Application of msrb3 gene / protein as target in screening of drugs for inhibiting replication of foot-and-mouth disease virus
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- LANZHOU VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES(LANZHOU BRANCH CENTER OF CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER)
- Filing Date
- 2026-04-08
- Publication Date
- 2026-06-09
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and animal viruses, specifically involving the application of MSRB3 as a target for foot-and-mouth disease virus, as well as the construction method and application of MSRB3-targeting sgRNA, MSRB3 gene knockout cell line. Background Technology
[0002] Foot-and-mouth disease (FMD) is an acute, highly contagious infectious disease caused by foot-and-mouth disease virus (FMDV), primarily infecting cloven-hoofed animals such as cattle, sheep, and pigs. Characterized by rapid transmission and high infection rates, it is one of the most significant animal diseases affecting global livestock production. FMDV belongs to the genus *Aphthovirus* within the family Picornaviridae. Its genome is a single-stranded positive-sense RNA that encodes structural proteins and various non-structural proteins, playing crucial roles in viral replication, protein translation, and viral particle assembly. The frequent genetic variation and diverse serotypes of FMDV pose significant challenges to vaccine immunization and disease control. Therefore, a thorough analysis of its replication mechanism from the perspective of virus-host interaction is essential for discovering new antiviral targets and developing novel prevention and control strategies.
[0003] Viral replication is highly dependent on a variety of molecular environments and functional proteins provided by the host cell. After infecting host cells, FMDV's genome replication, protein translation, and viral particle assembly all require the participation and regulation of host factors. Some host proteins can promote or inhibit viral replication by regulating cellular metabolism, signaling pathways, or protein translation systems. Therefore, systematically identifying and studying key host factors involved in FMDV replication regulation is of great value for a deeper understanding of viral replication mechanisms and the development of new antiviral strategies.
[0004] Methionine sulfoxide reductase B3 (MSRB3) belongs to the methionine sulfoxide reductase (MSR) family and is mainly involved in the repair of oxidatively damaged proteins, playing a crucial role in maintaining intracellular redox homeostasis and protein functional stability. Previous studies have shown that cellular redox status is closely related to viral infection; viral replication is often accompanied by changes in cellular oxidative stress levels, and host cells can influence viral RNA replication and protein expression through redox regulatory mechanisms. However, there are currently no reports on MSRB3 regulating viral replication, and its function in FMDV replication remains unclear.
[0005] With the development of CRISPR / Cas9 gene editing technology, researchers can efficiently construct gene knockout models at the cellular level, thereby systematically studying the functions of host factors in viral replication. This technology has been widely used in virus-host interaction studies, providing an important tool for screening and identifying viral replication-related host factors. Therefore, constructing an MSRB3 gene knockout cell model using CRISPR / Cas9 technology will help to further clarify the specific role of this protein in FMDV infection.
[0006] To address the gaps in existing technologies, this invention constructs an MSRB3 gene knockout cell line using CRISPR / Cas9 technology. Combined with RNA interference and overexpression experiments, it systematically verifies the role of MSRB3 in the replication process of foot-and-mouth disease virus, clarifying that MSRB3 can serve as a key target for resistance to foot-and-mouth disease virus. At the same time, it provides related sgRNA, cell lines, and applications, making up for the deficiencies of existing technologies. Summary of the Invention
[0007] The purpose of this invention is to overcome the shortcomings of the prior art, to clarify for the first time the promoting effect of MSRB3 on FMDV replication, to provide its application as an anti-FMDV target, and to provide sgRNA targeting porcine MSRB3, MSRB3 gene knockout cell lines and their construction methods, so as to provide tools and foundation for anti-FMDV drug screening and viral replication mechanism research.
[0008] This invention provides the application of the MSRB3 gene or protein as a target in the preparation or screening of drugs against foot-and-mouth disease virus (FMDV). Based on the key promoting role of MSRB3 in FMDV replication discovered in this invention, inhibiting MSRB3 expression can effectively inhibit FMDV replication, thus providing a clear target and direction for the development of novel anti-FMDV drugs. The drug may contain an inhibitor of MSRB3 gene / protein expression, such as an RNA interference molecule (siRNA) targeting MSRB3 or an sgRNA targeting and knocking out the MSRB3 gene.
