Novel mutations in the ANKRD11 gene and their application in risk screening for KBG syndrome
By detecting ANKRD11 gene mutants and using a cell model with low p53 protein expression, the challenges of screening for KBG syndrome have been solved, enabling early diagnosis and personalized intervention, and enriching the gene pool for KBG syndrome risk screening.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- QINGDAO WOMEN & CHILDREN HOSPITAL
- Filing Date
- 2026-03-17
- Publication Date
- 2026-06-09
Smart Images

Figure CN122168607A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of gene diagnosis and treatment technology, and in particular relates to novel mutations in the ANKRD11 gene and their application in risk screening for KBG syndrome. Background Technology
[0002] The ANKRD11 gene (OMIM 611192) encodes ankyrin repeat domain protein 11, and pathogenic variants can lead to KBG syndrome (KBGS, OMIM 148050). This syndrome is a multi-systemic genetic disorder with a wide range of clinical manifestations. Common phenotypes include: short stature (40%), head and neck abnormalities (such as microcephaly, round or triangular face, unibrow, wide or thick eyebrows, wide-set eyes, epicanthal folds, long palpebral fissures, enlarged auricles, recurrent otitis media (25%–31%), which may be accompanied by sensorineural, conductive, or mixed hearing loss; nasal features include a bulbous nasal tip, anteriorly tilted nostrils, and underdeveloped nasal ala; facial features include a long philtrum, thin upper lip, and macrodontia of the maxillary central incisors in the permanent dentition stage (85%–95%). Widening of the central incisor space, dental ridges, fused teeth, shovel-shaped teeth, missing or insufficient teeth, tooth depression, claw-like canines, crowded teeth, enamel hypoplasia, enlarged pulp chamber, and webbed neck. Skeletal abnormalities may manifest as cervical rib fusion, extra cervical ribs, vertebral fusion, vertebral arch abnormalities, endplate defects, thoracic kyphosis, finger flexion deformities, short fingers, syndactyly, joint flexion deformities, hip dysplasia, syndactyly of the second and third toes, and delayed skeletal maturation. Neurological abnormalities include developmental delay and intellectual disability. Symptoms include: seizures (50%), cerebellar vermis hypoplasia, corpus callosum dysplasia, optic nerve hypoplasia, enlarged cerebellomedullary cistern, type I Chiari malformation, periventricular nodular heterotopia, pineal cysts, posterior fossa arachnoid cysts, and abnormal electroencephalograms (EEGs). Mental and behavioral abnormalities occur in 50%–70% of cases, manifesting as inattention, obsessive-compulsive behaviors, anxiety, social withdrawal, delayed social development, and attention deficit hyperactivity disorder (ADHD). Digestive symptoms include feeding difficulties. Obstruction (20%), infantile vomiting, constipation, and gastroesophageal reflux. Cryptorchidism is present in approximately 25%–35% of male patients. Some patients may have ocular abnormalities such as strabismus, congenital cataracts, myopia, and macrokeratosis. Body wall manifestations include a single transverse palmar crease, low anterior or posterior hairline, skin pigmentation, ichthyosis, hirsutism, abnormal hair whorls, and nail dystrophy. Cardiovascular abnormalities occur in 10%–26% of cases, with atrial septal defects and ventricular septal defects being the most common.
