Fresh xian tianmingjing source anti-tumor plant exosome and preparation process thereof

Abstract

This invention relates to the field of biomedical technology, specifically to an antitumor plant exosome derived from fresh *Ligustrum lucidum*, its preparation process, and its application. The process includes: Step 1: Taking clean, fresh *Ligustrum lucidum* branches and leaves, adding buffer solution, crushing, stirring, filtering, and collecting the juice; Step 2: Using multiple gradient low-speed centrifugations on the juice to remove large particles, obtaining a supernatant; Step 3: Performing gradient ultracentrifugation on the supernatant, then resuspending the precipitate in buffer solution; Step 4: Purifying the resuspended solution using size exclusion chromatography, concentrating it to the target volume using an ultrafiltration tube, and filtering it through a microporous membrane for sterilization to obtain purified fresh *Ligustrum lucidum* plant exosomes. This invention extracts and separates plant exosome components from the juice of fresh *Ligustrum lucidum*, and screens their antitumor activity, obtaining fresh *Ligustrum lucidum*-derived plant exosomes with natural antitumor vesicles, which can effectively promote the clinical use of fresh *Ligustrum lucidum*. It solves the problem of limited clinical use of fresh *Ligustrum lucidum*.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and in particular relates to an anti-tumor plant exosome derived from fresh Tianming essence and its preparation process. Background Technology

[0002] In the field of traditional Chinese medicine, due to the unclear material basis and mechanism of action of fresh medicinal materials, their unique medicinal value is gradually being forgotten and replaced by dried medicinal materials, leading to a huge crisis of their extinction. Take *Carpesium abrotanoides* L. as an example. As the whole herb of this plant (of the genus *Carpesium* in the Asteraceae family), its clinical application history is extremely long, dating back to the origins of the Menghe School of Medicine in the Han Dynasty. The *Shennong Bencao Jing* records that "long-term use lightens the body and prolongs life. It treats blood stasis, blood masses that are almost fatal, hemorrhage, and stops bleeding." Subsequently, Menghe physicians throughout history have recorded numerous uses of fresh *Carpesium abrotanoides* juice. Tao Hongjing of the Northern and Southern Dynasties described it in his "Collected Annotations on the Materia Medica" as "sweet, cold, and non-toxic. It removes numbness and eliminates heat accumulation in the chest. In summer, pound it to extract juice and drink it to eliminate fever." Zhang Lu of the Qing Dynasty recorded in "Sources of Materia Medica" that "Heavenly Name Essence has the effect of breaking up old and new growths; rinsing it with water can stop toothache. For tonsillitis with sore throat, pound it, squeeze it, mix it with wine, and administer it. For throat swelling and congestion, pound it to extract juice and sweep it in with a goose feather." Ding Ganren, a physician from Menghe in the late Qing Dynasty, recorded in "Essential Prescriptions" that "pressing down blood removes heat accumulation, disinfects and relieves pain, and stops sore throat. It is an essential medicine for surgery; pounding it raw to extract juice and drinking it will cause vomiting and diarrhea, and can also stop toothache." In addition, Meng Shen of the Tang Dynasty's "Essential Prescriptions" states, "Pound the juice of *Dioscorea opposita* and drink it two or three times a day to treat malignant sores," and Li Shizhen of the Ming Dynasty's "Compendium of Materia Medica" states, "For carbuncles and boils on the back, pound one liter of Heavenly Name Essence to extract juice and drink it twice a day, and it will heal." These are all relevant records.

[0003] However, although fresh *Phyllanthus urinaria* has been used in my country for over 2000 years, its use in modern medicine is rarely documented due to a severe lack of understanding of its therapeutic value. This lack of continuity in its application creates a significant gap in its use. While the concept of cancer did not exist in ancient times, the descriptions of febrile diseases, malignant sores, and carbuncles in the aforementioned medical texts strongly suggest that the medicinal effects of fresh *Phyllanthus urinaria* juice may be related to the treatment of tumors. However, the significant differences between modern and traditional medicine in their understanding and definition of diseases not only result in the extremely rare clinical use of fresh *Phyllanthus urinaria* for tumor treatment but also severely limit the clinical application of many other fresh medicinal materials with similar properties.

[0004] Therefore, this invention proposes a modern preparation process for antitumor plant exosomes derived from fresh Tianming essence, which extracts natural antitumor vesicles from the plant exosomes derived from fresh Tianming essence for the treatment of patients, thereby increasing the clinical utilization rate of fresh Tianming essence and solving the problems existing in the prior art. Summary of the Invention

[0005] To address the limitations of the clinical use of fresh Tianming essence in the existing technologies, this invention proposes a method for preparing and applying antitumor plant exosomes derived from fresh Tianming essence.

[0006] To achieve the above objectives, the present invention provides the following technical solution:

[0007] This invention provides a first solution: a process for preparing antitumor plant exosomes derived from fresh Tianming extract, comprising:

[0008] Step 1: Take clean, fresh leaves and branches of *Euphorbia hirta*, add buffer solution, crush them with a mortar and pestle, then use a juicer to stir, filter, and collect the juice.

[0009] Step 2: Use multiple gradient low-speed centrifugations on the juice extracted in Step 1 to remove large particles and obtain the supernatant;

[0010] Step 3: Perform gradient ultracentrifugation on the supernatant obtained in step 2, and then resuspend the precipitate with buffer solution;

[0011] Step 4: The resuspension obtained in Step 3 is purified by size exclusion chromatography, concentrated to the target volume using an ultrafiltration tube, and filtered and sterilized using a microporous membrane to obtain purified fresh Tianming plant exosomes.

