A polypeptide for targeted therapy of skeletal dysplasia based on interaction between FBXW4 and CCT5 and application thereof
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- THE OBSTETRICS & GYNECOLOGY HOSPITAL OF FUDAN UNIV
- Filing Date
- 2026-04-01
- Publication Date
- 2026-06-09
Smart Images

Figure CN122167556A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to a targeted therapeutic polypeptide for osteodystrophy that specifically blocks the interaction between FBXW4 and CCT5 and restores the phase separation function of CCT5, and its application. Background Technology
[0002] Idiopathic short stature (ISS) and skeletal dysplasia are a group of serious, heterogeneous genetic disorders characterized by impaired longitudinal bone growth. Clinically, recombinant human growth hormone (GH) is the standard treatment for these diseases. However, a large number of patients, despite having normal GH levels, are insensitive to GH treatment (i.e., growth hormone insensitivity, GHI), resulting in poor treatment outcomes and currently, there is little clinical treatment available for these patients.
[0003] Recent studies have revealed that protein ubiquitination degradation pathways play a crucial role in bone morphogenesis. For example, impaired function of the CRL7 ubiquitin ligase complex leads to 3M syndrome (a rare form of primitive dwarfism); and gain-of-function mutations in FBXW4, the substrate recognition component of the CRL1 E3 ligase complex, are closely associated with severe idiopathic dwarfism. Previous and concurrent studies in this invention have shown that both loss of CRL7 function and overactivation of FBXW4 ultimately lead to the same result: excessive ubiquitination and degradation of the free subunit of the classic molecular chaperone complex TRiC—the monomeric CCT5.
[0004] More importantly, the study found that monomeric CCT5 is not merely a component of the protein folding machine; it possesses a "moonlighting function" independent of the TRiC complex. Monomeric CCT5 is an RNA-binding protein capable of liquid-liquid phase separation (LLPS), forming phase-separated droplets that act as a translation hub for key mRNAs in chondrogenesis (such as SOX9, IGF1R, and COL1A1). Excessive degradation and depletion of monomeric CCT5 leads to the collapse of these phase-separated droplets, triggering severe translational arrest and causing chondrocytes to lose responsiveness to upstream growth signals (such as IGF1). This is the core pathological mechanism leading to growth hormone-insensitive dwarfism and skeletal dysplasia.
[0005] The existing technology has the following problems: (1) Lack of symptomatic drugs: At present, clinical intervention is still mainly based on the injection of growth hormone, which cannot solve the problem of "growth hormone insensitivity" caused by the blocked translation of receptors such as IGF1R. (2) Lack of targeted intervention: Although it is known that overactivation of FBXW4 will lead to pathological degradation of CCT5, there are no targeted drugs or small molecule inhibitors in the existing technology that can specifically block the interaction between FBXW4 and CCT5.
[0006] Therefore, there is an urgent need to develop a novel treatment strategy that can stabilize the level of monomeric CCT5 in vivo, restore its phase separation and translation hub function, and ultimately reverse skeletal developmental defects. Summary of the Invention
[0007] To address the lack of effective targeted therapies for non-growth hormone deficiency dwarfism and 3M syndrome in existing technologies, this invention provides a polypeptide (TR polypeptide and RR polypeptide) that blocks the interaction between FBXW4 and CCT5 and its application in the preparation of drugs for treating skeletal dysplasia.
[0008] This invention elucidates the molecular mechanism by which FBXW4 recognizes and degrades the monomer CCT5, identifying two key motifs at the N-terminus of CCT5 (located in amino acid residues 14-25 and 76-87, respectively) as essential degrons for FBXW4 recognition. Based on this, this invention designs competitive "decoy peptides," namely, by fusing the aforementioned CCT5 recognition motifs with membrane-penetrating peptides (such as the TAT domain), constructing TR and RR peptides capable of penetrating cell membranes.
[0009] To achieve the above-mentioned technical objectives, the present invention adopts the following technical solution: One objective of this invention is to provide a polypeptide composition comprising a core recognition peptide, wherein the core recognition peptide comprises the N1-1b peptide and / or the N1-4a peptide of the CCT5 protein; the amino acid sequence of the N1-1b peptide is shown in SEQ ID NO.1; and the amino acid sequence of the N1-4a peptide is shown in SEQ ID NO.2.
[0010] Furthermore, the polypeptide composition further includes a cell-penetrating peptide, which is linked to the N-terminus or C-terminus of the core recognition peptide; the amino acid sequence of the cell-penetrating peptide is shown in SEQ ID NO.3.
[0011] A second objective of this invention is to provide the application of the aforementioned polypeptide composition in the preparation of a competitive inhibitor targeting FBXW4.
[0012] A third objective of this invention is to provide a polypeptide inhibitor, wherein the active ingredient of the polypeptide inhibitor includes the polypeptide composition.
[0013] Furthermore, the inhibitor may also include one or more pharmaceutically acceptable carriers, excipients, or excipients.
[0014] A fourth objective of this invention is to provide the use of the polypeptide composition or the polypeptide inhibitor in the preparation of products for treating skeletal dysplasia.
[0015] Furthermore, the product is a medication for treating skeletal dysplasia.
