Use of ythdf2 as a therapeutic target for doxorubicin-induced cardiotoxicity injury

Abstract

The application provides application of YTHDF2 as a therapeutic target of doxorubicin-induced cardiotoxicity injury, and belongs to the technical field of biological medicine.The application takes YTHDF2 as a therapeutic target of doxorubicin-induced cardiotoxicity injury, and finds that YTHDF2 inhibitors can be used for preventing and treating doxorubicin-induced cardiotoxicity injury.In the embodiment of the application, AAV9 virus packaged YTHDF2 shRNA is used on a mouse individual in a manner of intravenous injection, can improve doxorubicin-induced myocardial cell apoptosis and cardiac fibrosis and partially restore cardiac function, and provides a new candidate drug and a clear target for solving the problem of doxorubicin cardiotoxicity in clinic.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of YTHDF2 as a therapeutic target for doxorubicin-induced cardiotoxicity. Background Technology

[0002] Doxorubicin is an anthracycline chemotherapy drug with significant efficacy against various malignant tumors. However, its clinical application is severely limited by dose-dependent cardiotoxicity. Doxorubicin-induced cardiotoxicity typically manifests as cardiomyocyte apoptosis, oxidative stress, mitochondrial dysfunction, endoplasmic reticulum stress, and cardiac fibrosis, ultimately leading to heart failure and severely impacting patients' quality of life and prognosis. Currently, there are no effective drugs to prevent and treat doxorubicin-induced cardiotoxicity. Prevention is usually limited to dose restriction and the use of drugs such as dexrazoxane, but the effects are limited and other side effects exist. Therefore, developing novel, highly effective, and targeted drugs to prevent or treat doxorubicin-induced cardiotoxicity is of significant clinical and social value.

[0003] YTHDF2 (YTH N6-methyladenosine RNA binding protein 2) is m 6 A key member of the A-reading protein family, its main function is to recognize and bind to mRNA on mRNA. 6 A-modification promotes the degradation of target mRNA. Studies have shown that YTHDF2 plays a key regulatory role in various pathophysiological processes. In recent years, its role in cardiovascular diseases has gradually attracted attention. However, whether and how YTHDF2 participates in doxorubicin-induced cardiotoxicity remains unclear. Summary of the Invention

[0004] This invention provides the application of YTHDF2 as a therapeutic target for doxorubicin-induced cardiotoxicity. Interfering with the expression of YTHDF2 in myocardial tissue can produce a significant therapeutic effect on doxorubicin-induced cardiotoxicity.

[0005] This invention provides specific inhibition YTHDF2 The use of molecules that inhibit gene transcription or translation, or specifically suppress the expression or activity of YTHDF2 protein, in the preparation of drugs for the prevention and / or treatment of doxorubicin-induced cardiotoxic injury.

[0006] In one embodiment of the present invention, the molecule is selected from any one of the following: nucleic acid molecules, antibody drugs, and interfering lentiviruses.

[0007] In one embodiment of the present invention, the nucleic acid molecule includes any of the following types: siRNA, shRNA, dsRNA, microRNA, and antisense oligonucleotides.

[0008] In one embodiment of the present invention, the sequence of the siRNA is shown in SEQ ID No. 3.

[0009] In one embodiment of the present invention, the sequence of the shRNA is shown in SEQ ID No. 1.

[0010] The present invention also provides reagents for loading and delivering siRNA and / or shRNA, wherein the sequence of the siRNA is shown in SEQ ID No. 3; The sequence of the shRNA is shown in SEQ ID No. 1.

[0011] In one embodiment of the present invention, the reagent comprises the shRNA packaged using AAV virus.

[0012] In one embodiment of the present invention, the serotype of the AAV virus includes AAV9.

[0013] The present invention also provides a medicament for preventing and / or treating doxorubicin-induced cardiotoxicity, the active ingredients comprising the above-mentioned reagents and pharmaceutically acceptable excipients.

[0014] In one embodiment of the present invention, the viral titer of the working solution of the reagent in the drug is 2 × 10⁻⁶. 13 vg / mL.