[0012] The average particle size of the fresh *Tetracentron sinense* plant exosomes prepared using the above method was 243.3 nm, and the particle concentration was 6.2 × 10⁻⁶. 11 / mL, protein concentration is 2560 μg / ml.

[0013] In a preferred embodiment of the present invention, the treatment process of the Tianmingjing branch and leaf sap in step 1 includes:

[0014] Step 1.1: Take fresh leaves and branches of *Epiphyllum indicum*, wash them with ultrapure water, and then add PBS buffer.

[0015] The mass ratio of fresh Tianming extract to buffer solution is approximately 5:4, i.e., 50 g of medicinal material : 40 ml of buffer solution;

[0016] Step 1.2: Add 20 ml of buffer solution for the first time. Crush the medicinal materials with a mortar and pestle to increase the surface area of ​​the medicinal materials. Stir and filter with a juicer to collect the residue. Add another 20 ml of buffer solution and repeat the crushing and juicing operation. Combine the two filtrates.

[0017] In a preferred embodiment of the present invention, the process of obtaining the supernatant in step 2 includes:

[0018] The juice extracted in step 1 was subjected to multiple gradient low-speed centrifugations, in the following order: 700×g for 10 minutes, 1200×g for 20 minutes, and 15000×g for 30 minutes. Each centrifugation removed large precipitate particles, and the supernatant was obtained.

[0019] In a preferred embodiment of the present invention, step 3, which involves gradient ultracentrifugation of the supernatant followed by resuspending the precipitate in buffer solution, includes:

[0020] After combining the supernatants obtained in step 2, aliquot them into 6 ultracentrifuge tubes, balance them, and perform gradient ultracentrifugation. The gradient ultracentrifugation was first performed at 50,000×g for 1 hour. The supernatant was then transferred to a new centrifuge tube and centrifuged at 100,000×g for another hour. The precipitate was then resuspended in about 6 ml of PBS buffer and combined.

[0021] In a preferred embodiment of the present invention, the purification process of the fresh Tianming plant exosomes in step 4 includes:

[0022] Step 4.1: The obtained resuspension was purified by size exclusion chromatography. 3 ml of exosome sample was loaded onto the column at one time and eluted with PBS buffer. 1 ml fractions were collected. The first 4 fractions were the void volume. The last 4 fractions, 5, 6, 7, and 8, were collected as the target fractions. The sample was concentrated to the target volume using a 100 kD ultrafiltration tube at 4000×g centrifugation. The sample was then filtered through a microporous membrane for sterilization to obtain purified fresh Tianming plant exosomes.

[0023] The microporous filter membrane is a 0.22 μm nylon-66 membrane.

[0024] This invention provides a second solution: an anti-tumor plant exosome derived from fresh Tianming essence.

[0025] In a preferred embodiment of the present invention, the average particle size of the fresh Tianming plant exosomes is 243.3 nm, and the particle concentration is 6.2 × 10⁻⁶. 11 The protein concentration was 2560 μg / ml, which could be taken up by different tumor cells, and it inhibited the IC50 of HCT-116, PC-9 and TMK-1 cell lines. 50 The values ​​were 75.09 ± 0.84 μg / ml, 102.77 ± 1.33 μg / ml, and 81.34 ± 3.01 μg / ml, respectively.

[0026] In a preferred embodiment of the present invention, the plant exosomes of *Euphorbia hirta* can inhibit the expression of CDK1, FOXM1 and PIK3R2, while upregulating the expression of genes LAMB3, ARG2 and TRIB3.

[0027] In a preferred embodiment of the present invention, the miR9479-3p derived from the plant exosomes of *Euphorbia hirta* can bind to the PIK3R2 gene of human colon cancer cells and inhibit the expression of the gene. PIK3R2 is the target of *Euphorbia hirta* plant exosomes in inhibiting colon cancer.

[0028] This invention provides a third approach: the application of exosomes from antitumor plants derived from fresh Tianming extract in the preparation of antitumor drugs.

[0029] The present invention has at least the following beneficial effects:

[0030] 1. This invention extracts and separates plant exosome components from the juice of fresh Tianmingjing (a type of plant extract), and screens their antitumor activity to obtain plant exosomes derived from fresh Tianmingjing that have natural antitumor vesicles, which can effectively promote the clinical use of fresh Tianmingjing.

[0031] 2. The plant exosomes extracted in this invention are used as the effective components of fresh herb juice. Compared with directly taking fresh herb juice, they are more easily accepted by patients and have a more significant therapeutic effect.

[0032] 3. At the same time, plant exosomes have good stability and are easy to store and mass-produce, which solves the problems of fresh herbs being seasonal and difficult to store and transport.

[0033] This solves the problem of limited clinical use of fresh Tianming essence in existing technologies. Attached Figure Description

[0034] The accompanying drawings, which form part of this application, are used to provide a further understanding of this application. The illustrative embodiments and descriptions of this application are used to explain this application and do not constitute an undue limitation of this application. In the drawings:

[0035] Figure 1 This is a technical roadmap of the method for preparing plant exosomes of Tianmingjing in Embodiment 1 of the present invention;

[0036] Figure 2 This is a transmission electron microscope image of the plant exosomes prepared in Example 1 of this invention.

