A nucleic acid aptamer specifically binding to n-l-lactoyl-l-phenylalanine and screening and application thereof
Patent Information
- Application Number
- CN202610611615.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-07
- Publication Date
- 2026-08-18
- Estimated Expiration
- 2046-05-07
AI Technical Summary
[0003]在生物分子检测领域,传统检测技术普遍依赖抗原-抗体的特异性免疫反应实现靶标识别,但抗体作为核心识别元件,存在环境耐受性差、易失活变性、制备流程繁琐且周期长的技术瓶颈,严重限制了其在复杂场景下的规模化应用
[0013] This invention, through the design of a random base library and GO-SELEX screening, obtained the top 50 nucleic acid sequences with the highest replication counts, exhibiting at least 30% homology among the sequences. SEQ ID NO.1, tested and shown to have an affinity of 125 μM, is linked to NL-lactic-L-phenylalanine in solution via four hydrogen bonds. Quantitative detection of NL-lactic-L-phenylalanine in cell culture medium can be achieved using the thioflavin-T (ThT) fluorescence method, with an accuracy of 99.87 ± 5.61%. Experiments demonstrate that SEQ ID NO.1 can be used for the direct quantitative detection of NL-lactic-L-phenylalanine in solution, showing broad application prospects.
Smart Images

Figure CN122168605B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological detection technology, specifically relating to a nucleic acid aptamer that specifically binds to NL-lactyl-L-phenylalanine and its screening and application. Background Technology
[0002] Existing research indicates that in animals undergoing strenuous exercise, cells metabolize some of the L-lactic acid produced during exercise into NL-lactic-L-phenylalanine, which is then recovered after exercise. This suggests that NL-lactic-L-phenylalanine can serve as a biomarker for strenuous exercise. Therefore, increasing research focuses on the metabolic levels of NL-lactic-L-phenylalanine and its changes in energy metabolism within organisms. However, current detection methods, primarily based on liquid chromatography and liquid chromatography-mass spectrometry, are not portable and involve complex sample pretreatment steps. Furthermore, the lack of development of aptamers for NL-lactic-L-phenylalanine nucleic acids significantly limits the development of rapid, real-time detection methods. Therefore, developing a nucleic acid aptamer that specifically binds to the cellular metabolite NL-lactic-L-phenylalanine would contribute to establishing a direct, rapid, and real-time detection method for NL-lactic-L-phenylalanine.
[0003] In the field of biomolecular detection, traditional detection techniques generally rely on specific immune reactions between antigens and antibodies to achieve target recognition. However, antibodies, as the core recognition element, suffer from technical bottlenecks such as poor environmental tolerance, easy inactivation and denaturation, and cumbersome and time-consuming preparation processes, severely limiting their large-scale application in complex scenarios. Nucleic acid aptamers are DNA or RNA chains isolated through systematic evolution of ligands using exponential enrichment (SELEX) technology. They can bind with high affinity and specificity to targets such as proteins, metal ions, small molecules, and peptides, demonstrating broad application prospects. Compared with antibodies, nucleic acid aptamers have advantages such as small molecular weight, high stability, ease of modification, non-immunogenicity, and artificial synthesis, eliminating complex procedures such as animal immunization, protein extraction, and purification. Therefore, obtaining nucleic acid aptamers with high affinity and high specificity for NL-lactyl-L-phenylalanine will provide a key foundation for achieving highly specific detection of NL-lactyl-L-phenylalanine, contributing to the development of direct, rapid, and real-time detection methods for NL-lactyl-L-phenylalanine. Summary of the Invention
[0004] The purpose of this invention is to provide a nucleic acid aptamer that specifically binds to NL-lacticoyl-L-phenylalanine, as well as its screening and application. Through aptamer screening experiments, a chemically stable, easy-to-store and labelable nucleic acid aptamer that can bind to NL-lacticoyl-L-phenylalanine with high affinity is obtained. Furthermore, the obtained nucleic acid aptamer can be used for cellular-level detection and has broad application prospects.