[0015] Beneficial Effects: This invention targets YTHDF2 as a therapeutic target for doxorubicin-induced cardiotoxicity, discovering that YTHDF2 inhibitors can be used to prevent and treat doxorubicin-induced cardiotoxicity. In this embodiment, YTHDF2 shRNA packaged with AAV9 virus was administered intravenously to mice, which improved doxorubicin-induced cardiomyocyte apoptosis and cardiac fibrosis and partially restored cardiac function, providing a novel candidate drug and a clear target for clinically addressing the challenge of doxorubicin-induced cardiotoxicity. Attached Figure Description

[0016] Figure 1 A graph showing the change in YTHDF2 expression in cardiac tissue 5 weeks after intraperitoneal injection of doxorubicin, as detected by Western blotting. Figure 2 Flowchart of mouse modeling by tail vein injection of AAV9-cTnT-shScr / AAV9-cTnT-shYTHDF2 followed by intraperitoneal injection of saline / doxorubicin for 5 weeks; Figure 3A graph showing changes in YTHDF2 expression detected by Western blotting; Figure 4 The image shows the effect of echocardiography after intravenous injection of AAV9-cTnT-shYTHDF2; Figure 5 Image showing the effect of TUNEL staining after intravenous injection of AAV9-cTnT-shYTHDF2; Figure 6 This image shows the results of Sirius red staining of mouse heart tissue. Detailed Implementation

[0017] This invention provides specific inhibition YTHDF2 The use of molecules that inhibit gene transcription or translation, or specifically suppress the expression or activity of YTHDF2 protein, in the preparation of drugs for the prevention and / or treatment of doxorubicin-induced cardiotoxic injury.

[0018] This invention uses YTHDF2 as a therapeutic target for doxorubicin-induced cardiotoxicity. The YTHDF2 gene is: Human (Gene ID: 51441), Mouse (Gene ID: 213541), and Rat (Gene ID: 313053). In the embodiments, this invention found that YTHDF2 inhibitors can be used to prevent and treat doxorubicin-induced cardiotoxicity, and these YTHDF2 inhibitors can specifically inhibit… YTHDF2 This invention relates to molecules that inhibit gene transcription or translation, or molecules that specifically inhibit the expression or activity of the YTHDF2 protein. The invention does not specifically limit the type of the molecule; any molecule with YTHDF2 inhibitor function may be used, such as any of the following: nucleic acid molecules, antibody drugs, and interfering lentiviruses. Specifically, the types of nucleic acid molecules include any of the following: siRNA, shRNA, dsRNA, microRNA, and antisense oligonucleotides.

[0019] In one embodiment of the present invention, the expression of the YTHDF2 gene in myocardial tissue is interfered with using siRNA and shRNA. The siRNA is designed using the sequence shown in SEQ ID No. 2 as the target sequence. The sequence of the siRNA is shown in SEQ ID No. 3 in this embodiment. The siRNA sequence shown in SEQ ID No. 3 is then inserted into an shRNA structural template to construct the shRNA shown in SEQ ID No. 1. The structure and insertion method of the shRNA structural template described in this invention have been described in the article (Chang K, Marran K, Valentine A and Hannon GJ. Creating an miR30-based shRNA vector). Cold Spring Harb ProtocThis has been published in (2013;2013:631-5.), and will not be repeated here.

[0020] shRNA (SEQ ID No. 1): 5'-GAAGGTATATTGCTGTTGACAGTGAGCGAAGGACGTTCCCAATAGCCAATAGTGAAGCCACAGATGTATTGGCTATTGGGAACGTCCTTTGCCTACTGCCTCGG-3'; SEQ ID No.2: 5'-AAGGACGTCCCAATAGCCAA-3'; siRNA (SEQ ID No. 3): 5'-AAGGACGTTCCAATAGCCAA-3'.

[0021] The present invention also provides reagents for loading and delivering siRNA and / or shRNA, wherein the sequence of the siRNA is shown in SEQ ID No. 3; The sequence of the shRNA is shown in SEQ ID No. 1.

[0022] The reagents described in this invention include shRNA packaged with AAV9 virus. This invention does not specifically limit the method of packaging AAV9 virus; conventional methods in the art can be used for virus packaging.