[0037] Figure 3 This is a schematic diagram of the nanoparticle size and concentration of *Tianmingjing* plant exosomes prepared in Example 1 of the present invention via flow cytometry.

[0038] Figure 4 This is an image of PKH26-stained plant exosomes of *Tianmingjing* prepared in Example 1 of this invention, co-cultured with the human colon cancer cell line HCT-116.

[0039] Figure 5This is a diagram showing the co-culture of PKH26-stained plant exosomes of *Tianmingjing* prepared in Example 1 of this invention with the human lung cancer cell line PC-9.

[0040] Figure 6 This is a diagram showing the co-culture of PKH26-stained exosomes of the plant *Typha latifolia* prepared in Example 1 of this invention with the human gastric cancer cell line TMK-1.

[0041] Figure 7 This is a diagram showing the experimental results of the inhibition of CCK8 cell proliferation in HCT-116 cells by the plant exosomes prepared in Example 1 of this invention.

[0042] Figure 8 This is a diagram showing the experimental results of the inhibition of CCK8 cell proliferation in PC-9 cells by the plant exosomes prepared in Example 1 of this invention.

[0043] Figure 9 This is a graph showing the experimental results of the inhibition of CCK8 cell proliferation in TMK-1 cells by the plant exosomes prepared in Example 1 of this invention.

[0044] Figure 10 This is a diagram showing the scratch test results of the plant exosomes prepared by Tianmingjing in Example 1 of this invention on HCT-116 cells;

[0045] Figure 11 The figure shows the Transwell migration results of HCT-116 cells by the plant exosomes of *Gynostemma pentaphyllum* prepared in Example 1 of this invention.

[0046] Figure 12 This is a diagram showing the results of the colony formation experiment of HCT-116 cells using plant exosomes prepared in Example 1 of this invention.

[0047] Figure 13 This is a flow cytometry diagram of HCT-116 cell apoptosis induced by *Typhonium sibiricum* plant exosomes prepared in Example 1 of this invention.

[0048] Figure 14 This is a diagram showing the exosomes of *Gynostemma pentaphyllum* and the miRNA profile in *Gynostemma pentaphyllum* tissues prepared in Example 1 of this invention.

[0049] Figure 15 This is a diagram showing the differential analysis of miRNAs in *Symplocos rubrum* plant exosomes and *Symplocos rubrum* plant tissues prepared in Example 1 of this invention.

[0050] Figure 16 This is a graph showing the functional enrichment analysis of the top 20 miRNAs expressed in the plant exosomes prepared in Example 1 of the present invention, predicting the target genes.

[0051] Figure 17 This is a graph showing the transcriptome sequencing analysis results of human colon cancer cells HCT-116 prepared in Example 1 of this invention;

[0052] Figure 18 This is a graph showing the functional enrichment of differentially expressed genes from the transcriptome sequencing of human colon cancer cells HCT-116 prepared in Example 1 of this invention.

[0053] Figure 19 This is a graph showing the results of a real-time PCR experiment on human colon cancer cells after incubation of plant exosomes prepared in Example 1 of this invention.

[0054] Figure 20 The figure shows the experimental results of dual-luciferase assay on the target of the plant exosomes prepared in Example 1 of this invention inhibiting human colon cancer cells HCT-116.

[0055] Among them: Figure 14 In the figure, Figure A is a statistical chart of miRNA length analysis, and Figure B is a chart of miRNA first-position preference analysis.

[0056] exist Figure 15 In the figure, Figure A is a statistical graph of miRNA intersection analysis, and Figure B is a volcano plot of differential miRNA expression.

[0057] exist Figure 16 In the figure, Figure A is the target gene GO enrichment analysis diagram, and Figure B is the target gene Kegg enrichment analysis diagram;

[0058] exist Figure 17 In the figure, Figure A is a volcano diagram of differentially expressed genes between the experimental group and the control group, and Figure B is a heatmap of differentially expressed genes between the experimental group and the control group.

[0059] exist Figure 18 In the figure, Figure A is the GO enrichment analysis diagram of differentially expressed genes, and Figure B is the Kegg enrichment analysis diagram of differentially expressed genes. Detailed Implementation

[0060] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0061] Example 1: Extraction and purification of exosomes from *Spermum cristatum*;

[0062] A preparation process for antitumor plant exosomes derived from fresh Tianming extract, the preparation process is as follows: Figure 1 The extraction and purification techniques were followed to successfully extract and purify Tianming sperm exosomes. The main steps included:

[0063] Step 1: Take fresh leaves and branches of Tianmingjing, wash them, add buffer solution, crush them with a mortar and pestle, then use a juicer to stir, filter and collect the juice.

[0064] Fresh *Pterocarya stenoptera* (a type of medicinal herb) was harvested annually from October to November in Pingdingshan City, Henan Province, transported on dry ice, and stored at -80°C. Fresh *Pterocarya stenoptera* branches and leaves were washed with ultrapure water, and then PBS buffer (the mass ratio of fresh *Pterocarya stenoptera* to buffer was approximately 5:4, i.e., 50 g of herb : 40 ml of buffer) was added initially. The herb was then crushed using a mortar and pestle to increase its surface area. After stirring and filtering with a juicer, the residue was collected, and another 20 ml of buffer was added. The crushing and juicing process was repeated, and the two filtrates were combined. A total of 200 g of herb was extracted at one time, and the filtrate was aliquoted into six 50 ml centrifuge tubes.