[0005] One objective of this invention is to protect nucleic acid aptamers that specifically bind to NL-lactyl-L-phenylalanine, wherein the nucleotide sequence of the nucleic acid aptamer includes at least one of the following three sequences: (1) The DNA sequence shown in any one of SEQ ID NO. 1 to 6; (2) A nucleotide sequence that has at least 30% homology with the nucleotide sequence shown in any one of SEQ ID No. 1 to 6 and binds NL-lactyl-L-phenylalanine; (3) An RNA sequence transcribed from any of the nucleotide sequences shown in SEQ ID NO.1 to 6.
[0006] The second objective of this invention is to protect a method for screening nucleic acid aptamers that specifically bind to NL-lactyl-L-phenylalanine, comprising the following steps: (1) Synthesize a single-stranded DNA library containing 40 bp random bases and 20 bp primers; (2) GO-SELEX screening: At least 12 rounds of forward and reverse screening were performed using graphene oxide as the nucleic acid chain adsorption and separation matrix; The experiment used the GO-SELEX method, with a total of 12 rounds of screening. The specific screening criteria are as follows: Positive screening test: Mix 10 μL of ssDNA with 190 μL of 2x phosphate buffer (2x PBS) containing 2 mM MgCl2 and 0.05% (v / v) Tween-20. MT After mixing, add 200 μL of deionized water to obtain a mixture; incubate the mixture at 95℃, 0℃ and room temperature for 10 min respectively, add the target (addition amount 1:1000~1:50), incubate for 1 h, then add 60 μL of 2 mg / mL graphene oxide (GO) and 60 μL of 2xPBS. MT Incubate at room temperature for 30 min; centrifuge multiple times at 25℃ to collect the supernatant, add 1 / 10 volume of sodium acetate and 1 mL of anhydrous ethanol, freeze at -20℃ for 2 h, centrifuge again to collect the precipitate, wash the precipitate with 70% ethanol (water:ethanol = 30:70 volume ratio) and centrifuge to remove the supernatant, dry at 95℃ and dissolve in water to obtain the positive sieve product, and store for later use. Reverse screening experiment: Mix 10 μL ssDNA with 190 μL 2xPBSMT After mixing, add 200 μL of deionized water to obtain a mixture; incubate the mixture at 95℃, 0℃ and room temperature for 10 min respectively, add reverse screening target (1:500), incubate for 1 h, then add 60 μL of GO (2 mg / mL) and 60 μL of 2xPBS. MT Incubate at room temperature for 30 min; centrifuge multiple times at 25°C to collect the precipitate and homogenize it, then add 2xPBS containing the target. MT The solution was centrifuged multiple times at 25℃ to obtain the supernatant. 1 / 10 volume of sodium acetate and 1 mL of anhydrous ethanol were added, and the solution was frozen at -20℃ for 2 h. The precipitate was centrifuged again, washed with 70% ethanol (water:ethanol = 30:70 volume ratio), and the supernatant was removed by centrifugation. The solution was dried at 95℃ and dissolved in water to obtain the reverse screening product, which was then stored for later use. PCR amplification: Add the screening product to 900 μL of PCR mix premix and mix well. Use the library primers as templates: forward primer FP: GCAGTATTCCACGAGTCGAT; reverse primer RP: CATGACGTCTACTAGGCTGA. Divide the template and PCR mix premix into 100 μL / tube and add them to the PCR tube for amplification. The amplified products are then stored at 4℃. Secondary library preparation: The amplification product was purified using streptavidin magnetic beads to prepare the secondary library for the next round of screening. 1 / 5 volume of 4M sodium chloride was added to 1 mL of the amplification product. After incubation on a shaker at room temperature for 60 min, the PCR product supernatant was removed using a magnetic rack. The magnetic beads were then washed three times with phosphate buffer. After removing the supernatant, 20 μL of 0.2M sodium hydroxide solution was added, and after incubation for 3 min, the magnetic beads were magnetically removed. Then, 3.5–4 μL of 1M hydrochloric acid was added for dilution and neutralization. The resulting secondary library can then be used as the library for the next round of screening.