[0023] The present invention also provides a medicament for preventing and / or treating doxorubicin-induced cardiotoxicity, the active ingredients comprising the above-mentioned reagents and pharmaceutically acceptable excipients.

[0024] This invention does not specifically limit the dosage form of the drug. In one embodiment, it is an intravenous injection solution. In this embodiment, YTHDF2 shRNA packaged with AAV9 virus is administered as a working solution via tail vein injection at a dose of 50 μL per mouse. The results showed that the drug could improve doxorubicin-induced cardiomyocyte apoptosis and partially restore cardiac function. The viral titer of the working solution of the reagent in the drug of this invention is 2 × 10⁻⁶. 13 vg / mL.

[0025] To further illustrate the present invention, the application of YTHDF2 provided by the present invention as a therapeutic target for doxorubicin-induced cardiotoxicity is described in detail below with reference to embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0026] The applicant previously conducted systematic research on YTHDF2 and myocardial ischemia-reperfusion injury, and published relevant research findings (Xu GE, Yu P, Hu Y, et al. Exercise training decreases lactylation and prevents myocardial ischemia-reperfusion injury by inhibiting YTHDF2. Basic Res Cardiol. 2024;119:651-671.). These results suggest that YTHDF2 plays an important regulatory role in myocardial ischemia-reperfusion. Based on these findings, it is reasonable to infer that YTHDF2 may play a regulatory role in other types of myocardial injury (including drug-induced cardiotoxicity), thus providing a technical motivation for further research and development as an intervention target. In this invention, it was found that YTHDF2 was significantly upregulated in a mouse model of doxorubicin-induced cardiotoxicity; therefore, YTHDF2 was investigated as a potential intervention target for doxorubicin-induced cardiotoxicity.

[0027] Example 1 1. Construction of YTHDF2 shRNA: First, the sequence of YTHDF2 (human species: Gene ID: 51441, mouse species: Gene ID: 213541) was obtained from the NCBI database. The siRNA sequence shown in SEQ ID No. 3 was designed, and the designed siRNA was inserted into the shRNA structural template to construct the shRNA shown in SEQ ID No. 1. cTnT-YTHDF2 shRNA was constructed into the addgene (catalog number #105543) plasmid using the Seamless Cloning Kit (2X MultiF Seamless Assembly Mix (RK21020) abclonal) to obtain cTnT-YTHDF2 shRNA.

[0028] 2. Packaging, isolation, and purification of AAV9 virus 293T cells were seeded in 10cm cell culture dishes at a density of 3 million cells per dish. 24 hours later, 1 mL of serum-free DMEM medium containing 10 μg cTnT-YTHDF2 shRNA, 10 μg AAV capsid plasmid, 10 μg Helper plasmid (pAdDeltaF6 plasmid, purchased from Addgene Plasmid, catalog number #112867), and 90 μL PEI solution (Kingmorn, KE10980) was added to each culture dish. The AAV capsid plasmid was derived from AAV2 / 9 (purchased from Addgene Plasmid, catalog number 12865) according to the article (Vu Hong, A., Suel, L., Petat, E., Dubois, A., Le Brun, PR, Guerchet, N., Veron, P., Poupiot, J., and Richard, I. (2024). Anengineered AAV targeting integrin alpha V beta 6 presents improved myotropismacross species. Nat Commun 15 The optimized capsid plasmid, which has been optimized using publicly available optimization strategies (7965. 10.1038 / s41467-024-52002-4.), will not be described further here.

[0029] Twelve hours after transfection, the culture medium was replaced with fresh DMEM complete medium, and the virus was collected from the cells and cultures 48 hours later.

[0030] Collect the virus in the culture medium: Add 25 mL of 40% PEG-8000 to every 100 mL of cell supernatant, centrifuge overnight at 2800 g at 4°C, and then centrifuge for 15 min at 15°C. Add 1 mL of cell lysis buffer to the virus particles and resuspend them.

[0031] Virus collection in cells: Cells collected by scraping were resuspended in 5 mL of cell lysis buffer and subjected to three freeze-thaw cycles at -80°C and 37°C.