[0065] Step 2: Use multiple gradient low-speed centrifugations on the juice extracted in Step 1 to remove large particles and obtain the supernatant;

[0066] The juice extracted in step 1 was subjected to multiple gradient low-speed centrifugations (in sequence: 700×g for 10 minutes, 1200×g for 20 minutes, and 15000×g for 30 minutes) to remove large precipitate particles each time to obtain supernatant.

[0067] Step 3: Perform gradient ultracentrifugation on the supernatant obtained in step 2, and then resuspend the precipitate with buffer solution;

[0068] After combining the supernatants obtained in step 2, aliquot them into 6 ultracentrifuge tubes (Beckman 32ml thick-walled polycarbonate open tubes, catalog number 355631), balance them, and perform gradient ultracentrifugation (Beckman Optima XE-100 Ultracentrifuge, using SW 32 Ti rotor). The gradient ultracentrifugation was first performed at 50,000×g for 1 hour. The supernatant was then transferred to a new centrifuge tube and centrifuged at 100,000×g for another hour. The precipitate was then resuspended in about 6 ml of PBS buffer and combined.

[0069] Step 4: Purify the resuspension obtained in Step 3 using size exclusion chromatography, concentrate it to the target volume using an ultrafiltration tube, and filter it with a microporous membrane to remove bacteria, thus obtaining purified fresh Tianming plant exosomes.

[0070] The prepared resuspension was purified using size exclusion chromatography (Enzekangtai Company, catalog number ES933). 3 ml of exosome sample was loaded onto the column at a time and eluted with PBS buffer. 1 ml fractions were collected, with the first four fractions representing the void volume. The last four fractions (5, 6, 7, and 8) were collected as the target fractions. The fractions were concentrated to the target volume using a 100 kD ultrafiltration tube at 4000 × g centrifugation. The mixture was then filtered through a microporous membrane (0.22 μm nylon-66 membrane) for sterilization, yielding purified fresh *Euphorbia hirta* plant exosomes. The transmission restriction structures of the prepared *Euphorbia hirta* plant exosomes are shown in Table 2.

[0071] Example 2: Transmission electron microscopy observation and particle size analysis of exosomes from fresh Tianming plant;

[0072] 10 μL of the *Spermum tianmingense* exosomes obtained in Example 1 were added to a copper grid and allowed to precipitate for about 1 minute. The precipitate was then removed with filter paper. 10 μL of uranium acetate was added to the copper grid and allowed to precipitate for about 1 minute. After removing the precipitate with filter paper, the mixture was dried at room temperature for several minutes and then imaged under an electron microscope at 100 kV. The ring-shaped *Spermum tianmingense* exosomes were observed. The results are as follows: Figure 2 .

[0073] from Figure 3 The results showed that after dilution of exosomes with PBS, the particle size and particle size of exosomes were determined using NanoFCM nanoflow cytometry. The average particle size was 243.3 nm, and the particle concentration was 6.2 × 10⁻⁶. 11 / mL.

[0074] Example 3: Determination of the concentration of exosome proteins in Tianming sperm;

[0075] Protein standard solutions with final concentrations of 2, 1.5, 1, 0.75, 0.5, 0.25, 0.125, and 0.025 mg / ml were prepared using BSA protein standard (5 mg / ml). 1 μL of each protein standard solution and exosome was added sequentially to the wells of a 96-well plate, with three replicates per sample. BCA working solution was prepared using BCA reagent A and B solutions at a 50:1 ratio, and 200 μL of BCA working solution was added to each well. The plate was incubated at 37°C for 30 minutes. The absorbance (OD) value at 562 nm was measured using a microplate reader. A standard curve was plotted with protein content (μg) on ​​the x-axis and OD value on the y-axis. Based on the standard curve, the protein concentration of the exosome sample extracted in Example 1 was calculated to be 2560 μg / ml.

[0076] Example 4: PKH26 staining experiment of Tianming sperm exosomes;

[0077] The *Spermum jasminoides* exosome precipitate obtained by ultracentrifugation was resuspended in 1 ml of dilution buffer C. 4 µL of PKH26 ethanol solution was added to another 1 ml of dilution buffer C, and the mixture was incubated for 5 minutes. Then, an equal volume of 2 ml of serum was added to terminate the reaction, and incubation continued for 1 minute. The mixture was then centrifuged at 100,000 g for 1.5 hours at 4°C to obtain a red precipitate, which is the stained *Spermum jasminoides* exosome. The supernatant was discarded, and the red precipitate was resuspended in PBS and centrifuged at 100,000 g for 1.5 hours to wash away excess dye. The supernatant was aspirated with a pipette, and 200 µL of the solution was used in a laminar flow hood. Resuspend the stained exosome pellet in DMEM complete medium and store at 4°C; plate different tumor cells on a glass slide, add PKH26-stained exosomes, and co-incubate at 37°C for 5 hours; wash the cells twice with PBS, fix with 4% paraformaldehyde for 30 minutes, then wash three times with PBS, and then stain the cell nuclei with DAPI; add anti-fluorescence quencher to the glass slide, mount with nail polish, and take pictures using a laser confocal microscope.

[0078] The results showed that Tianming sperm exosomes could be taken up by different tumor cells, and red fluorescence appeared in the cytoplasm of all tumor cells.