[0007] q-PCR: Using nucleic acid molecules in the secondary library as templates, the template and q-PCR mix premix are added to a PCR tube for amplification to obtain a nucleic acid aptamer that specifically binds to NL-lactic-L-phenylalanine. Store at 4°C.
[0008] Furthermore, the PCR amplification conditions are as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 55℃ annealing for 30 s, and 72℃ extension for 30 s, for a total of 25 cycles.
[0009] Furthermore, the amplification conditions in the q-PCR were: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 55℃ annealing for 30 s, and 72℃ extension for 30 s, for a total of 40 cycles.
[0010] A third objective of this invention is to protect a conjugate or derivative of a nucleic acid aptamer, wherein the nucleic acid aptamer is any of the aforementioned nucleotide sequences; the conjugate of the nucleic acid aptamer includes a fluorescent label; and the derivative of the nucleic acid aptamer includes a nucleic acid sequence that binds NL-lactyl-L-phenylalanine, modified from the nucleotide sequence backbone of the nucleic acid aptamer or the conjugate of the nucleic acid aptamer.
[0011] The fourth objective of this invention is to protect a fluorescence method for detecting NL-lactyl-L-phenylalanine, comprising using any of the above-described nucleic acid aptamers, or conjugates or derivatives of the above-described nucleic acid aptamers.
[0012] The fifth objective of this invention is to protect the application of the above-mentioned nucleic acid aptamers or conjugates or derivatives of nucleic acid aptamers in the direct detection of NL-lactyl-L-phenylalanine. Beneficial effects
[0013] This invention, through the design of a random base library and GO-SELEX screening, obtained the top 50 nucleic acid sequences with the highest replication counts, exhibiting at least 30% homology among the sequences. SEQ ID NO.1, tested and shown to have an affinity of 125 μM, is linked to NL-lactic-L-phenylalanine in solution via four hydrogen bonds. Quantitative detection of NL-lactic-L-phenylalanine in cell culture medium can be achieved using the thioflavin-T (ThT) fluorescence method, with an accuracy of 99.87 ± 5.61%. Experiments demonstrate that SEQ ID NO.1 can be used for the direct quantitative detection of NL-lactic-L-phenylalanine in solution, showing broad application prospects. Attached Figure Description
[0014] Figure 1 This is a graph showing the results of the dissolution curve detection. Figure 2 A graph showing the screening recovery rate results; Figure 3 The results of the homology analysis of the screened products are shown in the figure; Figure 4 Motif analysis results for screening products; Figure 5 A prediction graph of NLP1 sequence structure; Figure 6 A graph showing the predicted sequence structure of NLP2; Figure 7 NLP3 sequence structure prediction diagram; Figure 8 NLP4 sequence structure prediction diagram; Figure 9 NLP5 sequence structure prediction diagram; Figure 10 NLP6 sequence structure prediction diagram; Figure 11 The graph shows the NLP1 affinity test results. Figure 12 This is a diagram showing the docking of NLP1 with NL-lactic-L-phenylalanine molecules; Figure 13 Figures show the simulation results of NLP1 and NL-lacticoyl-L-phenylalanine molecules, where a is the root mean square deviation of NLP1 and NL-lacticoyl-L-phenylalanine, b is the root mean square fluctuation of NLP1 and NL-lacticoyl-L-phenylalanine, c is the radius of gyration of NLP1 and NL-lacticoyl-L-phenylalanine, and d is the number of hydrogen bonds of NLP1 and NL-lacticoyl-L-phenylalanine. Figure 14 The graph shows the results of gradient concentration detection using the ThT method. Figure 15 This is a graph showing the fluorescence detection results of cell samples using the ThT method. Detailed Implementation
[0015] The present invention will be further described below with reference to the accompanying drawings and embodiments. The following embodiments are illustrative of the present invention, but the present invention is not limited to the following embodiments: Example 1: Screening of nucleic acid aptamers that specifically bind to NL-lactic-L-phenylalanine
[0016] This embodiment describes a method for screening nucleic acid aptamers that specifically bind to NL-lactyl-L-phenylalanine, comprising the following steps: (1) Synthesize random DNA libraries and primers The sequence of the random DNA library is: GCAGTATTCCACGAGTCGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGCCTAGTAGACGTCATG; Primer information is shown in Table 1, and the primers were synthesized by Shanghai Sangon Biotech Co., Ltd.