[0016] Furthermore, the skeletal dysplasia includes idiopathic dwarfism caused by gain-of-function mutations in FBXW4, and 3M syndrome caused by loss of function of the CRL7 complex.
[0017] Furthermore, the drug is suitable for patients with normal or elevated serum growth hormone levels who are insensitive to growth hormone.
[0018] Furthermore, the dosage form of the drug is selected from injections, solutions, emulsions, suspensions, microneedle patches, or nano-delivery sustained-release formulations.
[0019] Compared with the prior art, the present invention has the following beneficial effects: 1. Precise targeted competitive inhibition: The TR and RR peptides provided by this invention can enter cells through the membrane in a dose-dependent manner, and act as "decoys" to specifically preempt and bind to the FBXW4 complex, thereby replacing and protecting the endogenous monomer CCT5 from pathological ubiquitination degradation.
[0020] 2. Revolutionary mechanism repair (restoration of phase separation and translation hub): By stabilizing the protein level of monomeric CCT5, the peptide of this invention can successfully restore the ability of CCT5 to form liquid-liquid phase separation (LLPS), reassemble the eIF4B-rich translation hub, and completely remove the "translation blockade" of key cartilage-related mRNAs such as SOX9, IGF1R and COL1A1.
[0021] 3. Excellent in vivo therapeutic effect (cured disease model): In in vivo models (including the Fbxw4 knock-in mouse model with patient mutation and the Ccdc8 knockout model representing 3M syndrome), intra-articular injection or systemic administration of the present invention's polypeptide (TR polypeptide) to pregnant mice can significantly restore the extracellular matrix tissue of chondrocytes, significantly increase the length of the tibia and femur in mice, successfully rescue skeletal dysplasia, and effectively prevent perinatal lethality in 3M syndrome model mice.
[0022] In summary, this invention provides a first-in-class targeted peptide drug for the treatment of idiopathic short stature, 3M syndrome, and skeletal system diseases characterized by growth hormone insensitivity, which are clinically intractable. Attached Figure Description
[0023] Figure 1 This invention presents the design and synthesis of CCT5-derived "decoy" peptides (TR and RR). (A) Schematic diagram of CCT5 truncated mutants (P1-P3, N1-N2, and motifs 1-6). (BE) Co-IP experiments performed in HEK293T cells gradually determined that N1-1b (amino acids 14-25) and N1-4a (amino acids 76-87) of the CCT5 protein are the main motifs mediating its binding to FBXW4. (F) Sequences of cell-penetrating peptides TAT, TR (targeting amino acids 14-25), and RR (targeting amino acids 76-87).
[0024] Figure 2 This image illustrates the effect of the TR / RR peptide in this invention on blocking the degradation of CCT5 and restoring phase separation (LLPS) at the cellular level. (A) shows the results of an in vitro competitive binding assay (Co-IP). (B) shows the results of intracellular ubiquitination level detection (Western blot). (C) shows the results of intracellular CCT5 protein homeostasis detection (Western blot). (D) shows a fluorescence microscopy image (left) and a quantitative statistical graph (right) of intracellular CCT5 undergoing liquid-liquid phase separation (LLPS). The images show that the mutant cell (FBXW4)... C328Y In the FBXW4, the punctate aggregates (Puncta) of CCT5 essentially disappeared (fluorescence showed a diffuse distribution); while after treatment with TR peptides (FBXW4) C328Y +TR), CCT5 re-formed distinct phase-separated aggregates in the cytoplasm, and the aggregate area ratio was completely restored ( p<0.001). Scale bar is 5 μm. (E) is the result of RNA immunoprecipitation combined with quantitative PCR (RIP-qPCR). The results confirmed that in mutant cells, the binding of translation initiation factor EIF4B to SOX9 mRNA, a key target gene for chondrogenesis, was disrupted; while the addition of TR peptide successfully reconstructed this binding. p<0.01).
[0025] Figure 3 This invention demonstrates the TR peptide rescue process. Mouse cartilage development defects and related protein expression. (AB) Immunohistochemical analysis: (A) Representative immunohistochemical (IHC) staining images of CCT5, SOX9, and IGF1R in cartilage tissue. Compared with wild-type... , +TAT control group and +TR treatment group. (B) Quantitative score of corresponding protein expression intensity. Results showed... Histone levels were significantly decreased, while TR treatment significantly restored their expression. (C) Western Blot analysis: Detection of FBXW4, CCT5, SOX9, and IGF1R protein levels in pure cartilage tissue. The numbers represent CCT5 / The ratio of -actin. The results confirmed... This leads to the degradation of proteins such as CCT5, while TR can effectively inhibit this decline. (DE) Von-Kossa staining: (D) Von-Kossa staining of limb sections for observation of calcification / mineralization (black areas). (E) Quantitative analysis of the percentage of positive areas. TR treatment significantly improved... Insufficient mineralization in mice. (FG) Safranin O-Fast Green staining: (F) Safranin O staining of cartilage tissue; red indicates proteoglycan content. (G) Quantitative analysis of positive areas. Severe loss of cartilage matrix was observed, and TR treatment showed a significant salvage effect. (H) HE staining: Histological morphological observation of the tibial growth plate region showed that TR treatment improved the structure of the growth plate. (IJ) Gross morphology and bone length measurement: (I) Morphological photographs of isolated tibia and femur. (J) Quantitative measurement of bone length. TR treatment significantly restored... Shortened long bone length in mice.
