with pathological myocardial remodeling induced by multiple methods.

[0106] Mice were administered vitamin A by gavage for 30 consecutive days. Their body weight and heart weight were measured, and the cardiac weight index (CWI) was calculated.

[0107] In a mouse model of pathological myocardial remodeling induced by subcutaneous Iso injection, the results showed ( Figure 1 A) Compared with the normal control group, the CWI in the model group was significantly increased (P<0.001), indicating that the pathological myocardial remodeling model induced by subcutaneous injection of iso was successfully established. Compared with the model group, the CWI in the 10 mg / kg VA administration group was decreased (P<0.05), and the CWI in the 40 mg / kg VA administration group was significantly decreased (P<0.01). In summary, this indicates that VA has a dose-dependent effect on pathological myocardial remodeling.

[0108] In a mouse model of pathological myocardial remodeling induced by TAC surgery, the results showed ( Figure 1 B), compared with the Model group, the CWI of mice in the 40 mg / kg VA administration group was significantly reduced (P<0.05).

[0109] 2.7.2. Vitedoin A (VA) reduced abnormal cardiomyocyte structure and morphology in mice with pathological myocardial remodeling induced by various methods.

[0110] Heart tissue was taken for routine pathological sectioning and H&E staining for observation.

[0111] In a mouse model of pathological myocardial remodeling induced by subcutaneous Iso injection, the results showed ( Figure 2 In normal mice, the cardiomyocytes showed normal structure and uniform staining. Compared with the Sham group, the Model group showed enlarged hearts, increased intercellular matrix, and enlarged cardiomyocytes in some areas. After 30 days of administration of high and low doses of vitamin A, the myocardial structure in the high and low dose groups was close to normal compared with the Model group, with smaller cardiomyocytes and reduced intercellular matrix.

[0112] In a mouse model of pathological myocardial remodeling induced by TAC surgery, the results showed ( Figure 3 Compared with the Model group, the cardiomyocyte structure of mice in the 40 mg / kg VA administration group was close to normal, and the intercellular matrix was reduced.

[0113] 2.7.3. Vitedoin A (VA) reduced cardiac collagen deposition in mice with pathological myocardial remodeling induced by multiple methods.

[0114] Heart tissue was taken for routine pathological sectioning and Sirius red staining for observation.

[0115] In a mouse model of pathological myocardial remodeling induced by subcutaneous Iso injection, the results showed ( Figure 4In the normal mouse group, the myocardial cells had normal structure, less collagen deposition, and uniform staining. After induction by subcutaneous injection of Iso, the collagen deposition in the heart of the model group mice was significantly increased (P < 0.0001). Compared with the model group, the collagen deposition in the heart of mice in the high-dose 40 mg / kg VA group was reduced (P < 0.01), and the collagen deposition in the heart of mice in the low-dose 10 mg / kg VA group showed a decreasing trend but no statistical difference.

[0116] In a mouse model of pathological myocardial remodeling induced by TAC surgery, the results showed ( Figure 5 Compared with the Model group, the 40 mg / kg VA group showed significantly reduced cardiac collagen deposition (P < 0.05).

[0117] 2.7.4. Vitedoin A (VA) reduced the expression levels of myocardial fibrosis factor mRNA in mice with pathological myocardial remodeling induced by various methods.

[0118] To further verify that VA can reduce collagen deposition in mice with pathological myocardial remodeling induced by different methods, heart tissues from 6 mice in each group were randomly selected, and the transcriptional levels of fibrosis-related indicators were detected by RT-qPCR.

[0119] In a mouse model of pathological myocardial remodeling induced by subcutaneous Iso injection, the results showed ( Figure 6 A) Compared with the Sham group, the mRNA expression of fibrosis markers such as COL1A1, COL3A1 and α-SMA was significantly increased in the Model group; compared with the Model group, the expression of fibrosis-related marker mRNA was significantly reduced after treatment with 10 mg / kg and 40 mg / kg VA.

[0120] In a mouse model of pathological myocardial remodeling induced by TAC surgery, the results showed ( Figure 6 B) Compared with the Model group, the fibrosis-related indicators of mice in the 40 mg / kg VA administration group were significantly reduced.

[0121] 2.7.5. Vitedoin A (VA) reduces pathological myocardial hypertrophy induced by various methods.

[0122] Heart tissue was taken for routine pathological sectioning and WGA staining for observation.