[0079] Example 5: Proliferation experiment of Tianming sperm exosomes in CCK8 cells;

[0080] 100 µL of HCT-116, PC-9, and TMK-1 cells in logarithmic growth phase were seeded into 96-well plates (5000 cells / well). After overnight culture, different concentrations of exosomes were added, and the cells were cultured for 24 hours at 37°C and 5% CO2, respectively. 10 µL of CCK-8 solution was added to each well, and after incubation for 1.5 hours, the OD value was measured at 450 nm using a microplate reader. Based on the measured OD values, the inhibitory rate of different concentrations of exosomes on tumor cells was calculated. The experiment was repeated three times, and the IC50 was calculated using Graphpad Prism software. 50 Value. The formula for calculating the inhibition rate is:

[0081] Inhibition rate (%) = [OD(0 with drug) - OD(with drug)] / [OD(0 with drug) - OD(blank)] × 100%

[0082] The results are as follows Figure 7 , Figure 8 and Figure 9 As shown, the results indicated that fresh Tianming sperm exosomes inhibited the IC50 of HCT-116, PC-9, and TMK-1 cell lines. 50 The values ​​were 75.09 ± 0.84 μg / ml, 102.77 ± 1.33 μg / ml, and 81.34 ± 3.01 μg / ml, respectively.

[0083] Example 6: Scratch test on plant exosome cells of *Tianmingjing* (a plant name);

[0084] Inoculate approximately 5 × 10 per well 5 HCT-116 cells were transferred to 6-well plates. The next day, after the cells adhered, lines were drawn in the wells using a pipette tip and a ruler. The cells were washed three times with PBS to remove the drawn cells. Fresh culture medium diluted with PBS and exosomes (final concentration 40 μg / ml, i.e., 1×10⁻⁶ cells) were added to each well. 10 Two ml of each exosome sample (particles / ml) were placed in a cell culture incubator and photographed under a microscope at 0, 24 and 48 hours.

[0085] The results show that... Figure 10 As shown, compared with the HCT116+PBS group, the migration ability of HCT-116 cells in the HCT116+EXO group was significantly reduced.

[0086] Example 7: Transwell migration experiment of plant exosomes from *Typhonium sibiricum*;

[0087] HCT-116 cells were digested, resuspended in serum-free DMEM medium, counted, and seeded at 1 × 10⁶ cells per well in the upper chamber of a 24-well Transwell plate. 4 The above-mentioned cells (volume 200 µL) and exosomes (final concentration 40 μg / ml, i.e., 1×10⁶ cells / ml) 10 (Exosome sample particles / ml) Add DMEM medium containing 10% FBS to the lower chamber, place the 24-well plate in a cell culture incubator and incubate for 24 hours. After that, aspirate the medium from the well plate, fix with 4% paraformaldehyde for 15 minutes, stain with crystal violet for 20 minutes, wash with PBS and take pictures under a microscope.

[0088] The results show that... Figure 11 As shown, compared with the HCT116+PBS group, the migration ability of HCT116 cells in the HCT116+EXO group was significantly reduced.

[0089] Example 8: Experiment on the cloning of plant exosomes from *Euphorbia hirta*;

[0090] HCT-116 cells in logarithmic growth phase were cultured in a monolayer, digested with 0.05% trypsin, and pipetted to form single cells. The cells were then suspended in 10% FBS medium for later use. Approximately 800 cells were seeded into 6-well plates and incubated at 37°C in a 5% CO2 incubator. PBS and exosome groups were set up (final concentration 40 μg / ml, i.e., 1×10⁻⁶ cells / ml). 10(particles / ml), change medium every 2-3 days; culture for about 20 days and observe daily. When visible clones appear in the culture dish, stop the culture; discard the supernatant and carefully wash twice with PBS; add 4% paraformaldehyde for 15 min and discard the fixative; add an appropriate amount of crystal violet staining solution for 10-30 min, then slowly wash away the staining solution with running water and air dry; take photos with a Huawei Mate 60 Pro phone to record the staining area; analyze the staining area using ImageJ.

[0091] The results show that... Figure 12 As shown, the colony formation rate of HCT116 cells in the HCT116+EXO group was significantly lower than that in the HCT116+PBS group.

[0092] Example 9: Annexin V-FITC / PI double staining experiment of exosomes from Tianming sperm in flow cytometry;

[0093] Because Tianmingjing exosomes exhibited the best inhibitory activity against HCT-116 colon cancer cells, this cell line was selected. Annexin V-FITC and PI double staining methods were used, and flow cytometry was employed to determine the percentage of apoptosis induced by different concentrations of exosomes. Tumor cells were first digested, counted, and seeded into 6-well plates, then incubated for 24 hours with different concentrations of exosomes (0, 40, 80, and 160 μg / ml). After culture was terminated, cells were digested and collected. Cells were washed twice with pre-chilled PBS at 4°C, centrifuged to remove the PBS, and resuspended in apoptosis-binding buffer. Cells were then transferred to flow cytometry tubes, stained at 4°C in the dark for 30 minutes, and data were collected using flow cytometry. The results showed... Figure 13 As shown, HCT-116 cells treated with different concentrations of *Typhonium sibiricum* exosomes showed a dose-dependent increase in late apoptosis cells, indicating that fresh *Typhonium sibiricum* exosomes inhibit tumor cells by inducing apoptosis.