[0026] Figure 4 This invention demonstrates the TR peptide rescue model for 3M syndrome. - / - Phenotypic and developmental lethality of ). (A) Cell-level rescue experiments: In various pathogenic cell models (CCDC8-KO, CUL7) L1588P FBXW4 C328Y In the study, Western blotting results showed that TR peptide treatment effectively reversed the decrease in CCT5, SOX9, COLIA1, and IGF1R protein levels. The grayscale ratios below indicate that TR restored protein levels to near-wild-type or higher. (BD) Prenatal rescue and embryonic development analysis: (B) By administering... Pregnant mice were injected with either TR or TAT peptides after mating, and the number of surviving mice at each week after birth was counted. The TR-treated group successfully produced... Homozygous mice survived to birth (P0), while 0 mice in the TAT group survived. (C) Gross morphological observation of embryos at E18.5 days. (D) Statistical analysis of embryo weight at E18.5 days; results showed no significant difference in weight among groups during the embryonic period (ns). (E) Embryonic tissue protein detection: Western blot analysis of mouse tissues at E18.5 days showed that TR treatment significantly improved... Levels of CCT5 and SOX9 in embryos. (F) Survival curve analysis: Kaplan-Meier survival curves showed that TR peptide treatment significantly prolonged survival compared to the TAT group (which had a very short median survival). Lifespan of mice (Log-rank test, p=0.0035). Detailed Implementation
[0027] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention. The reagents, products, and instruments used in the following examples are all commercially available, and the methods used in the examples, unless otherwise specified, are consistent with conventionally used methods.
[0028] The technical solution of the present invention will be further described in detail below with reference to the embodiments.
[0029] Example 1: Design and Synthesis of CCT5-Derived "Collateral" Peptides (TR and RR) Through immunoprecipitation (IP) and structural truncation mutation analysis, the inventors precisely identified two essential degrons on the CCT5 protein that bind to FBXW4: 14-25 aa (RPFLIIKDQDRK, sequence SEQ ID NO.1) and 76-87 aa (TILSMMDVDHQI, sequence SEQ ID NO.2).
[0030] To deliver these blocking peptides into cells, the cell-penetrating peptide sequence TAT (YGRKKRRQRRR, sequence SEQ ID NO. 3) from HIV was covalently linked to the N-terminus of the two sequences using standard solid-phase peptide synthesis (SPPS), and named TR peptide and RR peptide, respectively. After synthesis and purification, the purity was verified to be >95% by mass spectrometry (MS) and high-performance liquid chromatography (HPLC).
[0031] The specific experimental method is as follows: (A) Cell Culture and Treatment: HEK293T cells were obtained from the American Type Culture Collection (ATCC). DNA footprinting and PCR were used to routinely verify the cell line's authenticity and absence of mycoplasma contamination. The cell line was cultured in DMEM medium with 15% FBS at 37°C in a 5% CO2 incubator. For transient transfection, Lipo8000 was used. TM (Beyotime) or Lipofectamine 2000 (Thermo Fisher Scientific) transfected cells according to the manufacturer's instructions.
[0032] (B) Plasmid Construction: Plasmids for transient overexpression were constructed using the pCS2-FLAG and pCS2-HA vectors (Clontech). Point mutants and deletion mutants were constructed using Phanta Max Super-Fidelity DNA polymerase (VazymeBiotech) according to the manufacturer's instructions. The specific procedure is as follows: (1) PCR amplification of genes The PCR reaction system consists of primers, template, thermostable DNA polymerase, and dNTPs. The PCR template is cDNA reverse transcribed from RNA extracted from human HEK293T cells. The specific PCR reaction system is shown in Table 1 below (taking CCT5 amplification as an example): Primer sequence: CCT5-F (SEQ ID NO.4): CCTACCGGTACGCGTATGGCGTCCATGGGGAC CCT5-R (SEQ ID NO.5): CTTTGTAGTCGCCCATGGTTTCTTCAGATTCTCCAG Table 1 PCR reaction system
[0033] The PCR reaction procedure is shown in Table 2 below: Table 2 PCR reaction procedure
[0034] (2) Enzyme digestion of plasmid vector Taking the digestion of the PCS2-FLAG plasmid vector with XbaI restriction endonuclease as an example, the digestion system is shown in Table 3 below: Table 3 Enzyme digestion system
[0035] After adding the enzyme digestion system, incubate at 37°C for 1 hour.