[0032] The viral suspension in the culture medium was mixed with the freeze-thawed cell suspension, and 1 mol / L magnesium chloride was added to a final concentration of 1 mmol / L. Benzodesonase (Merck) was then added to a final concentration of 250 U / mL, and the mixture was incubated at 37°C for 45 min. The supernatant was collected after centrifugation at 4000 rpm for 4 min at 4°C. The virus was purified using iodixanol gradient density centrifugation.

[0033] Viral titer detection method: The viral vector plasmid was diluted to 1 ng / μL, and the calculated plasmid copy number concentration was 1.36 × 10⁻⁶. 11 vg / mL. The plasmid was serially diluted 13 times to obtain standards 1-14, which were then used to prepare a standard curve with 2-fold dilutions of Standard DNA dilution (0.1 ng / μL or 0.001 ng / μL plasmid serial dilutions).

[0034] Take 5 μL of the purified viral AAV9-cTnT-shRNA-YTHDF2 prepared above, and extract viral gDNA using a tissue genomic DNA extraction kit (TIANGEN, DP304) according to the instructions. Elute with 50 μL ddH2O, and then dilute the viral gDNA 100 times before detecting the viral titer by qPCR.

[0035] qPCR reaction system (10 μL): 5 μL SYBR Green, 0.5 μL each of upstream primer F and downstream primer R (10 μM), 2.5 μL ddH2O, and 2 μL of standard DNA dilution or viral genomic DNA; The sequences of the upstream primer F and the downstream primer R used in the qPCR reaction are as follows: Upstream primer F (SEQ ID No. 4): 5'-AAGCAGTCTGGGCTTTCACA-3'; Downstream primer R (SEQ ID No. 5): 5'-CGGACGGAGATACGTGAGTG-3'.

[0036] The qPCR reaction program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 sec, 60℃ annealing for 30 sec, 40 cycles.

[0037] Since the logarithm of the cycle number and the concentration of Standard DNA dilution is linearly related, the viral titer is obtained through linear fitting. The AAV9 virus after titer determination can be used directly in animal experiments or frozen at -80°C.

[0038] Example 2 1. Establishment of a mouse model of cardiotoxic injury induced by doxorubicin Eight to ten-week-old wild-type male C57BL / 6J mice were used to induce cardiotoxicity by intraperitoneal injection of doxorubicin at a dose of 5 mg / kg, once a week for 5 weeks. The corresponding control model, i.e., control mice, was induced by intraperitoneal injection of an equal volume of physiological saline, once a week for 5 weeks. After the last administration, the mice were fed for 7 days and then sacrificed.

[0039] 2. AAV9-cTnT-sh-YTHDF2 injection 10 12 A dose of virus (vg / mouse) was injected into mice via tail vein injection, and a cardiotoxicity injury model was established one week later. Here, vg represents vector genome. The specific experimental procedure is as follows: First, the experimental mice were divided into four groups: control virus + saline group, control virus + doxorubicin group, AAV9-cTnT-shYTHDF2 + saline group, and AAV9-cTnT-shYTHDF2 + doxorubicin group.

[0040] One week prior to establishing the cardiac toxicity model, mice were treated with a single-use 1mL sterile syringe via tail vein injection. Figure 2 As shown, the specific method is as follows: Group 1 (control group + saline group) was administered according to 10... 12 vg / mouse; control virus was injected into the tail vein of mice, and intraperitoneal injection of physiological saline was started 1 week later. Group 2, AAV9-cTnT-shYTHDF2+ saline group, all followed the regimen of 10 12 vg / mouse, AAV9-cTnT-shYTHDF2 was injected into the tail vein of mice, and intraperitoneal injection of physiological saline began 1 week later; Group 3, the control group plus doxorubicin, both followed the regimen of 10... 12 vg / mouse; control virus was injected into the tail vein of mice, and doxorubicin was injected intraperitoneally one week later. Group 4, AAV9-cTnT-shYTHDF2 + doxorubicin group, all followed the regimen of 10 12 AAV9-cTnT-shYTHDF2 was injected into the tail vein of mice, and doxorubicin was administered intraperitoneally one week later.