[0009] This invention provides a gRNA for targeting and knocking out the MSRB3 gene, wherein the sgRNA is selected from at least one of susMSRB3-KO#1, susMSRB3-KO#2, and susMSRB3-KO#3; the primer sequence of the sgRNA is shown below: susMSRB3-KO#1-F: CACCGTCCTACGGGATGCACAGGG; susMSRB3-KO#1-R:AAACCCCTGTGCATCCCGTAGGAAC; susMSRB3-KO#2-F: CACCGTGAGTGACATGGTACTGCAG; susMSRB3-KO#2-R:AAACCTGCAGTACCATGTCACTCAC; susMSRB3-KO#3-F: CACCGTTCCACCCTGTGCATCCCGT; susMSRB3-KO#3-R:AAACACGGGATGCACAGGGTGGAAC.
[0010] The aforementioned sgRNA can specifically recognize the porcine MSRB3 gene, with high knockout efficiency and low off-target risk, making it suitable for CRISPR / Cas9 gene editing systems.
[0011] This invention provides a method for constructing an MSRB3 gene knockout cell line, comprising the following steps: (1) The above sgRNA was constructed into a CRISPR / Cas9 vector to obtain a recombinant knockout plasmid; (2) The recombinant knockout plasmid and the lentiviral packaging helper plasmid were co-transfected into the packaging cell line to obtain lentivirus; (3) The obtained lentivirus was used to infect host porcine cell lines. After drug screening and passage purification, a stable MSRB3 gene knockout cell line was obtained.
[0012] The host porcine cell line is PK-15 cells, IBRS-2 cells, or WSL cells; the packaging cell line is HEK293T cells.
[0013] The drug screening used puromycin screening, and after screening, the cells were passaged three or more times to obtain a stably inherited MSRB3 knockout cell line.
[0014] This invention provides applications of the MSRB3 gene knockout cell line constructed by the above method, including: applications in screening or preparing drugs against foot-and-mouth disease virus; applications in breeding pigs resistant to foot-and-mouth disease virus; and applications in studying the replication mechanism of foot-and-mouth disease virus.
[0015] This invention provides an application of MSRB3 gene / protein as a target in the preparation or screening of foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production enhancers; the enhancers can be used to increase the replication level of foot-and-mouth disease virus by promoting the expression of MSRB3 gene / protein, and can be used to increase the yield of virus or vaccine.
[0016] This invention provides the application of an MSRB3 gene / protein overexpression cell line in the preparation of foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production cell lines.
[0017] The method for constructing the MSRB3 gene / protein overexpression cell line includes the following steps: (1) Preparation of MSRB3 overexpression plasmid; (2) Construct a recombinant lentivirus containing the MSRB3 overexpression plasmid described in step (1); (3) The recombinant lentivirus prepared in step (2) was transduced into host cells, and after screening and culture, MSRB3 overexpression cell lines were obtained.
[0018] The beneficial effects of this invention are as follows: 1. This invention is the first to demonstrate that MSRB3 is a key host factor that promotes foot-and-mouth disease virus replication. Inhibiting MSRB3 expression or activity can significantly reduce foot-and-mouth disease virus RNA levels, viral protein expression levels, and progeny virus titers, providing a novel target for the development of anti-foot-and-mouth disease virus drugs.
[0019] 2. This invention screened three highly efficient sgRNAs targeting the porcine MSRB3 gene. These sgRNAs exhibit precise targeting and significant knockout effects, allowing for the stable construction of gene knockout cell lines without significant cytotoxicity or impact on host cell viability. The constructed MSRB3 gene knockout cell lines demonstrate stable genetic traits and are suitable for various porcine cell line models. They can be widely used for research on the replication mechanism of foot-and-mouth disease virus (FMDV), high-throughput screening of antiviral drugs, and animal breeding for FMDV resistance. This provides a theoretical basis for future prevention or inhibition of FMDV infection and demonstrates strong practicality.