[0017] Table 1 Primers and their sequences NL-Lac-Phe-FAM-FP FAM-GCAGTATTCCACGAGTCGAT NL-Lac-Phe -Biotin-RP Biotin-CATGACGTCTACTAGGCTGA The primers were prepared into 100µM stock solutions using ddH2O and stored at -20℃ for later use.
[0018] (2) GO-SELEX screening: Perform at least 12 rounds of screening and reverse screening, and gradually reduce the amount of target added as the number of screening rounds increases; The experiment used the GO-SELEX method, with a total of 12 rounds of screening. The specific screening criteria are as follows: (1) Positive screening test: Mix 10 μL ssDNA with 190 μL 2xPBS MTAfter mixing, add 200 μL of deionized water to obtain a mixture; incubate the mixture at 95℃, 0℃ and room temperature for 10 min respectively, add the target, incubate for 1 h, and then add 60 μL of GO (2 mg / mL) and 60 μL of 2xPBS. MT Incubate at room temperature for 30 min; centrifuge multiple times at 25℃ to collect the supernatant, add 1 / 10 volume of sodium acetate and 1 mL of anhydrous ethanol, freeze at -20℃ for 2 h, centrifuge again to collect the precipitate, wash the precipitate with 70% ethanol (water:ethanol = 30:70 volume ratio) and centrifuge to remove the supernatant, dry at 95℃ and dissolve in water to obtain the positive sieve product, and store for later use. (2) Reverse screening experiment: Mix 10 μL ssDNA and 190 μL 2xPBS MT After mixing, add 200 μL of deionized water to obtain a mixture; incubate the mixture at 95℃, 0℃ and room temperature for 10 min respectively, add reverse screening target (1:500), incubate for 1 h, then add 60 μL of GO (2 mg / mL) and 60 μL of 2xPBS. MT Incubate at room temperature for 30 min; centrifuge multiple times at 25°C to collect the precipitate and crush it, then add 2xPBS containing the target. MT The solution was centrifuged multiple times at 25℃ to obtain the supernatant. 1 / 10 volume of sodium acetate and 1 mL of anhydrous ethanol were added, and the solution was frozen at -20℃ for 2 hours. The precipitate was centrifuged again, washed with 70% ethanol (water:ethanol = 30:70 volume ratio), and the supernatant was removed by centrifugation. The solution was dried at 95℃ and dissolved in water to obtain the reverse screening product, which was then stored for later use. (3) PCR amplification: Add the screening product to 900 μL of PCR mix premix and mix well. Using the library primer part as template, divide the template and PCR mix premix into 100 μL / tube and add it to the PCR tube for amplification. The amplification conditions are 95℃ pre-denaturation for 3 min, 95℃ denaturation for 30 s, 55℃ annealing for 30 s, and 72℃ extension for 30 s, for a total of 25 cycles to obtain the amplification product. Store at 4℃. Table 2 PCR mix premix formulation forward primer 40 reverse primer 40 2x Taq enzyme mixture 500 Ultrapure water 220 DNA template 200 (4) Secondary library preparation: The amplification products were purified using streptavidin magnetic beads to prepare secondary libraries for the next round of screening. 1 / 5 volume of 4M sodium chloride was added to 1 mL of amplification products. After incubation on a shaker at room temperature for 60 min, the supernatant of the PCR product was removed using a magnetic rack. The magnetic beads were then washed 3 times with phosphate buffer. After removing the supernatant, 20 μL of 0.2M sodium hydroxide solution was added. After incubation for 3 min, the magnetic beads were removed by magnetic suction. 4 μL of 1M hydrochloric acid was added to dilute and neutralize the mixture. The secondary library was then obtained and could be used as the library for the next round of screening. A total of 12 rounds of screening were carried out. (5) Through high-throughput sequencing, a nucleic acid aptamer that can specifically bind to NL-lactic-L-phenylalanine was finally screened.