[0041] One week after the fifth intraperitoneal injection of doxorubicin, color Doppler ultrasound of the heart was performed on the mice. After the examination, the mice were sacrificed and the hearts were dissected. Western blotting was first used to verify whether AAV9-cTnT-shYTHDF2 successfully reduced the expression of YTHDF2 in the heart at the animal level. Then, TUNEL immunofluorescence and Masson staining were performed on myocardial tissue sections to count the number of TUNEL-positive cells and the area of ​​tissue fibrosis.

[0042] 2.1. Western blotting to detect YTHDF2 expression in the heart 5 weeks after DOX treatment Wild-type male C57BL / 6J mice aged 8-10 weeks were used to induce cardiotoxicity by intraperitoneal injection of doxorubicin at a dose of 5 mg / kg, once a week for 5 weeks. The corresponding control model was induced by intraperitoneal injection of an equal volume of physiological saline, once a week for 5 weeks. Seven days after the last administration, the mice were sacrificed. The hearts were dissected, and proteins were extracted from the heart tissue using a phosphorylated protein extraction kit. After quantification using the BCA method, protein loading buffer was added to prepare protein samples. Western blotting was used to detect YTHDF2 expression, and changes in YTHDF2 expression were analyzed using ImageJ grayscale values.

[0043] Wild-type mice were induced to develop a DOX 5w model. Western blotting efficiency was used to verify the expression of YTHDF2 in the mouse heart after DOX 5w. Results are as follows: Figure 1 As shown, the hearts of 12 mice were examined, with 6 mice in each group. The relative expression levels of YTHDF2 in the first group were 1.037716, 1.056774, 0.979538, 1.08814, 0.923914, and 0.913917, respectively; the relative expression levels of YTHDF2 in the second group were 1.636377, 1.50743, 1.428024, 1.462253, 1.533941, and 1.525998, respectively. After intraperitoneal injection of doxorubicin for 5 weeks, the expression level of YTHDF2 in the heart tissue significantly increased.

[0044] 2.2. Western blot analysis of YTHDF2 expression changes One week after the fifth intraperitoneal injection of doxorubicin, mice were sacrificed, and their hearts were dissected. Proteins were extracted from the heart tissue using a phosphorylated protein extraction kit, quantified using the BCA method, and then added to protein loading buffer to prepare protein samples. Western blotting was used to detect YTHDF2 expression, and changes in YTHDF2 expression were analyzed by calculating grayscale values ​​using ImageJ.

[0045] The results are as follows Figure 3As shown, YTHDF2 expression was detected in the hearts of 24 mice, with 6 mice in each group. The relative expression levels of YTHDF2 in group 1 were 0.90, 1.00, 1.36, 0.91, 0.92, and 0.90, respectively; in group 2, they were 0.77, 0.49, 0.87, 0.58, 0.63, and 0.54, respectively; in group 3, they were 1.80, 1.76, 1.75, 1.28, 1.52, and 1.41, respectively; and in group 4, they were 0.72, 0.70, 0.85, 0.62, 0.75, and 0.49, respectively. The results indicate that intraperitoneal injection of doxorubicin for 5 weeks significantly increased the expression level of YTHDF2 in cardiac tissue. Intravenous injection of AAV9-cTnT-shYTHDF2 significantly reduced the expression of YTHDF2 in myocardial tissue; tail vein injection of AAV9-cTnT-shYTHDF2 significantly reduced the expression of YTHDF2 in cardiac tissue.

[0046] 2.3. Echocardiography of mice After hair removal and cleaning of the mouse chest, the mice were anesthetized with isoflurane, and their heart rate was stabilized at 450-500 beats / minute. The cardiac contractile function of the mice was assessed using a small animal echocardiography system (Visual Sonics, Vevo 2100). B-mode long-axis images of the left ventricle were acquired, and M-mode images were acquired at the point of maximum left ventricular diameter. Finally, the left ventricular ejection fraction (EF) and left ventricular short-axis shortening (FS) were calculated using the LVTrace tool.