[0003] Of the reported cases of KBG syndrome worldwide, approximately 78.0% are caused by single-base mutations or small insertions / deletions in the ANKRD11 gene, while the remaining 22.0% are associated with microdeletions at 16q24.3. De novo variants account for the vast majority, representing approximately 81.9% of single-gene mutations and 75.0% of chromosomal deletions. In terms of mutation type distribution, frameshift mutations account for the highest proportion (approximately 65.2%), followed by nonsense mutations (approximately 27.3%), with other types of mutations being relatively less common. Furthermore, studies such as "Olfactory bulbanomalies in KBG syndrome mouse model and patients," "The chromatin regulator Ankrd11 controls cardiac neural crest cell-mediated outflow tract remodeling and heart function," "Insights into the ANKRD11 variants and short-stature phenotype through literature review and ClinVar database search," "ANKRD11 binding to cohesin suggests a connection between KBG syndrome and Cornelia deLange syndrome," and "Missense variants in ANKRD11 cause KBG syndrome by impairment of stability or transcriptional activity of the encoded protein" have all confirmed that abnormal ANKRD11 protein function is a sufficient condition for KBG syndrome. In-depth analysis of ANKRD11 gene mutants not only helps to clarify the molecular pathogenic mechanism of KBG syndrome but also provides crucial scientific evidence for early genetic diagnosis, genetic counseling, and personalized intervention for this disease. Meanwhile, functional studies based on the ANKRD11 mutant can lay an important molecular foundation for the development of targeted therapy strategies and the screening of specific drugs, and have significant translational medicine value and clinical application prospects. Summary of the Invention
[0004] This invention provides novel mutations in the ANKRD11 gene and their application in KBG syndrome risk screening, primarily to further improve the KBG syndrome screening mechanism, while also expanding our understanding of the ANKRD11 gene.
[0005] To solve the above problems, the present invention adopts the following technical solution: The first aspect of the present invention provides an ANKRD11 gene mutant, wherein the ANKRD11 gene mutant is any one of the following: The nucleic acid has a target fragment, and the target fragment has a deletion of nucleotide A at position 4109 compared with the wild-type ANKRD11 gene with the sequence SEQ ID NO.1, i.e., the ANKRD11 gene c.4109delA mutation; The polypeptide has the p.K1370Rfs*39 mutation compared to the protein encoded by the wild-type ANKRD11 gene, which has the sequence SEQ ID NO.2.
[0006] Furthermore, the protein encoded by the wild-type ANKRD11 gene is the wild-type ANKRD11 protein. When this gene undergoes the c.4109delA mutation, the 1370th amino acid of the protein it encodes changes from lysine to threonine, causing a complete change in the sequence of all subsequent amino acids from that site, and a premature stop codon appears near position 1409, leading to premature termination of protein synthesis.
[0007] Regarding the effects of ANKRD11 gene mutants on organisms and their organs: ANKRD11 protein, as an important nuclear transcriptional co-regulator, can induce disease phenotypes when its function is abnormal (usually due to haploinadequacy caused by gene mutations or inactivation of key functional domains). Specifically, loss of ANKRD11 function first impairs its interactions with chromatin regulatory complexes (such as cohesin) and histone deacetylases (such as HDAC3), thereby disrupting chromatin structural stability and the coordination of target gene transcription programs. This molecular-level disruption further leads to decreased expression levels of downstream key regulatory genes (such as SETD5), impairing ribosome biosynthesis and global protein translation efficiency, thus affecting cell growth and metabolic homeostasis. At the developmental level, the aforementioned molecular and cellular cascade abnormalities specifically affect cell populations highly dependent on ANKRD11 function: impaired proliferation, differentiation, and migration of neural progenitor cells lead to abnormal brain structure, agenesis of the corpus callosum, and intellectual disability; dysregulation of the developmental program of craniofacial neural crest cells causes typical facial features (including prominent brow ridges and a broad nasal bridge); and impaired differentiation and growth of skeletal and dental progenitor cells manifest as delayed skeletal development, oblique fifth finger, and macrodontia. Therefore, ANKRD11 dysfunction, by disrupting the chromatin regulatory network and causing dysregulation of key developmental gene expression, impairs the normal developmental processes of multiple cell lineages, including neural, craniofacial, and skeletal cells, ultimately leading to the comprehensive clinical manifestations of KBG syndrome, including intellectual disability, distinctive facial features, skeletal abnormalities, and dental malformations.
[0008] It should be noted that the above sequence alignment uses a specific site as an example, primarily to indicate the location of the newly discovered mutation. The emphasis is on highlighting the presence of this mutation, and it does not require that other sites be completely identical to the wild-type sequence. In short, any sequence that, compared to the aforementioned wild-type sequence, possesses the newly discovered mutation described in this finding at a specific site should be considered within the scope of this finding; variations at other sites are not considered.