[0094] Example 10: Small RNA sequencing analysis of *Gynostemma pentaphyllum* plant exosomes and *Gynostemma pentaphyllum* plant tissues;

[0095] (1) The small RNA sequencing library was sequenced using the PE150 sequencing protocol, and the quality value of the sequencing library was evaluated using FastQC. FastP was used for the removal of N bases at both ends of the sequence, Q20 filtering, and adapter removal. The cleaned sequence was aligned to the Rfam library using the Bowtie short sequence alignment tool to remove rRNA, tRNA, and other ncRNAs, and then aligned to the genome using Bowtie. For non-model species, the miRbase library did not record their small RNA sequences; therefore, all small RNAs in the miRbase library were used as a reference for quantitative analysis of possible small RNAs in the samples. miRNAs identified in the miRbase database were merged and retained as one record based on the principle of complete sequence and expression level consistency. Small RNAs were numbered sequentially from high to low expression levels based on sequence uniqueness. The families corresponding to the miRNAs were searched using the miRbase database. A total of 5147 miRNAs were detected from the exosomes and tissues of *Symplocos rubrum*, and their length distribution and first base preference were as follows: Figure 14 There are 2550 miRNAs shared by the exosomes and tissues of *Euphorbia hirta*. Figure 15 The results of the significant difference analysis showed that () Figure 15 ( ), exosomes upregulated 828 miRNAs and downregulated 392 miRNAs compared to plant tissues.

[0096] (2) The top 20 genes expressed in plant exosomes were selected. Using the Miranda software with default parameters (sc 168, en -10.0; -sc: specifies the threshold for sequence alignment scoring; binding sites below this threshold are filtered out; -en: specifies the threshold for free energy; results must be below this threshold to be retained), target sites were searched for in human genes to obtain their target genes in the human species. GO functional enrichment analysis and KEGG pathway enrichment analysis were performed on the target genes. The enrichment analysis results are as follows: Figure 16 As shown.

[0097] Example 11: Transcriptome sequencing analysis of human colon cancer cells HCT-116;

[0098] (1) The effect of *Euphorbia hirta* plant exosomes on human colon cancer cell mRNA was investigated by transcriptome sequencing experiments. Three experimental groups (exosome group) and three control groups (PBS group) were set up. After extracting total RNA from the samples, eukaryotic mRNA was enriched using magnetic beads with Oligo(dT). Fragmentation buffer was added to break the mRNA into short fragments. Using mRNA as a template, the first cDNA strand was synthesized using six-base random hexamers. Then, buffer, dNTPs, RNase H and DNA polymerase I were added to synthesize the second cDNA strand. Next, the double-stranded cDNA was end-repaired, poly(A) was added, sequencing adapters were ligated, and purification and fragment selection were performed using magnetic beads. Finally, PCR amplification was performed to obtain the library. After the library passed quality control, it was sequenced.

[0099] (2) Quality control (QC) was performed on the raw reads obtained from sequencing to determine whether the sequencing data was suitable for subsequent analysis. After QC, clean reads were obtained by filtering and aligned to the reference sequence. After alignment, the distribution and coverage of reads on the reference sequence were statistically analyzed to determine whether the alignment results passed the second QC ofalignment. After passing QC, a series of subsequent analyses were performed, including gene expression, alternative splicing, prediction of new transcripts, SNP detection, and gene structure optimization. Differentially expressed genes were screened from the gene expression results, and GO functional enrichment analysis and KEGG pathway enrichment analysis were performed based on the differentially expressed genes.

[0100] Analysis results as follows Figure 17 The experimental group showed 446 downregulated genes and 499 upregulated genes compared to the control group. GO enrichment analysis results showed ( Figure 18 A) The differentially expressed genes between the experimental and control groups mainly involve microtubule binding, microtubule motility, microtubule-based movement, and extracellular regions. These functions are related to tumor proliferation, survival, metabolism, and migration. The corresponding KEGG enrichment analysis results ( Figure 18 B) It shows that the metabolic pathways involved in differentially expressed genes are closely related to the cell growth cycle.

[0101] Example 12: Real-time PCR experiment;

[0102] From the transcriptome experiments of human colon cancer cells described above, we selected three genes downregulated compared to the control group (CDK1, FOXM1, and PIK3R2) and three genes upregulated compared to the control group (LAMB3, ARG2, and TRIB3) for verification using quantitative real-time PCR. Primer information used in this experiment is shown in Table 1.

[0103] Table 1: Primer Information for PCR Experiments

[0104] Gene name left primer Right primer Fragment size GAPDH CCACATCGCTCAGACACCAT GGCAACAATATCCACTTTACCAGAGT 114 PIK3R2 AGGAGATGCTGAGTGGCAAG GTGCGGTAGATGACGCAGT 121 TRIB3 TTTGTACCAGTGTCGGCCTC AGCCTTTGGCACAGGGATAC 137 ARG2 GGTCTTGCCAACCAGGAACT GGGCATGGCCACTAATGGTA 118 CDK1 TGCTTATGCAGGATTCCAGGT CCATGTACTGACCAGGAGGGA 96 LAMB3 AAGCTCAGGACACCATGCAA GCTTGGTCATGCTTGTCACC 117 FOXM1 GTTGAGGAGCCTTCGAGACC TCATGCGCTTCCTCTCAGTG 118

[0105] (2) The extracted RNA was reverse transcribed using the HiScript 1st Strand cDNA Synthesis Kit. The reverse transcription system and procedure are as follows.

[0106] System: Prepare the mixture in RNase-free centrifuge tubes as shown in Table 2.