[0047] The results are as follows Figure 4As shown, a total of 40 mice underwent echocardiography. Eight mice were from the first group, with ejection fraction (EF) of 65.484899%, 70.376487%, 72.722502%, 66.664043%, 66.271241%, 72.048921%, 77.602688%, and 75.741063%, respectively; and free fibrosis fraction (FS) of 35.559651%, 39.096168%, 40.621652%, 36.235302%, 35.653181%, 40.399126%, 45.270778%, and 43.500673%, respectively. The other eight mice were from the second group, with an EF of 61.879294%. The percentages of EF (efficiency percentage) were 64.016943%, 64.856798%, 76.494654%, 68.934688%, 64.364959%, ​​71.172769%, and 74.271555%, respectively; the free frost ratios (FS) were 32.609607%, 34.085428%, 34.939700%, 43.544152%, 37.645975%, 34.771697%, 39.470614%, and 42.021933%, respectively. Twelve of these came from the third group, with EF values ​​of 39.986128%, 49.646577%, 49.98499%, 51.486177%, 46.618787%, and 48.8%, respectively. The percentages were 0.7256%, 49.725459%, 51.6477195%, 50.619786%, 51.529026%, 47.526583%, and 49.984386%, respectively; the free frost ratios were 19.064843%, 24.488731%, 24.701494%, 25.300817%, 22.790238%, 23.989603%, 24.319007%, 25.583544%, 24.743019%, 25.625705%, 22.843256%, and 24.693189%, respectively; 12 of these came from the fourth group, with free frost ratios of 74.51942% and 69.5978%, respectively. 39%, 70.676724%, 68.237655%, 64.07528%, 67.05216%, 76.932519%, 65.668236%, 70.297024%, 65.321109%, 64.568489%, 63.823386%; FS were 42.353349%, 38.092258%, 39.070572%, 36.910151%, 34.316586%, 36.273665%, 44.551587%, 34.660946%, 38.555665%, 34.880637%, 34.503603%, 33.889919%.The results showed that doxorubicin treatment significantly induced cardiac dysfunction in mice, manifested as a decrease in ejection fraction and shortening fraction; intravenous injection of AAV9-cTnT-shYTHDF2 improved doxorubicin-induced cardiac systolic dysfunction, manifested as a significant improvement in the decrease in ejection fraction and shortening fraction induced by doxorubicin.

[0048] 2.4. Tunnel staining of mouse myocardial tissue Mouse heart tissue was frozen and sectioned, and the slides were stored at -80°C.

[0049] The specific staining method is as follows: Warm to room temperature for 15-30 minutes; wash 3 times with PBS buffer, 5 minutes each time; fix with 4% paraformaldehyde for 15 minutes; wash 3 times with PBS buffer, 5 minutes each time; permeabilize with proteinase K solution for 15 minutes; wash 3 times with PBS buffer, 5 minutes each time; equilibrate with equilibration buffer for 10 minutes; incubate with Tunel-FITC stain (Promega#G7360) at 37°C in the dark for 60 minutes; terminate the reaction with 2×SSC for 10 minutes; wash 3 times with PBS buffer, 5 minutes each time; block with 5% BSA for 60 minutes; incubate with mouse anti-α-actinin (Sigma#A7811) at 4°C in the dark overnight; wash 3 times with PBS buffer, 5 minutes each time; incubate with mouse anti-Cy3 stain (Sigma#AP124C) at room temperature in the dark for 120 minutes; wash 3 times with PBS buffer, 5 minutes each time; incubate with Hoechst (KeyGen#KGA212) stain in the dark for 30 minutes; wash 3 times with PBS buffer, 5 minutes each time.

[0050] After mounting with 50% glycerol under light-protected conditions, the samples were observed under a laser confocal microscope (Carl Zeiss, Thuringia, Germany) (Hoechst excitation wavelength 375 nm, corresponding emission wavelength 425 nm, represented by blue light; Tunel-FITC excitation wavelength 485 nm, emission wavelength 525 nm, represented by green light; Cy3 excitation wavelength 550 nm, corresponding emission wavelength 570 nm, represented by red light). Images were acquired using ZEN software, and the number of positive cardiomyocytes was counted using ImageJ.