[0123] In a mouse model of pathological myocardial remodeling induced by subcutaneous Iso injection, the results showed ( Figure 7In the normal mouse group, the myocardial cells had normal structure and uniform staining. In the model group induced by subcutaneous injection of Iso, compared with the normal control group, the average cross-sectional area of ​​myocardial cells was significantly increased (P < 0.001), and the intercellular matrix was increased. Compared with the model group, the average CSA in the low-dose group showed a decreasing trend but no statistical difference. The average CSA in the high-dose VA administration group was decreased (P < 0.05).

[0124] In a mouse model of pathological myocardial remodeling induced by TAC surgery, the results showed ( Figure 8 Compared with the Model group, the mice in the 40 mg / kg VA administration group had a smaller mean CSA (P < 0.01) and a more regular morphology.

[0125] 2.7.6. Vitedoin A (VA) reduced the expression level of myocardial hypertrophy mRNA in mice with pathological myocardial remodeling induced by various methods.

[0126] Previous WGA staining results of cardiac tissue sections showed that VA could alleviate cardiomyocyte hypertrophy in mice with pathological myocardial remodeling induced by different methods. To further verify this result, heart samples were randomly selected from each group of mice, and the transcriptional levels of cell hypertrophy-related indicators were detected by RT-qPCR.

[0127] In a mouse model of pathological myocardial remodeling induced by subcutaneous Iso injection, the results showed ( Figure 9 A) Compared with the Sham group, the mRNA expression of cell masturbation indicators such as ANP, BNP and β-MHC in the Model group was significantly increased; compared with the Model group, the mRNA expression level of cell masturbation-related indicators was significantly reduced after different doses of TOV treatment.

[0128] In a mouse model of pathological myocardial remodeling induced by TAC surgery, the results showed ( Figure 9 B) Compared with the Model group, the transcriptional expression of cell hypertrophy-related indicators was significantly reduced in mice in the 40 mg / kg VA administration group.

[0129] 2.7.7. Vitedoin A (VA) directly binds to Aconitase 2 protein, enhancing its thermal stability.

[0130] The interaction between VA and Aconitase2 protein was further verified by heat transfer assay after DMSO and VA treatment in HL-1 cells. Results are as follows: Figure 10As shown, the Aconitase 2 protein in both the control DMSO group and the drug VA treatment group degraded with increasing temperature, i.e., the protein abundance gradually decreased. However, at 48℃, 50℃, and 52℃, the Aconitase 2 protein abundance in the VA treatment group was significantly higher than that in the DMSO group, indicating that Vitedoin A can bind to Aconitase 2 protein, enhance its stability, and inhibit its degradation.

[0131] 2.7.8. Vitedoin A (VA) has a strong specific binding affinity to Aconitase 2 (ACO2) protein.

[0132] To further confirm the specific binding of VA to the ACO2 protein, surface plasmon resonance (SPR) assays were used to assess the affinity between VA and ACO2. The results are as follows: Figure 11 The results showed that VA and ACO2 exhibited strong specific binding activity, and the two could directly bind with a KD of 9.73 μM.

[0133] 2.7.9. Vitedoin A enhances the activity of Aconitase 2 (ACO2) protein.

[0134] To investigate whether VA exerts its effect by enhancing or inhibiting ACO2 activity, ACO2 activity was measured in HL-1 cells after treatment with DMSO and different concentrations of VA. The results showed ( Figure 12 VA can increase the activity of ACO2 protein in a concentration-dependent manner. This indicates that VA works by enhancing ACO2 activity and is an agonist of ACO2.

[0135] 2.8. Analysis Results

[0136] A sympathetic excitation-induced myocardial remodeling model was established in C57BL / 6J mice by subcutaneous injection of isoproterenol (Iso). Based on the content of VA in TOV (Total Volucular Venous Deficiency), 40 mg / kg was selected as the high dose and 10 mg / kg as the low dose. After 30 days of gavage treatment with the two doses of VA, compared with the model group, the VA-treated group showed significantly reduced CWI (Continuous Wound Scale), reduced CVF%, and smaller CSA (Cardiomyocyte Scale), with myocardial structure approaching normal, cardiomyocytes shrinking, and reduced intercellular matrix. The mRNA expression levels of fibrosis-related indicators COL1A1, COL3A1, and α-SMA were significantly reduced, as were the mRNA expression levels of cell hypertrophy-related indicators ANP, BNP, and β-MHC. Moreover, the improvement effect of 40 mg / kg VA was more significant than that of 10 mg / kg VA, indicating that the anti-pathological myocardial remodeling effect of VA has a certain dose-dependent effect. To further verify the efficacy of vitamin A (VA), a pathological myocardial remodeling model with aortic arch constriction (TAC, where peak blood flow at the stenosis was twice that of normal mice was considered a successful model) was constructed. After screening, mice were treated with 40 mg / kg VA. Results showed that the VA-treated group exhibited downregulated expression of myocardial fibrosis markers and mRNAs related to cardiomyocyte hypertrophy, significantly reduced CVF%, CWI, and mean CSA. In conclusion, VA can alleviate pathological myocardial remodeling caused by various factors.