[0019] 1. Melting curve detection q-PCR detection: The products from each round of screening were amplified under the following conditions: 95℃ pre-denaturation for 4 min, 95℃ annealing for 30 s, and 60℃ extension for 30 s, for a total of 40 cycles. Table 3 q-PCR mix premix formulation forward primer 0.4 reverse primer 0.4 Fluorescent quantitative premixed solution 10 Ultrapure water 8.2 DNA sample 1 Melting curve determination was performed by adding a melting curve determination program to the q-PCR amplification program. The specific conditions were set as follows: hold at 50℃ for 5 s, then increase the temperature to 90℃ at a rate of 0.5℃ / s, then decrease the temperature to 60℃ and hold for 30 s, and finally hold at 4℃ for 30 s.
[0020] Figure 1 The experimental results showed that the screened library exhibited significant enrichment. This indicates that the final product obtained after 12 rounds of screening was ready for subsequent sequencing.
[0021] 2. Screening recovery rate determination Depend on Figure 2 It can be seen that increasing the screening pressure significantly reduces the recovery rate. However, as the screening progressed, the recovery rate in the 12th round of screening remained above 60%, indicating that the product may have become enriched.
[0022] 3. Homology analysis of screening products The top 50 sequences with the highest replication count were selected for homology and motif analysis. Figure 3 and Figure 4 As can be seen from the experiment, the sequences in the screened products mainly consist of four families, and some families show a high degree of homology (>30%). Furthermore, the sequence information of the top six sequences with the highest replication numbers (excluding primers) is shown in Table 4, and the overall structure including the primers is shown in Table 4. Figure 5-10 As observed, the free energies of the six sequences are -12.7 (NLP1), -8.99 (NLP2), -8.99 (NLP3), -8.17 (NLP4), -14.72 (NLP5), and -9.87 (NLP6) kcal / mol, respectively.
[0023] The sequence of NLP1 (SEQ ID NO.1) is as follows: GCAGTATTCCACGAGTCGATGCTAGTCGGCCGGGGCAATACTGTCATGCGACACTTGGCTTCAGCCTAGTAGACGTCATG; The sequence of NLP2 (SEQ ID NO.2) is as follows: GCAGTATTCCACGAGTCGATGTATCGAACGCTGTGGACAGGACGAGACGGGTGGGTTTACTCAGCCTAGTAGACGTCATG The sequence of NLP3 (SEQ ID NO.3) is as follows: GCAGTATTCCACGAGTCGATTTATCGAACGCTGTGGACAGGACGAGACGGGTGGGTTTACTCAGCCTAGTAGACGTCATG The sequence of NLP4 (SEQ ID NO.4) is as follows: GCAGTATTCCACGAGTCGATAGAGGAGTGGAGTGACTCGGTCAGGTGGATACCTTGTGTGTCAGCCTAGTAGACGTCATG The sequence of NLP5 (SEQ ID NO.5) is as follows: GCAGTATTCCACGAGTCGATCACATCGAATCTTGGAATGCTCTTGTCGTCTAGAAGTGCTTCAGCCTAGTAGACGTCATG The sequence of NLP6 (SEQ ID NO.6) is as follows: GCAGTATTCCACGAGTCGATGCTAGTCGGCCTGGGCAATACTGTCATGCGACACTTGGCTTCAGCCTAGTAGACGTCATG.