[0009] The second aspect of this invention provides the application of reagents for detecting the aforementioned ANKRD11 gene mutation in the preparation of products for screening individuals at risk of KBG syndrome. Individuals at risk of KBG syndrome can be understood as: individuals with KBG syndrome or those at risk of developing KBG syndrome, such as unborn fetuses or infants who are still developing and may not fully exhibit the characteristics of KBG syndrome, but it is still clear that this group is at risk of KBG syndrome, and the phenotype of KBG syndrome will appear as they develop.
[0010] The reagent for detecting the aforementioned ANKRD11 gene mutation can be any one of a gene chip, primers, or probes. By detecting the presence of the aforementioned ANKRD11 gene mutant in a sample (e.g., peripheral blood), it can be determined whether the sample comes from a patient with KBG syndrome or a high-risk group (formed and unformed fetuses are temporarily categorized as patients or high-risk groups). This is because the presence of the aforementioned ANKRD11 gene mutant necessarily indicates that the tested individual has KBG syndrome or is at risk. More specifically, the reagent for detecting the aforementioned ANKRD11 gene mutant is at least one of a probe or primer specifically targeting the aforementioned ANKRD11 gene mutant, and can also be other methods such as Sanger sequencing, NGS sequencing, etc. (all within the scope of the claims of this invention). The primers are primer pairs: forward primer: 5'ACGGAGCCACCTGGAGACGACAA3', reverse primer: 5'GCGGGGCGGGCTGTCCTT3'.
[0011] In genetic risk screening tests, this test kit is primarily used to analyze the presence of the aforementioned ANKRD11 gene c.4109delA site mutation in the peripheral blood sample of the test subject. By directly detecting the presence of this specific gene variant, key molecular evidence can be provided for relevant genetic risk assessment, helping to determine whether an individual carries this pathogenic mutation.
[0012] A third aspect of this invention provides a method for constructing a cell model with low p53 protein expression; the method involves transfecting a c.4109delA mutant ANKRD11 overexpression plasmid into a tool cell line. This method provides a novel cell model that can obtain low p53 protein expression, which can be used as a research model for scientific research purposes.
[0013] Regarding the choice of cell line, the HEK293 cell line was used in this experiment. This cell line is widely used in recombinant protein expression and signaling pathway research. Transfection was performed using the Lipofectamine™ 3000 transfection kit, which has high transfection efficiency and good cell compatibility. For the specific implementation of plasmid construction and transfection methods, relevant literature or standard operating procedures can be referred to. These are routine techniques in this field, possessing reliability and reproducibility.
[0014] This disclosure provides a novel pathogenic mutation ANKRD11 c.4109delA for KBG syndrome, enriching the gene pool for KBG syndrome risk screening. It offers a novel approach, particularly for prenatal KBG syndrome screening, further reducing the risk of missed screening results. This enhances clinicians' understanding of the disease, provides experience for clinical screening and diagnosis, and also provides a basis for prenatal diagnosis. Attached Figure Description
[0015] Figure 1 A schematic diagram of the pedigree of KBG patients; Figure 2 Anteroposterior view of the left wrist joint of the KBG proband; Figure 3 Sanger sequencing validation peak diagram of the c.4109delA mutation site in the ANKRD11 gene of the KBG proband and his parents; Figure 4 High-throughput sequencing results for KBG proband variants; Figure 5 This is a diagram showing the expression of the c.4109delA mutant of the ANKRD11 gene and the related p53 protein. Detailed Implementation
[0016] The present invention will be further described in detail below with reference to specific research examples. However, this should not be construed as limiting the scope of the present invention to the following embodiments.
[0017] I. Research on pathogenic genes and mutation sites 1. Sample collection: The inventor collected a family history of KBG syndrome, such as Figure 1 As shown, □ represents a normal male, ○ represents a normal female, ● represents a female with the disease, and ↗ represents a proband. All family members involved in this invention research signed informed consent forms. The inventors collected peripheral blood samples from patients and normal individuals within the aforementioned KBG syndrome families.