[0137] To further explore the molecular mechanism by which vitamin A (VA) exerts its anti-pathological myocardial remodeling effect, this study employed multiple experimental techniques to systematically detect the direct binding interaction between compound VA and the target protein ACO2 at different levels, while also analyzing the regulatory effect of VA on ACO2 function. First, a cell heat transfer assay was used to detect the binding of VA to ACO2 protein and the effect of VA on ACO2 protein stability. The results showed that ACO2 protein in both the control and drug-treated groups degraded with increasing temperature. At 48℃, 50℃, and 52℃, the abundance of ACO2 protein in the VA-treated group was significantly higher than that in the control group, confirming that VA can specifically bind to ACO2 and enhance its stability and inhibit its degradation. Based on this, surface plasmon resonance (SPR) technology was used to systematically detect the interaction between compound VA and the target protein ACO2, and to analyze the regulatory effect of VA on ACO2 enzyme activity. The experimental results showed that compound VA can specifically bind to ACO2 protein, with a KD value of 9.73 μM. Further verification through enzyme activity assays revealed that VA treatment significantly increased the enzyme activity of ACO2, suggesting that VA is an agonist of ACO2. By specifically binding to ACO2, it can regulate its enzyme activity, thereby mediating downstream signaling pathways and ultimately exerting an interventional effect on pathological myocardial remodeling. This also lays an important foundation for further in-depth analysis of the molecular regulatory network of VA in combating pathological myocardial remodeling.

[0138] The undescribed parts of this invention are the same as or implemented using existing technology. The applicant declares that this invention is illustrated through the above specific embodiments, but the invention is not limited to the above detailed methods, i.e., it does not mean that the invention must rely on the above detailed methods to be implemented. Those skilled in the art should understand that any improvements to this invention, equivalent substitutions of raw materials for the product of this invention, additions of auxiliary components, and selection of specific methods all fall within the protection and disclosure scope of this invention.

Claims

Application of 1,6-hydroxy-4β-(4-hydroxy-3-methoxyphenyl)-3α-hydroxymethyl-5-methoxy-3,4-dihydro-2-naphthaldehyde (isoviticin) in the preparation of aconitase 2 (ACO2) protein agonists.

2. An ACO2 protein agonist, characterized in that, The active component is the aforementioned vitexin.

3. Application of isovitexin in the preparation of drugs for treating human ACO2 protein-related diseases.

4. The application according to claim 3, characterized in that, The aforementioned human ACO2 protein-related diseases are caused by the downregulation of human ACO2 protein expression or activity.

5. The application according to claim 3 or 4, characterized in that, The human ACO2 protein-related diseases are selected from any of the following types of diseases: pathological myocardial remodeling-related diseases, ACO2 deficiency, neurodegenerative diseases, and tumors.

6. The application according to claim 5, characterized in that, The pathological myocardial remodeling-related diseases include ischemic heart disease, diabetic cardiomyopathy, hypertensive myocardial hypertrophy, myocardial infarction, and heart failure. The neurodegenerative diseases mentioned include Parkinson's disease, Alzheimer's disease, and Huntington's disease; The tumors are selected from solid tumors or non-solid tumors (leukemia) with altered ACO2 expression or activity.

7. The application according to claim 6, characterized in that, The drug described is one that improves mitochondrial energy metabolism by activating ACO2 enzyme activity.

8. A pharmaceutical composition, characterized in that, It contains a therapeutically effective amount of 6-hydroxy-4β-(4-hydroxy-3-methoxyphenyl)-3α-hydroxymethyl-5-methoxy-3,4-dihydro-2-naphthaldehyde or a salt thereof, along with a pharmaceutically acceptable carrier or excipient.

9. The pharmaceutical composition according to claim 8, characterized in that, The dosage form of the pharmaceutical composition is tablets, capsules, injections, granules, or oral liquid preparations.

10. The pharmaceutical composition according to claim 8, characterized in that, This drug composition is used in combination with other drugs for treating human ACO2 protein-related diseases.

Images