[0036] (3) Purification of PCR products and enzyme digestion products The PCR and enzyme digestion products were subjected to agarose gel electrophoresis. After 30 min of electrophoresis, the band sizes of the PCR and enzyme digestion products were observed using a nucleic acid UV gel excision gel analyzer. The gel was then excised for recovery. Gel purification and recovery were performed using a kit, following the instructions: First, weigh the gel (weigh the empty tube first, cut out the gel and put it into the empty tube, weigh it again, and the difference between the two is the weight of the gel). Add an appropriate volume of sol solution to the gel in the centrifuge tube (at a ratio of 100 μL to 0.1 g of gel). Place in a 65℃ metal bath to dissolve completely for 15 minutes, inverting and mixing several times during the process to help dissolve completely. After the gel is completely dissolved, the sol solution on the tube wall is collected by centrifugation at low speed, transferred to the adsorption column and centrifuged at 12,000 rpm for 2 min. Discard the liquid collected from the adsorption column, add 600 μL of rinsing solution again, centrifuge at 12000 rpm for 2 min, and repeat once more. Remove the liquid from the collection tube, centrifuge at 12000 rpm for 2 min; Discard the liquid collected in the adsorption column, open the column cap, and air dry aseptically for 15 minutes, during which time the eluent is preheated to 65°C. Add 35 μL of preheated elution buffer (65℃) to the adsorption column, dissolve thoroughly for 1 min, centrifuge at 12000 rpm for 2 min, and collect the eluted liquid into a new centrifuge tube, which is the purified DNA product.
[0037] (4) Ligation reaction of PCR product and enzyme digestion plasmid vector The ligation reaction is a one-step clonal homologous recombination ligation system, as shown in Table 4 below: Table 4 Connection Method System
[0038] After adding the mixture, place it in a 37°C water bath for 30 minutes to fully connect. The ligation product will be used for the next step of converting competent cells.
[0039] (5) Transformation of Escherichia coli competent cells DH5α and plating Take 20 μL of competent cells and place them in an ice bath to thaw slowly. Then add them to the recombinant product, mix well, and incubate in an ice bath for 20 min. Heat shock in a 42℃ water bath for 90 seconds, followed by an ice bath for 2 minutes; Add 800 μL of LB medium preheated at 37℃ and incubate at 37℃ in a shaker for 1 h; Centrifuge at 3000 rpm for 5 min, then remove 700 μL of supernatant; Resuspend the remaining bacteria with a pipette, and spread the bacterial solution evenly on ampicillin or kanamycin agar plates using a sterile spreader in a clean bench. Invert the container and place it in a 37°C incubator overnight.
[0040] (6) Colony inoculation, plasmid mini-preparation and sequencing Use a sterile toothpick or pipette tip to pick up colonies that have grown overnight on the agar plate and inoculate them into sterilized LB medium in a 50 mL centrifuge tube (medium volume: 25 mL). Incubate overnight at 37°C in a horizontal shaker. The next day, centrifuge at 4000 rpm for 15 min using a floor centrifuge, discard the supernatant, and collect the bacterial cells for plasmid extraction.
[0041] Plasmids were extracted using the plasmid mini-extraction kit from Shanghai Tiangen Biotech Co., Ltd. The specific experimental steps were performed according to the kit instructions: Add the RNase provided with the kit to Buffer P1 before use to prevent RNA contamination during plasmid extraction. Add 500 μL of Buffer P1 mixed with RNase to the bacterial cells, resuspend by pipetting with a 2 mL pipette tip, and transfer to a 2 mL centrifuge tube; Add 500 μL of Buffer P2, cap the centrifuge tube, and gently invert to mix. Add 500 μL Buffer P4, cap the centrifuge tube, gently invert to mix, and let stand for 2 min; Centrifuge at 4℃, 12000 rpm for 10 min; Transfer the supernatant to the filter cartridge, being careful not to aspirate the white precipitate at the bottom of the centrifuge tube. Centrifuge at 4°C and 12,000 rpm for 2 minutes. Add 1 / 3 volume of isopropanol to the filtered supernatant, mix gently, and let stand for 2 minutes to allow the plasmid DNA to precipitate efficiently. Add 500 μL of Buffer BL to the adsorption column and centrifuge at 12000 rpm for 2 min at 4 °C to equilibrate the adsorption column. The liquid after isopropanol precipitation was added to the adsorption column for DNA adsorption. The column was centrifuged at 4°C and 12,000 rpm for 2 min. After centrifugation, the liquid in the collection tube was removed. Add 600 μL of Wash Buffer (add 60 mL of anhydrous ethanol before use), centrifuge at 12000 rpm for 2 min at 4°C, and repeat once more. Remove the liquid from the collection tube, and centrifuge at 4°C, 12000 rpm for 2 min. Open the cap of the adsorption column and air dry it aseptically for 15 minutes, while simultaneously preheating ddH2O at 65℃. Add 200 μL of preheated ddH2O to the air-dried adsorption column, cover and let stand for 2 min to fully dissolve the DNA. Replace the collection tube under the adsorption column with a new 1.5 mL centrifuge tube, centrifuge at 4℃, 12000 rpm for 2 min, and the liquid in the 1.5 mL centrifuge tube is the extracted plasmid. The concentration of extracted plasmids and the OD260 / 280 ratio were measured using NanoDrop2000 for subsequent sequencing, enzyme digestion, transfection and other experiments. 10 μL of the extracted plasmid was sent to Beijing Qingke Biotechnology Co., Ltd. for Sanger sequencing. The forward primer for the pCS2 vector was SP6, and the reverse primer was T7. By comparing the sequencing results, the plasmid that successfully cloned the gene can be obtained.