[0107] Table 2: Mixture Preparation Table

[0108] Rnase-free ddH2O to20ul 2×RT Mix 10ul HiScript Enzyme Mix 2ul Oligo(dT)18 (50uM) 1ul Random hexamers (50ng / ul) 1ul Total RNA 10pg-1ug

[0109] The reaction procedure is shown in Table 3.

[0110] Table 3: PCR experimental reaction procedure

[0111] 25℃ 5min 50℃ 15min 85℃ 5min

[0112] The test results showed that... Figure 19 As shown, from Figure 19 It can be seen that the plant exosomes of *Gynostemma pentaphyllum* can inhibit the expression of CDK1, FOXM1 and PIK3R2, while upregulating the expression of genes LAMB3, ARG2 and TRIB3.

[0113] Example 13: Dual-luciferase assay;

[0114] Based on a comprehensive analysis of the sequencing results of *Euphorbia pekinensis* plant exosomes, as well as the transcriptome sequencing results and quantitative real-time PCR verification results of the human colon cancer cell line HCT-116 after incubation with *Euphorbia pekinensis* plant exosomes, we predicted that the target gene of miR9479-3p, one of the top 20 most expressed miRs in *Euphorbia pekinensis* exosomes, is PIK3R2, a gene downregulated in the transcriptome results. PIK3R2 encodes PI3K (phosphatidylinositol-3-kinase), a core enzyme in cell signaling, which activates downstream pathways to regulate cell proliferation, survival, metabolism, and migration. Therefore, we further used dual-luciferase assays to verify whether miR9479-3p and the target gene PIK3R2 interact and bind.

[0115] (1) Gene synthesis and vector construction:

[0116] A sequence of approximately 200 bp near the PIK3R2-WT / MT binding site was synthesized and constructed into the pmirGLO vector; miR9479-3p mimics and NC control were synthesized; the pmirGLO vector contained Firefly luciferase and Renilla luciferase, with Renilla luciferase serving as a control;

[0117] (2) Plasmid concentration:

[0118] Table 4: Plasmid Concentration Table

[0119] Serial Number plasmid name plasmid concentration 1 PIK3R2-WT 0.2306 μg / μl 2 PIK3R2-MT 0.5787 μg / μl

[0120] (3) Plasmid transfection:

[0121] 1) Seed cells in 24-well culture plates one day before transfection to achieve a cell density of 60-70% at transfection. The culture medium is DMEM + 10% FBS.

[0122] 2) Add the plasmid to 50 μL of serum-free DMEM medium, dilute the miRNA to the same tube of 50 μL of serum-free medium (total miRNA concentration 50 nM), add 4 μL of lipo2000 transfection reagent to 50 μL of serum-free DMEM medium, mix the two and incubate at room temperature for 15 min, then add serum-free DMEM medium to a final volume of 500 μL.

[0123] 3) Discard the culture medium in the well, add 500 μl of the transfection complex prepared in the previous step, and incubate at 37℃ for 4-6 h;

[0124] 4) Discard the culture medium, add 1 ml of complete culture medium, and incubate at 37°C for 48 h;

[0125] Transfection was repeated 5 times.

[0126] 5) The plasmid transfection combinations are shown in the table below:

[0127] Table 5: Transfection Plasmid Combination Table

[0128] Serial Number Transfection plasmid combination 1 <![CDATA[NC-mimics + PIK3R2 -WT]]> 2 <![CDATA[ miR9479-3p -mimics + PIK3R2 -WT]]> 3 <![CDATA[NC-mimics + PIK3R2 -MT]]> 4 <![CDATA[ miR9479-3p -mimics + PIK3R2 -MT]]>

[0129] (4) Detection experiment using the dual-luciferase reporter gene assay kit (company: Jinkairui; catalog number: JKR23008), the specific experimental method is as follows:

[0130] 1) Cell lysis: Add 200 μl of cell lysis buffer (CLB) to each well of a 24-well plate and incubate on ice for 5 min to fully lyse the cells;

[0131] 2) After complete lysis, collect the lysate, centrifuge at 10,000 rpm for 5 min, and take the supernatant as the test solution;

[0132] 3) Dissolve firefly luciferase buffer (LRB) and firefly luciferase substrate (50 ×) (LRS), kidney luciferase buffer (LRB II), and kidney luciferase substrate (50 ×) (LRS II) at room temperature. Dilute each solution to 1× working solution with the corresponding buffer and store on ice for later use.

[0133] 4) Turn on the chemiluminescence immunoassay analyzer, take another 96-well plate, add 10-20 μl of cell lysis supernatant to the 96-well chemiluminescence plate, then add 100 μl of firefly luciferase detection working solution, shake the plate to mix well.

[0134] 5) Measure the luminescence value at 350-700 nm using the instrument, with a detection time of 1 second;

[0135] 6) After completing the above steps for determining firefly luciferase, add 100 μl of Renaissance luciferase detection working solution, shake the plate to mix well, and measure the luminescence value at 350-700 nm for 1 sec.

[0136] 7) With Renal luciferase as an internal control, divide the RLU value obtained by firefly luciferase measurement by the RLU value obtained by Renal luciferase measurement. Compare the activation level of the target reporter gene among different samples based on the obtained ratio.

[0137] The test results showed that... Figure 20 As shown:

[0138] 293T cells were transfected with miR9479-3p-mimics + PIK3R2-WT group, and NC-mimics + PIK3R2 Compared to the -WT group, the fluorescence ratio was significantly lower;

[0139] When 293T cells were transfected with the miR9479-3p-mimics + PIK3R2-MT group, the fluorescence ratio showed no significant change compared with the NC-mimics + PIK3R2-MT group.