[0018] The proband is a girl with moderate intellectual disability. At 18 months, she could stand and walk independently and initiate conversations. She had previously been diagnosed with developmental delay at a rehabilitation center but did not return for follow-up. Upon entering kindergarten, she was found to be poor in math, but her literacy and memory were acceptable. She could engage in daily conversation, was talkative and spoke quickly, and denied any stereotyped behaviors. Her head circumference was 48cm, her general condition was good, but her facial features were distinctive. She could make eye contact, but her behavior was childish. She spoke quickly, with slightly poor speech clarity, but could follow verbal commands. She was hyperactive, showed joint attention, and had a low cognitive level. In August 2024, a Wechsler Intelligence Scale test (WISC) showed an IQ of 53-64-70-49, with a total IQ of 53. A cranial MRI showed deepened cerebellar sulci. At age 6, a CT scan of her left wrist revealed a bone age equivalent to approximately 2 years old.
[0019] 2. Whole exome sequencing The inventors used the Roche KAPA HyperExome in conjunction with the MGI-DNB-T7 sequencing platform to perform whole-exome sequencing on the proband in this family. The target region coverage was >99.79%, the proportion of sites with a depth greater than 20× in the target region was >99.33%, and the average sequencing depth was approximately 205.81×.
[0020] 2.1 Sample Preparation Peripheral blood was collected from the proband and their parents in the aforementioned family, and peripheral blood DNA was extracted using the Qiagen Blood DNA minikit 1.2.1 kit (Qiagen, Germany). Quantification was performed using Qubit, ensuring that at least 2 μg of each DNA sample was used for whole-exome sequencing.
[0021] 2.2 Library construction and sequencing DNA samples were randomly fragmented into 150-200 bp fragments using an E220 Covaris instrument. Following the manufacturer's instructions, fragment sizes were selected using AMPure XP Beads, followed by end repair, phosphorylation, and α-tailing. BGISEQ-500 platform-specific adapters were ligated to the α-tail fragments, the ligated fragments were purified, and amplified by PCR. Finally, the fragments were cycled to generate single-stranded DNA circulars. After quantitative identification, the library was sequenced.
[0022] 3. Variance detection, annotation, and database comparison 3.1 Sequencing Results and Analysis Whole-genome sequencing was performed on the proband and their parents. Sequencing data were matched with the SPAST genome reference using the Burrows-Wheeler alignment tool and annotated using snpEff 3 and the dbSNP database. First, all identified variants were screened using the dbSNP database, ExAC, HapMap database, 1000 genomes, and a local database of 100 healthy Chinese adults. Variants with a minor allele frequency (MAF) > 0.01 in healthy individuals were removed. Then, all filtered variants were compared with the OMIM and CGD databases to identify gene variants associated with the disease phenotype.
[0023] Whole-exome sequencing analysis and Sanger sequencing verification of specific variant sites were performed on the proband. The results showed that there was a heterozygous variant c.4109delA in exon 9 of the ANRKD11 gene in this case. This variant is a frameshift mutation, which causes the amino acid at position 1370 to change from lysine to arginine and causes the stop codon to appear prematurely, resulting in a truncated protein (p.K1370Rfs*39) (PVS1). This variant has not been reported in normal population gene databases (allele frequency (%): gnomAD:.) (PM2_PP). This variant is a de novo variant in this family (PS2_PP).
[0024] 3.2 Protein function analysis: ANKRD11 c.4109delA (p.K1370Rfs*39) This mutation manifests as a deletion of nucleotide A at position 4109, causing the amino acid at position 1370 of the encoded protein to be changed from lysine to arginine. This completely alters the amino acid sequence from position 1370 onwards, and a stop codon appears prematurely around position 1409, causing premature termination of protein synthesis and affecting normal protein translation. The protein encoded by ANKRD11 is highly conserved. When the ANKRD11 gene is abnormal, it leads to the production of a truncated protein, resulting in impaired protein function and ultimately inducing KBG syndrome.
[0025] 3.3 Analysis of Harmfulness and Pathogenicity Based on the above evidence and in accordance with the variant classification guidelines of the American College of Medical Genetics and Genomics (ACMG), the ANKRD11 c.4109delA (p.K1370Rfs*39) variant is a pathogenic variant (ACMG: PVS + 2PP).