[0042] (C) Immunoprecipitation: HEK293T cells were cultured in 6cm culture dishes until the density reached over 70%. The pCS2-HA-FBXW4 plasmid was co-transfected with pCS2-FLAG-CCT5 wild-type and various mutant plasmids. Cells were collected 36 h after transfection. Cells were lysed using IP lysis buffer (Beyotime) at 4°C for 15 min, centrifuged at 12000 rpm for 15 min, and the supernatant was collected. 20 μL of anti-FLAG magnetic beads were added to each cell lysis buffer and incubated overnight at 4°C. The magnetic beads were collected, washed three times with IP lysis buffer, and all liquid was removed. 50 μL of 1×SDS loading buffer was added, and the cells were boiled at 95°C for 10 min. Western blot was used to detect the interaction between CCT5 wild-type and various mutant plasmids and FBXW4.
[0043] Experimental results are as follows Figure 1 As shown. By Figure 1 The experimental results show that amino acid sequences 14-25 aa (RPFLIIKDQDRK) and 76-87 aa (TILSMMDVDHQI) of the CCT5 protein are the amino acid sequences in which the interaction between CCT5 and FBXW4 depends. The deletion of these two segments of the CCT5 protein greatly eliminates the interaction with FBXW4.
[0044] The two short peptide fragments mentioned above are linear polypeptides. Based on the two amino acid sequences that depend on the interaction between CCT5 and FBXW4, these two amino acid sequences were used to synthesize in vitro CCT5-derived short peptides. The HIV-derived TAT sequence YGRKKRRQRRR (SEQ ID NO.3) was directly added to the N-terminus through in vitro amino acid chemical synthesis to enhance cell membrane permeability. The two short peptides were named TR and RR. TAT was used as a control peptide because it cannot interact with FBXW4.
[0045] Example 2: TR / RR peptide blocks degradation and restores phase separation (LLPS) at the cellular level. 1) Interaction and ubiquitination blocking assays: In HEK293T cell lines co-expressing overactive FBXW4 mutants and CCT5, 20 μM of TR or RR peptides were added for incubation. Western blot results showed that the TR peptide significantly replaced the endogenous complex, greatly inhibiting FBXW4-mediated ubiquitination modification of monomeric CCT5 at the K48 link, and significantly prolonging the half-life of monomeric CCT5 protein.
[0046] 2) Phase-separated droplet recovery assay: Human cartilage C28 / I2 cell lines containing mutations were edited using CRISPR / Cas9. Under pathological conditions, intracellular CCT5 fluorescence was diffuse. After incubation with TR peptides, liquid-liquid phase separation (LLPS) of CCT5 was clearly observed to re-emerge under a fluorescence microscope, forming punctate aggregates (Puncta). RIP-qPCR confirmed that the recovered phase-separated droplets successfully recruited eIF4B and the target mRNA (SOX9, IGF1R), restarting the translation process. Specific materials and methods are as follows: Experimental materials: (A) Cell lines: HEK293T cells (used for in vitro co-transfection and binding experiments). C28 / I2 chondrocyte cell line. Parental: wild-type parental cells. FBXW4 C328Y mutant cell line: FBXW4 C328Y mutant cells were knocked into C28 / I2 cells using CRISPR / Cas9 technology (mimicking the pathological state of short stature / skeletal dysplasia).
[0047] (B) Plasmids and Constructs: FBXW4-HA expression vector (FBXW4 with HA tag). CCT5-FLAG expression vector (CCT5 with FLAG tag). HA-Ub expression vector (ubiquitin with HA tag, used for ubiquitination detection).
[0048] (C) Synthetic Peptides: TAT: Control peptide (control group). RR peptide: Contains amino acids 76-87 of CCT5 + TAT membrane-penetrating sequence. TR peptide: Contains amino acids 14-25 of CCT5 + TAT membrane-penetrating sequence (core rescue drug).
[0049] (D) Chemicals & Antibodies: MG132: Proteasome inhibitor. Antibodies: anti-FLAG, anti-HA, anti-CCT5, anti-FBXW4, anti- -actin, anti-EIF4B. Agarose / magnetic beads: used for immunoprecipitation (e.g., anti-HA beads, anti-FLAG beads, Protein A / G beads).
[0050] Fluorescent dye: DAPI (for staining cell nuclei). RNA-related reagents: Trizol, cDNA reverse transcription kit, qPCR Mix.
[0051] Experimental methods: (A) In vitro competitive binding assay (In vitro Peptide Competition Co-IP).
[0052] Objective: To verify whether the designed peptide can specifically disrupt the binding of FBXW4 and CCT5.
[0053] Procedure: FBXW4-HA and CCT5-FLAG plasmids were co-transfected into HEK293T cells. Cells were collected after 48 hours, and total protein lysis buffer (Input) was extracted. Before immunoprecipitation (IP), excess amounts of control peptides TAT, RR peptide, or TR peptide were added to the cell lysis buffer for in vitro co-incubation. The FBXW4 complex was enriched using anti-HA magnetic beads. After washing, the precipitated CCT5-FLAG signal was detected by Western blot (WB). The blocking efficiency of the peptides was assessed by calculating the IP / Input ratio.