[0140] This indicates that miR9479-3p derived from *Symplocos rubra* exosomes can bind to the PIK3R2 gene in human colon cancer cells and inhibit its expression. PIK3R2 is the target of *Symplocos rubra* plant exosomes in inhibiting colon cancer.

[0141] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. A preparation process for antitumor plant exosomes derived from fresh Tianming extract, characterized in that, include: Step 1: Take clean, fresh leaves and branches of *Euphorbia hirta*, add buffer solution, crush them with a mortar and pestle, then use a juicer to stir, filter, and collect the juice. Step 2: Use multiple gradient low-speed centrifugations on the juice extracted in Step 1 to remove large particles and obtain the supernatant; Step 3: Perform gradient ultracentrifugation on the supernatant obtained in step 2, and then resuspend the precipitate with buffer solution; Step 4: The resuspension obtained in Step 3 is purified by size exclusion chromatography, concentrated to the target volume using an ultrafiltration tube, and filtered and sterilized using a microporous membrane to obtain purified fresh Tianming plant exosomes. The average particle size of the fresh *Tetracentron sinense* plant exosomes prepared using the above method was 243.3 nm, and the particle concentration was 6.2 × 10⁻⁶. 11 / mL, protein concentration is 2560 μg / ml.

2. The preparation process of antitumor plant exosomes derived from fresh phytoestrogen as described in claim 1, characterized in that, The processing procedure for the Tianmingjing branch and leaf sap described in step 1 includes: Step 1.1: Take fresh leaves and branches of *Epiphyllum indicum*, wash them with ultrapure water, and then add PBS buffer. The mass ratio of fresh Tianming extract to buffer solution is approximately 5:4, i.e., 50 g of medicinal material : 40 ml of buffer solution; Step 1.2: Add 20 ml of buffer solution for the first time. Crush the medicinal materials with a mortar and pestle to increase the surface area of ​​the medicinal materials. Stir and filter with a juicer to collect the residue. Add another 20 ml of buffer solution and repeat the crushing and juicing operation. Combine the two filtrates.

3. The preparation process of antitumor plant exosomes derived from fresh phytoestrogen as described in claim 1, characterized in that, The process of obtaining the supernatant described in the steps includes: The juice extracted in step 1 was subjected to multiple gradient low-speed centrifugations, in the following order: 700×g for 10 minutes, 1200×g for 20 minutes, and 15000×g for 30 minutes. Each centrifugation removed large precipitate particles, and the supernatant was obtained.

4. The preparation process of antitumor plant exosomes derived from fresh phytoestrogen as described in claim 1, characterized in that, Step 3, which involves gradient ultracentrifugation of the supernatant followed by resuspending the precipitate in buffer solution, includes: After combining the supernatants obtained in step 2, aliquot them into 6 ultracentrifuge tubes, balance them, and perform gradient ultracentrifugation. The gradient ultracentrifugation was first performed at 50,000×g for 1 hour. The supernatant was then transferred to a new centrifuge tube and centrifuged at 100,000×g for another hour. The precipitate was then resuspended in about 6 ml of PBS buffer and combined.

5. The preparation process of antitumor plant exosomes derived from fresh phytoestrogen as described in claim 1, characterized in that, Step 4 describes the purification process of fresh Tianming plant exosomes, which includes: Step 4.1: The obtained resuspension was purified by size exclusion chromatography. 3 ml of exosome sample was loaded onto the column at one time and eluted with PBS buffer. 1 ml fractions were collected. The first 4 fractions were the void volume. The last 4 fractions, 5, 6, 7, and 8, were collected as the target fractions. The sample was concentrated to the target volume using a 100 kD ultrafiltration tube at 4000×g centrifugation. The sample was then filtered through a microporous membrane for sterilization to obtain purified fresh Tianming plant exosomes. The microporous filter membrane is a 0.22 μm nylon-66 membrane.

6. A type of antitumor plant exosome derived from fresh Tianming essence, prepared by the method described in any one of claims 1-5.

7. The antitumor plant exosome derived from fresh phytoestrogen as described in claim 6, characterized in that, The average particle size of the fresh Tianmingjing plant exosomes was 243.3 nm, and the particle concentration was 6.2 × 10⁻⁶. 11 The protein concentration was 2560 μg / ml, which could be taken up by different tumor cells, and it inhibited the IC50 of HCT-116, PC-9 and TMK-1 cell lines. 50 The values ​​were 75.09 ± 0.84 μg / ml, 102.77 ± 1.33 μg / ml, and 81.34 ± 3.01 μg / ml, respectively.

8. The antitumor plant exosome derived from fresh phytoestrogen as described in claim 6, characterized in that, The plant exosomes described in the *Tianmingjing* plant can inhibit the expression of CDK1, FOXM1, and PIK3R2, while upregulating the expression of genes LAMB3, ARG2, and TRIB3.

9. The antitumor plant exosome derived from fresh phytoestrogen as described in claim 6, characterized in that, The miR9479-3p derived from the plant exosomes of *Euphorbia hirta* can bind to the PIK3R2 gene of human colon cancer cells and inhibit the expression of this gene. PIK3R2 is the target of *Euphorbia hirta* plant exosomes in inhibiting colon cancer.

10. The use of the fresh Tianming essence-derived antitumor plant exosomes as described in claim 1 in the preparation of antitumor drugs.

Images