[0026] 4. Sanger sequencing verification The ANKRD11 gene was sequenced in patients and their parents (normal individuals) within the family. Based on the sequence determination results, whether the mutation was wild-type or mutant, the correlation between the c.4109delA heterozygous mutation of the ANKRD11 gene and KBG syndrome was verified. The specific methods and steps are as follows: 1) DNA extraction Genomic DNA was extracted from the peripheral blood of the proband and his / her parents for later use.
[0027] 2) Primer design and PCR reaction Referring to the human genome sequence database GRCh37.1 / ANKRD11, specific primers targeting the c.4109delA mutation site with the nucleotide sequence shown below were designed, as detailed in the table below.
[0028] The extracted DNA was used as a template to perform a PCR reaction with the above-mentioned specific primers according to conventional methods in the art, and the purified PCR product was sequenced.
[0029] The PCR amplification products obtained from the patient and their parents were sequenced for DNA. Based on the sequencing results, the ANKRD11 gene coding sequence of the above samples was compared. The results showed that the proband carried a heterozygous c.4109delA mutation, while the parents of the proband who showed normal behavior did not carry this mutation. Therefore, it was preliminarily determined that this mutation is the pathogenic site of KBG syndrome.
[0030] 3) Test kit Prepare a detection kit containing primers suitable for ANKRD11 gene mutants (compared to SEQ ID NO.1, the ANKRD11 gene mutant has a c.4109delA mutation) for screening biological samples susceptible to KBG syndrome, wherein these primers include the aforementioned ANKRD11 gene-specific primers.
[0031] The specific steps for screening biological samples susceptible to KBG syndrome using the above kit are as follows: extract DNA from the subject, use the extracted DNA as a template to perform PCR reaction with the above specific primers, purify the PCR product according to conventional methods in the field, sequence the purified product, and then observe whether the sequenced sequence has the c.4109delA mutation to effectively detect whether the subject is susceptible to KBG syndrome.
[0032] 5. In vitro experiments to verify protein expression levels: 1) Plasmid construction: Overexpression plasmids for wild-type and c.4109delA mutant ANKRD11 were constructed and provided by Sangon Biotech (Shanghai) Co., Ltd.
[0033] 2) Cell transfection: HEK293 cells were cultured in 1×DMEM basic solution with 10% fetal bovine serum and 1% ampicillin-streptomycin added. Transfection was performed using the Lipofectamine™ 3000 transfection kit according to the manufacturer's instructions.
[0034] 3) Protein extraction and Western blot: Cells were washed with PBS buffer and lysed using RIPA lysis buffer on ice for 5 minutes. The samples were sonicated and centrifuged at 10,000 × g for 10 minutes at 4°C, and the supernatant was collected. The samples were diluted with 5× loading buffer and heated at 98°C for 10 minutes. Protein samples were separated using a 4%–12% SDS-PAGE gel and protein electrophoresis system according to the manufacturer's instructions.
[0035] Experimental results are as follows Figure 5 As shown, this mutation results in the production of a truncated protein, impairing its function and leading to abnormal function of the protein encoded by ANKRD11, further confirming its pathogenicity. Furthermore, this truncated protein causes a decrease in p53 protein expression levels. Previous studies have shown that ANKRD11 can activate the p53 signaling pathway, while the loss-of-function mutation in this study leads to the loss of ANKRD11 activity, thereby weakening its regulatory effect on p53 and ultimately causing downregulation of p53 expression. This molecular mechanism provides direct evidence for explaining the pathological process of KBG syndrome caused by this mutation.
[0036] II. Introduction and Application Cases of Mutants Here is a brief introduction to the clinical applications of this type of product. It can be used to analyze the obtained samples for testing. By analyzing whether the sample has specific mutations, it can determine whether the sample source has a certain disease or is a high-risk group, thus providing a reference for clinical diagnosis and treatment. In particular, it provides better guidance in preconception screening, and can screen for potential serious diseases in the fetus during pregnancy to provide accurate advice.