[0054] (B) In vivo Ubiquitination Assay Objective: To verify whether TR peptides can inhibit the ubiquitination modification of CCT5 by pathological FBXW4 in living cells.
[0055] Operation: In FBXW4 C328YMutant C28 / I2 cells were transfected with CCT5-FLAG and HA-Ub plasmids. Cells were treated with TAT or TR peptides. Six hours before cell collection, the proteasome inhibitor MG132 (10 μL) was added. M), to accumulate ubiquitinated proteins. Cells are collected and lysed under denaturing conditions. CCT5 protein is pulled down (IP) using anti-FLAG magnetic beads. The pulled-down product is detected by Western blotting using an anti-HA antibody; the "smear" band indicates the polyubiquitination level of CCT5.
[0056] (C) Endogenous protein homeostasis assay (Protein Stability / Steady-state Assay) Objective: To verify whether TR peptide can restore the protein abundance of endogenous CCT5 in pathological cells.
[0057] Operation: Connect Parental and FBXW4 C328Y C28 / I2 cells were treated with either TAT or TR peptides. Cells were lysed, and total protein was extracted. Western blot analysis was performed directly, and the protein levels of endogenous CCT5 and FBXW4 were detected using specific antibodies. -actin As an internal reference, calculate CCT5 / -The relative grayscale ratio of actin.
[0058] (D) Immunofluorescence and Phase Separation Droplet Observation (LLPS Puncta) Objective: To observe whether the monomeric CCT5 can reform phase-separated condensates (Puncta) in the cytoplasm under peptide intervention.
[0059] Operation: Use Parental, or FBXW4 processed with TAT or TR. C328Y C28 / I2 cells were seeded in glass-bottomed culture dishes suitable for laser confocal microscopy. Cells were fixed, permeabilized, and blocked. Incubation was performed with a primary antibody against CCT5 and a secondary antibody with a fluorescent tag (e.g., green fluorescence); cell nuclei were stained blue with DAPI. The distribution of CCT5 in the cytoplasm (diffuse vs. granular / droplet-like) was observed using confocal microscopy. The percentage of Puncta (punctate structures) in each cell was quantitatively determined using image analysis software (e.g., ImageJ).
[0060] (E) RNA immunoprecipitation and quantitative PCR (RIP-qPCR) Objective: To verify whether the translation initiation factor (EIF4B) can re-recruit and bind to target developmental mRNAs (such as SOX9) after the TR peptide restores CCT5 homeostasis.
[0061] Procedure: C28 / I2 cells from the corresponding treatment groups were collected. RNA-protein complexes were cross-linked using UV light or formaldehyde, followed by cell lysis. Immunoprecipitation was performed using a specific anti-EIF4B antibody (with IgG as a negative control) to pull out EIF4B and its bound RNA complex. After washing, the cross-links were decross-linked and the enriched RNA was extracted. The RNA was reverse transcribed into cDNA. Real-time quantitative PCR (qPCR) was performed using primers specific to the SOX9 gene. The binding strength of EIF4B to the target mRNA was assessed by calculating the fold enrichment.
[0062] Table 5 Primer List
[0063] Experimental results are as follows Figure 2 As shown. By Figure 2 The experimental results show that the TR peptide competitively inhibits the binding of FBXW4 to CCT5, significantly reduces the ubiquitination level of CCT5, and restores its protein stability. More importantly, the TR peptide can promote the reformation of liquid-liquid phase separation condensates of monomeric CCT5 in the cytoplasm and re-establish the binding of translation initiation factor eIF4B to key chondrogenic mRNAs (such as SOX9), thereby restoring the translation hub function.
[0064] Example 3 TR polypeptide in Fbxw4 Skeletal rescue in knock-in (idiopathic dwarfism) mouse model A mouse model of Fbxw4 KI / KI carrying a human pathogenic mutation was constructed, which showed significant shortening of long bones and chondrodysplasia.
[0065] Dosage regimen: TR peptide (or TAT peptide as a control) was injected into the knee joint cavity of mice periodically after birth.
[0066] Results: (1) Biochemical indicators: Immunohistochemistry (IHC) and Western blot showed that the CCT5 protein level in the articular cartilage tissue of the TR peptide treatment group returned to normal, and the translation levels of SOX9 and COL1A1 were significantly increased. (2) Morphological indicators: Skeletal measurements showed that, compared with the control group, the length of the tibia and femur of the mutant mice injected with TR peptide was significantly increased, almost completely rescuing the phenotype of skeletal growth arrest. Histological examination (Safranin O-Fixed Green staining) showed that the arrangement of growth plate chondrocyte columns and extracellular matrix density returned to normal.
[0067] Materials: Animal models Fbxw4 + / + (wild-type mice) and Fbxw4 KI / KI (Knock-in / mutant homozygous mice). Treatment reagents: TAT peptide (control peptide), TR peptide (experimental intervention peptide). Antibodies: FBXW4 antibody, CCT5 antibody, SOX9 antibody, IGF1R antibody, β-actin antibody. Staining reagents: Von-Kossa staining solution (for mineralization detection), Safranin O-Fix Green staining solution (for cartilage matrix detection), HE staining solution (for histological morphology). Main equipment: Electrophoresis apparatus and transfer system (WB), microscope and imaging system (IHC / tissue staining), digital camera (gross photographs).