[0024] Table 4. Sequence information of random portions of the screened products excluding primers. NLP1 GCTAGTCGGCCGGGGCAATACTGTCATGCGACACTTGGCT 619908 NLP 2 GTATCGAACGCTGTGGACAGGACGAGACGGGTGGGTTTAC 246983 NLP 3 TTATCGAACGCTGTGGACAGGACGAGACGGGTGGGTTTAC 201097 NLP 4 AGAGGAGTGGAGTGACTCGGTCAGGTGGATACCTTGTGTG 148979 NLP 5 CACATCGAATCTTGGAATGCTCTTGTCGTCTAGAAGTGCT 113593 NLP 6 GCTAGTCGGCCTGGGCAATACTGTCATGCGACACTTGGCT 37308 Example 2: Affinity detection of NL-lactyl-L-phenylalanine aptamer (NLP1) with NL-lactyl-L-phenylalanine
[0025] The affinity of the selected aptamer for NL-lacticoyl-L-phenylalanine was assessed using isothermal titration calorimetry (ITC). NL-lacticoyl-L-phenylalanine (2 mM) and the aptamer (NLP1: 20 μM) were dissolved separately in buffer (2 μM PBS). MT The experiment was conducted with a stirring speed of 750 rpm and a temperature maintained at 25 °C. A total of 19 injections were performed, with the first injection being 0.4 μL, followed by subsequent injections of 2 μL of NL-lactyl-L-phenylalanine solution, with each injection spaced 120 s apart. Finally, the detection results were integrated and analyzed.
[0026] Depend on Figure 11 As can be seen, the ITC affinity assay results indicate that NLP1 has an affinity of 125 μM R for NL-lactyl-L-phenylalanine. 2 =0.99. Therefore, it can be determined that the screened sequence NLP1 has an affinity for NL-lactyl-L-phenylalanine.
[0027] Example 3: Analysis of the binding mechanism between NL-lactic-L-phenylalanine aptamer (NLP1) and NL-lactic-L-phenylalanine.
[0028] Molecular docking was performed using Autodock-VINA, with binding energies predicted based on the AMBER force field. The nucleic acid receptor structure was preprocessed in AutoDock Tools (ADT), including completing missing hydrogen atoms and assigning Gasteiger-Marsili charges. The number of docking iterations was set to 20. The docking box parameters were: center x-coordinate = 111.824, center y-coordinate = -45.144, center z-coordinate = -68.239, x-axis dimension = 120, y-axis dimension = 106, z-axis dimension = 126, spacing = 0.994. Molecular dynamics simulations of the DNA-ligand complex were performed using the GROMACS software package. The DNA was parameterized using the amber99sb-ildn force field, and the ligand force field parameters were described using GAFF2. The complex was placed in a simulation box with periodic boundary conditions, with a minimum distance of 1.0 nm between the system and the box boundary.
[0029] Before formal molecular dynamics simulations, the steepest descent method is used to minimize the energy of the system until the maximum force on the system is less than 1000 kJ·mol⁻¹. -1 ·nm -1 Then, a 50 ns equilibrium simulation was performed under the NPT ensemble, during which positional constraints were imposed on the DNA backbone atoms. The temperature was controlled using a V-rescale temperature controller (target temperature 310 K), and the pressure was controlled using a Parrinello-Rahman pressure controller (target pressure 1 bar).
[0030] After equilibration, molecular dynamics simulations of the production phase were performed in the NPT ensemble for 50 ns, with an integration time step of 2 fs. Long-range electrostatic interactions were calculated using the Particle Mesh Ewald (PME) method, with a van der Waals interaction cutoff radius of 1.0 nm. All hydrogen bond lengths were constrained using the LINCS algorithm. Trajectory files were saved at 50 ps intervals for subsequent structural stability and hydrogen bond analysis.
[0031] Depend on Figure 12 As can be seen, after molecular docking of NLP1, the binding energy between NLP1 and NL-lactyl-L-phenylalanine is -7.347 kcal / mol. Spatial relative position analysis shows that the ligand binds to the specific binding cavity of the nucleic acid, the system has a low binding free energy, and the two form multiple sets of non-covalent interactions, confirming that the ligand and receptor can form a stable complex.