[0037] When applying it clinically, the general steps can be as follows: S1. Extract nucleic acid samples from biological samples (samples can also be provided directly by the testing party). The type of biological sample is not limited, as long as it can extract nucleic acid samples reflecting whether ANKRD11 is mutated. Human blood, skin, subcutaneous tissue, etc., can be selected, with peripheral blood being preferred for its ease of sampling and testing, improving the efficiency of screening biological samples susceptible to KBG syndrome. "Nucleic acid sample" is broadly understood to include whole-genome DNA, portions containing the ANKRD11 coding sequence, total RNA, mRNA, etc., expanding the sources of biological samples, identifying multiple pieces of information, and improving screening efficiency. If RNA is used as the nucleic acid sample, an RNA sample (preferably mRNA) must also be extracted from the biological sample, and cDNA samples obtained through reverse transcription.
[0038] S2. After obtaining the nucleic acid sample, analyze it to determine the nucleic acid sequence. The method and equipment are not limited; sequencing is acceptable. Second-generation, third-generation, and more advanced sequencing technologies can be used, such as devices like the HISEQ2000, to improve sequencing depth, detection sensitivity, and accuracy, thereby increasing detection and analysis efficiency and the precision and accuracy of subsequent analyses. Determining the nucleic acid sequence includes constructing a nucleic acid sequencing library and sequencing to obtain data results. "Nucleic acid sequence" is broadly understood to include any sequence containing the ANKRD11 coding sequence.
[0039] S3. After determining the nucleic acid sequence, compare it with SEQ ID NO.1. If there is a c.4109delA mutation, it indicates that the biological sample is susceptible to KBG syndrome. At the same time, it can be determined whether to use relevant kits, etc.
[0040] Therefore, the method for screening biological samples susceptible to KBG syndrome according to embodiments of the present invention can effectively screen biological samples susceptible to KBG syndrome. The method and equipment for comparing nucleic acid sequences with SEQ ID NO.1 are not particularly limited and can be performed using any conventional software. Unless otherwise specified, the technical means used in the embodiments are conventional means familiar to those skilled in the art and can be performed with reference to *Molecular Cloning: A Laboratory Manual*, 3rd edition, or related products. All reagents and products used are commercially available. Various processes and methods not described in detail are conventional methods known in the art. The source, trade name, and components of reagents used, if necessary, are indicated upon their first appearance. Subsequent use of the same reagents, unless otherwise specified, are identical to the initial indication.
[0041] Those skilled in the art will appreciate that various modifications can be made to the above embodiments without departing from the overall spirit and concept of the present invention. For any aspects not detailed herein, reference can be made to the prior art. All such modifications fall within the protection scope of the present invention. The protection scheme of the present invention is defined by the appended claims.
Claims
1. An ANKRD11 gene mutant, characterized in that, The ANKRD11 gene mutant is any one of the following: Nucleic acid having a target fragment, and the target fragment having a c.4109delA mutation compared to the wild-type ANKRD11 gene with the sequence SEQ ID NO.1; The polypeptide has the p.K1370Rfs*39 mutation compared to the protein encoded by the wild-type ANKRD11 gene, which has the sequence SEQ ID NO.
2.
2. The ANKRD11 gene mutant according to claim 1, characterized in that, The protein encoded by the wild-type ANKRD11 gene is the wild-type ANKRD11 protein.
3. The use of the reagent for detecting the ANKRD11 gene mutation in claim 1 in the preparation of products for screening individuals at risk of KBG syndrome.
4. The application according to claim 3; wherein, The reagent for detecting the ANKRD11 gene mutant in claim 1 is any one of a gene chip, primers, or probes.
5. The application according to claim 4; wherein, The primers are primer pairs: forward primer -5'ACGGAGCCACCTGGAGACGACAA3', reverse primer -5'GCGGGGCGGGCTGTCCTT3'.
6. The application according to claim 3; wherein, The at-risk population for KBG syndrome refers to patients with KBG syndrome or those at risk of developing KBG syndrome.
7. A method for constructing a cell model with low p53 protein expression; characterized in that, The overexpression plasmid of c.4109delA mutant ANKRD11 was transfected into the tool cell line.
8. The method for constructing a cell model with low p53 protein expression according to claim 7; characterized in that, The cell line used was HEK293; transfection was performed using the Lipofectamine™ 3000 transfection kit.