[0068] Experimental methods: (A) In vivo peptide delivery treatment Dosing started on day 5 after birth (P5).
[0069] Administration route: Intra-articular injection.
[0070] Dosage and concentration: 5 mg / kg body weight, peptide dissolved in sterile PBS.
[0071] Dosage frequency: 3 injections per week, continued until mice are euthanized at 6 weeks of age.
[0072] Injection volume: Approximately 1-2 μL per administration using a micro-injection needle.
[0073] (B) Histological Preparation Fixation and decalcification: The collected tibia / femur was fixed in 4% paraformaldehyde (PFA) for 24 hours; then it was soaked in 10% EDTA (pH 7.4) decalcification solution, with the dressing changed every two days, for 2-4 weeks until the bone tissue softened.
[0074] Sectioning: Dehydrated with graded ethanol, cleared with xylene, and embedded in paraffin. Longitudinal sections with a thickness of 5 μm were cut.
[0075] (C) Staining Procedures IHC: Antigen retrieval was performed by heating in a pressure cooker for 15 minutes with citrate buffer (pH 6.0); endogenous peroxidase was inactivated with 3% H2O2; primary antibody was incubated overnight at 4°C.
[0076] Von-Kossa: Sections were exposed to 5% silver nitrate solution and irradiated under ultraviolet light for 30 minutes, followed by treatment with 5% sodium thiosulfate and counterstained with nuclear solid red.
[0077] Safranin O-Fast Green: First stain with 0.02% Fast Green, then stain with 0.1% Safranin O, used to quantify cartilage matrix area.
[0078] (D) Protein level detection (Western Blot) Sample: Precisely separated "pure cartilage tissues".
[0079] Analysis: Total protein was extracted, subjected to SDS-PAGE (4%-20% gradient gel) electrophoresis, and antibody hybridization was performed after transfer to a membrane. The grayscale value was measured using ImageJ software.
[0080] Experimental results are as follows Figure 3 As shown. By Figure 3 The experimental results show that in gene knock-in mice simulating idiopathic dwarfism, intra-articular injection of TR peptide can effectively restore the protein expression of CCT5, SOX9 and IGF1R in cartilage tissue, improve cartilage matrix structure, promote mineralization, and significantly increase the length of the tibia and femur, almost completely reversing the phenotype of long bone shortening.
[0081] Example 4: TR peptides in 3M syndrome ( Ccdc8 Prolonged lifespan in knockout mouse models Due to the core components of the CRL7 complex Ccdc8 The absence of [a specific ingredient] leads to perinatal lethality and extreme dwarfism in mice. This invention evaluates the systemic therapeutic potential of the peptide.
[0082] Dosage regimen: For pregnant women Ccdc8 - / - The embryonic mother mice were given a systemic drug administration during pregnancy (intraperitoneal injection of TR peptide).
[0083] Results: (1) Phenotypic reversal: During the embryonic period (E18.5), the embryos in the TR treatment group showed no difference in weight and body length compared to wild-type littermates, completely eliminating prenatal developmental delay. (2) Survival rate: The control group's survival rate was significantly higher than that of the control group. Ccdc8 - / - All the pups died shortly after birth; however, the group treated with the TR peptide successfully survived the perinatal lethal crisis, and the Kaplan-Meier survival curve showed that their lifespan was greatly extended, demonstrating the powerful therapeutic efficacy of this blocking peptide for severe hereditary skeletal and systemic developmental diseases.
[0084] Material: Laboratory animals: Ccdc8 Heterozygous knockout mice ( Ccdc8 + / - ), produced through mutual mating Ccdc8 - / - Homozygous mutant embryo.
[0085] Cell lines: C28 / I2 human chondrocyte cell lines, including Parental, CCDC8-KO, and CUL7. L1588P and FBXW4 C328Y Mutant strain.
[0086] Core drug: TR peptide: 5 mg / kg (for use in mice), sequence containing TAT and CCT5 binding motifs. TAT peptide: equimolar amount as negative control.
[0087] Antibodies: CCDC8, FBXW4, CCT5, SOX9, COLIA1, IGF1R, β-actin.
[0088] Experimental methods: (A) Prenatal Rescue Target of processing: pregnant Ccdc8 - / - embryo Ccdc8 + / - Heterozygous pregnant mice.
[0089] Administration route: Intraperitoneal injection (IP).
[0090] Dosage: 5 mg / kg body weight.
[0091] Treatment time / frequency: Administer the medication 3 times a week from the date of pregnancy confirmation until the embryo is born or euthanized and sampled at E18.5 days.
[0092] (B) Postnatal Rescue Target of processing: Successfully born Ccdc8 - / - Baby rat.
[0093] Administration method: Intra-articular injection (IA) of the knee joint.
[0094] Starting time: from day 5 after birth (P5).
[0095] Dosage: 5 mg / kg body weight.
[0096] Treatment frequency: 3 injections per week.
[0097] Monitoring cycle: Survival status is recorded every 5 days to plot Kaplan-Meier survival curves.