[0032] Depend on Figure 13 As can be seen, molecular simulation results show that after NLP1 binds to NL-lacticoyl-L-phenylalanine, the root mean square deviation (RMSD) of the complex rapidly increases and then stabilizes. This indicates that the NLP1-NL-lacticoyl-L-phenylalanine complex is in a stable conformation after binding.
[0033] Depend on Figure 13 As shown in b, among the DNA bases within <0.5 nm of NL-lactyl-L-phenylalanine, four bases correspond to the molecular docking results. Furthermore, the low root mean square fluctuation (RMSF) indicates that the binding with NL-lactyl-L-phenylalanine tends to be stable overall. Similarly, from... Figure 13 As can be seen from c, the radius of gyration (Rg) also indicates that the structure is in a stable conformation. Finally, hydrogen bond analysis was performed by... Figure 13 As can be seen, after NLP1 binds to NL-lactic-L-phenylalanine, there are weak hydrogen bonds in the system, and the number of hydrogen bonds is basically stable at 4, indicating that the binding mode is stable.
[0034] Example 4: Detection of NL-lactic-L-phenylalanine based on thioflavin-T (ThT) fluorescence detection method
[0035] After diluting the library to a final concentration of 1 μM, 10 μL of the library and 10 μL of 1 μM ThT solution were added to each sample for affinity experiments. After renaturation, the library was incubated with target solutions of different concentrations (420 nM, 4.2 μM, 42 μM, 420 μM, 4.2 mM) for 1 h at room temperature. 100 μL of the sample was placed in a 96-well plate for fluorescence intensity detection at excitation and emission wavelengths of 425 nm and 495 nm, respectively.
[0036] Fluorescence detection of NL-lactyl-L-phenylalanine was performed using conjugates or derivatives of nucleic acid aptamers. Figure 14 As can be seen, taking the ThT fluorescence method as an example, the R of the NL-lactyl-L-phenylalanine aptamer (NLP1) in the equation... 2 =0.99. Therefore, it can be determined that the experimentally selected sequence NLP1 has good linearity for NL-lactic-L-phenylalanine.
[0037] Depend on Figure 15 It can be seen that the ThT method can be used to determine NL-lactic-L-phenylalanine in cell culture medium using NLP1. After comparison, it was found that the aptamer has a good direct detection effect on NL-lactic-L-phenylalanine in cell culture medium, with a detection accuracy of 99.87±5.61%.
[0038] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Any person skilled in the art can make many possible variations and modifications to the technical solutions of the present invention, or modify them into equivalent embodiments, without departing from the spirit and technical essence of the present invention. Therefore, any simple modifications, equivalent substitutions, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention, without departing from the content of the technical solutions of the present invention, shall still fall within the scope of protection of the present invention.
Claims
1. A nucleic acid aptamer that specifically binds to NL-lactyl-L-phenylalanine, characterized in that, The nucleotide sequence of the nucleic acid aptamer is GCTAGGTCGGCCGGGGCAATACTGTCATGCGACACTTGGCT.
2. A conjugate of a nucleic acid aptamer, characterized in that, The nucleic acid aptamer is the nucleotide sequence as described in claim 1; the conjugate of the nucleic acid aptamer includes a fluorescent label.
3. A fluorescence method for detecting NL-lactyl-L-phenylalanine, wherein the fluorescence method is for non-disease diagnosis and non-disease treatment purposes, characterized in that, This includes conjugates using any of the nucleic acid aptamers as described in claim 1, or the nucleic acid aptamer as described in claim 2.
4. The application of the nucleic acid aptamer according to claim 1 or the conjugate of the nucleic acid aptamer according to claim 2 in the direct detection of NL-lactyl-L-phenylalanine, wherein the application is for non-disease diagnosis and non-disease treatment purposes.
Citation Information
Patent Citations
Screening and application of aptamer specifically bound with chlorpromazine
CN114410637A
Rapid detection method for cell metabolite N-L-lactoyl-L-phenylalanine
CN118795011A