[0051] A total of 24 heart tissue sections from the four groups of mice (n=6 per group) were subjected to TUNEL staining, and the results are as follows: Figure 5As shown, the percentages of TUNEL-positive cells in the first group of cardiac tissue sections were 1.72%, 1.97%, 1.44%, 1.51%, 1.61%, and 1.83%, respectively; in the second group, they were 1.46%, 1.34%, 1.55%, 1.78%, 1.28%, and 1.63%, respectively; in the third group, they were 9.64%, 11.38%, 12.16%, 9.94%, 11.07%, and 9.77%, respectively; and in the fourth group, they were 5.51%, 6.48%, 4.48%, 5.18%, 5.31%, and 4.23%, respectively. The results showed that intraperitoneal injection of doxorubicin significantly increased the number of apoptotic cells, i.e., Tunel-positive cells, in mouse cardiomyocytes; intravenous injection of AAV9-cTnT-shYTHDF2 improved doxorubicin-induced cardiomyocyte apoptosis, manifested as a significant reduction in the number of apoptotic cardiomyocytes.

[0052] 2.5. Sirius Red Staining of Mouse Heart Tissue Mouse heart tissue was fixed overnight with 4% PFA (paraformaldehyde), then sequentially immersed in 75% ethanol overnight, 85% ethanol for 1.5 h, 95% ethanol for 1.5 h, then in fresh 95% ethanol for 1 h, then in anhydrous ethanol for 1 h, then in fresh anhydrous ethanol for 0.5 h, then in anhydrous ethanol:xylene 1:1 solution for 0.5 h, then in xylene for 0.5 h, then in fresh xylene for 0.5 h, and finally immersed in molten paraffin for 2 h, followed by embedding. Paraffin sections with a thickness of 5 mm were prepared. After dewaxing, the sections were immersed in Sirius Red A solution at room temperature for 2 h, rinsed with running water for 2 s, air-dried, mounted with neutral resin, and observed under a bright-field microscope (normal tissue appears yellow, fibrosis appears red). Images were acquired and the fibrosis percentage was statistically analyzed using ImageJ.

[0053] Sirius red staining was performed on 24 heart tissue sections from the above 4 groups (6 animals in each group), and the results are as follows. Figure 6As shown, the statistical fibrosis levels of the heart tissue sections in the first group were 0.44%, 0.49%, 0.43%, 0.28%, 0.32%, and 0.39%, respectively; those in the second group were 0.21%, 0.26%, 0.29%, 0.45%, 0.44%, and 0.44%, respectively; those in the third group were 8.42%, 10.05%, 7.12%, 9.87%, 8.18%, and 7.84%, respectively; and those in the fourth group were 3.30%, 3.86%, 5.71%, 4.04%, 4.39%, and 3.41%, respectively. The results demonstrate that intraperitoneal injection of doxorubicin significantly increased cardiac tissue fibrosis in mice, while intravenous injection of AAV9-cTnT-shYTHDF2 improved doxorubicin-induced cardiac tissue fibrosis.

[0054] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Specific inhibition YTHDF2 The use of molecules that inhibit gene transcription or translation, or specifically suppress the expression or activity of YTHDF2 protein, in the preparation of drugs for the prevention and / or treatment of doxorubicin-induced cardiotoxic injury.

2. The application according to claim 1, characterized in that, The molecules are selected from any of the following: nucleic acid molecules, antibody drugs, and interfering lentiviruses.

3. The application according to claim 2, characterized in that, The types of nucleic acid molecules include any of the following: siRNA, shRNA, dsRNA, microRNA, and antisense oligonucleotides.

4. The application according to claim 3, characterized in that, The sequence of the siRNA is shown in SEQ ID No.

3.

5. The application according to claim 3, characterized in that, The sequence of the shRNA is shown in SEQ ID No.

1.

6. A reagent for loading and delivering siRNA and / or shRNA, characterized in that, The sequence of the siRNA is shown in SEQ ID No. 3; The sequence of the shRNA is shown in SEQ ID No.

1.

7. The reagent according to claim 6, characterized in that, The reagent includes the shRNA packaged using AAV virus.

8. The reagent according to claim 7, characterized in that, The serotype of the AAV virus includes AAV9.

9. A drug for preventing and / or treating doxorubicin-induced cardiotoxicity, characterized in that, The active ingredient includes the reagents and pharmaceutically acceptable excipients as described in any one of claims 6 to 8.

10. The drug according to claim 9, characterized in that, The viral titer of the working solution of the reagent in the drug is 2 × 10⁻⁶. 13 vg / mL.

Images