[0098] (C) In vitro treatment of cells Treatment method: Cells were exposed to TR or TAT peptides. Protein homeostasis was assessed by Western blotting after treatment. Although competitive Co-IP lasted for 2 hours, protein level recovery typically involved 24–48 hours of incubation to observe protein accumulation following degradation inhibition.
[0099] (D) Embryo Analysis Time point: E18.5 (day 18.5 of the embryonic period).
[0100] Procedure: Pregnant mice were euthanized, and embryos were removed for genotyping, weight measurement, and photography. Proteins were extracted from embryonic tissue for Western blotting analysis.
[0101] Experimental results are as follows Figure 4 As shown. By Figure 4 The experimental results show that in the Ccdc8 knockout (CRL7 complex loss of function) model, systemic administration of the TR peptide during pregnancy restored the birth weight and body length of homozygous mutant embryos to normal, successfully avoiding perinatal mortality. Continued administration after birth significantly prolonged the survival time of the mice, indicating that the peptide has a potent therapeutic effect on severe hereditary skeletal dysplasia.
[0102] This invention reveals a non-classical functional mechanism of the CRL7-FBXW4-CCT5 regulatory axis in skeletal development, opening up a new pathway for the diagnosis and treatment of idiopathic short stature (ISS) and 3M syndrome. Its core innovations and clinical value are mainly reflected in the following three dimensions: First, a major breakthrough in scientific theory. This invention is the first to discover the "moonlighting" function of the chaperone protein subunit CCT5. Unlike traditional protein folding functions, monomeric CCT5 can act as a phase-separated RNA-binding protein (RBP), constructing a "privileged translation center" within chondrocytes via liquid-liquid phase separation (LLPS). This mechanism can specifically recruit and stabilize the mRNA of key chondrocyte development factors such as SOX9 and IGF1R, thereby maintaining extremely high levels of translational output. This discovery rewrites the field's understanding of chaperone protein subunit functions and establishes a molecular link between protein homeostasis, translational control, and skeletal development.
[0103] Second, this study elucidates a unified pathogenic mechanism for short stature. For the first time, it defines gain-of-function mutation (GoF) in the E3 ubiquitin ligase FBXW4 as the primary genetic cause of short stature, cleverly unifying it with the previously unclear pathology of 3M syndrome (CRL7 complex deletion). The common bottleneck in both points to the abnormal accumulation of FBXW4 and the resulting excessive degradation of CCT5 monomers. This theory perfectly explains the long-standing clinical paradox of "growth hormone (GH) insensitivity" in patients with short stature, namely, the impaired expression of the IGF1R receptor due to translational blockage, leading to interruption of downstream signal feedback.
[0104] Third, the precise and efficient value of drug translation. Based on structural biology, this invention rationally designed a cell-penetrating decoy peptide called "TR". This peptide can precisely block the pathological binding of FBXW4 and CCT5, restoring CCT5 homeostasis through a "balance readjustment" strategy rather than a simple "dose supplementation". Experiments have shown that the TR peptide can not only significantly increase the length of long bones in mice, but also, more significantly, rescue the perinatal mortality risk in the 3M syndrome model.
[0105] In summary, this invention integrates "new target discovery, new mechanism elucidation, and new drug design," and not only has extremely high academic foresight, but also has great application potential for addressing unmet clinical needs (GH insensitivity dwarfism), making it an important milestone in the field of precision medicine for skeletal developmental disorders.
[0106] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A polypeptide composition, characterized in that, The polypeptide composition includes a core recognition peptide, which includes the N1-1b peptide and / or the N1-4a peptide of the CCT5 protein; the amino acid sequence of the N1-1b peptide is shown in SEQ ID NO.1; and the amino acid sequence of the N1-4a peptide is shown in SEQ ID NO.
2.
2. The polypeptide composition according to claim 1, characterized in that, The polypeptide composition further includes a cell-penetrating peptide, which is linked to the N-terminus or C-terminus of the core recognition peptide; the amino acid sequence of the cell-penetrating peptide is shown in SEQ ID NO.
3.
3. The use of the polypeptide composition of claim 2 in the preparation of a competitive inhibitor targeting FBXW4.
4. A polypeptide inhibitor, characterized in that, The active ingredient of the peptide inhibitor includes the peptide composition according to any one of claims 1-2.
5. The peptide inhibitor according to claim 4, characterized in that, The inhibitor may also include one or more pharmaceutically acceptable carriers, excipients, or excipients.
6. The use of the polypeptide composition according to any one of claims 1-2 or the polypeptide inhibitor according to any one of claims 4-5 in the preparation of a product for treating osteodystrophy.
7. The application according to claim 6, characterized in that, The product is a medication for treating skeletal dysplasia.
8. The application according to claim 7, characterized in that, The skeletal dysplasia disorders include idiopathic dwarfism caused by gain-of-function mutations in FBXW4 and 3M syndrome caused by loss of function of the CRL7 complex.
9. The application according to claim 7, characterized in that, The drug is suitable for patients with normal or elevated serum growth hormone levels who are insensitive to growth hormone.
10. The application according to claim 7, characterized in that, The dosage form of the drug is selected from injections, solutions, emulsions, suspensions, microneedle patches, or nano-delivery sustained-release formulations.