[0020] 3. This invention uses three experimental strategies—gene knockout, RNA interference, and gene overexpression—to mutually verify each other, and has demonstrated the universality of its effects in three porcine cell lines: PK-15, IBRS-2, and WSL. The experimental results are reliable and provide important experimental evidence for elucidating the interaction mechanism between FMDV and host factors.
[0021] 4. This invention utilizes a lentiviral packaging system to construct a stable MSRB3 expression cell line, which promotes FMDV replication and serves as a production cell line for foot-and-mouth disease virus vaccine, showing broad application prospects. Attached Figure Description
[0022] Figure 1 This is a sequencing alignment diagram of the three constructed CRISPRV2-MSRB3 sgRNAs. A, B, and C correspond to the sequencing alignment results of the sgRNA sequences susMSRB3-KO#1, #2, and #3, respectively.
[0023] Figure 2 The results of protein level identification in MSRB3 knockout cell lines in PK-15, IBRS-2 and WSL cells (Western-blot).
[0024] Figure 3The effect of MSRB3 knockout on cell viability (CCK-8 assay).
[0025] Figure 4 The figure shows the experimental results of the effect of MSRB3 knockout on FMDV replication levels in PK-15, IBRS-2, and WSL cells. In the figure, A represents viral RNA levels (qPCR) in PK-15 cells; B represents viral titer (TCID) in PK-15 cells. 50 C represents the viral VP1 protein level in PK-15 cells (Western-blot); D and E represent the viral RNA levels in IBRS-2 and WSL cells, respectively.
[0026] Figure 5 The effect of RNAi inhibition of MSRB3 expression on FMDV RNA levels. Where A represents the relative expression level of MSRB3 after siRNA transfection; B represents the relative viral RNA level after FMDV infection.
[0027] Figure 6 The effect of MSRB3 overexpression on FMDV replication. A represents the change in viral RNA level (qPCR) after overexpression; B represents the change in viral titer (TCID). 50 C represents the validation of MSRB3 overexpression and viral VP1 protein levels (Western-blot). Detailed Implementation
[0028] The technical solution of the present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto. Unless otherwise specified, the experimental materials used in the following embodiments are all conventional commercially available products, and the experimental methods are all conventional operations in the art unless otherwise specified.
[0029] The materials used in this invention are as follows: Cells, strains, and plasmids: FMDV (O / BY / CHA / 2010) was preserved by the National Foot-and-Mouth Disease Reference Laboratory of Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences. PK-15 cells, IBRS-2 cells, WSL cells, the lentiviral eukaryotic expression plasmid Plov-Flag-MSRB3, and the lentiviral eukaryotic expression vectors Plov-Flag- and lentiCRISPRV2 were preserved by our laboratory.
[0030] Antibodies: Rabbit polyclonal antibody MSRB3 and β-ActinRabbitmAb were purchased from ABclonal. Rabbit polyclonal antibody FMDV-VP1 was purchased from Bio-Sens, rabbit anti-Flag antibody was purchased from Proteintech, and Goat AntiRabbit (HRP) was purchased from Abcam (UK).
[0031] Cellular experimental reagents: DMEM cell culture medium was purchased from Invitrogen (Shanghai) Trading Co., Ltd. Fetal bovine serum (FBS) was purchased from Biological Industries (BI). Opti-MEM medium, 0.25% EDTA trypsin, and 0.05% EDTA trypsin were purchased from Gibco. PBS buffer, 100× penicillin-streptomycin-gentamicin mixture, and ampicillin were all purchased from Beijing Solarbio Science & Technology Co., Ltd.; serum-free cell cryopreservation solution was purchased from Suzhou Xinsaimei Biotechnology Co., Ltd.; Lipo3000 liposome transfection reagent (L3000015) was purchased from Invitrogen; PepMutesiRNA transfection reagent was purchased from SignaGen. CCK-8 cell proliferation-toxicity assay kit was purchased from Shanghai Beyotime Biotechnology Co., Ltd.
[0032] Reagents used in molecular experiments: Restriction endonucleases and T4 ligases were purchased from Thermo Fisher Scientific, USA; DNA Marker was purchased from Beijing Qingke Biotechnology Co., Ltd.; PrimeSTARMax high-fidelity DNA polymerases were purchased from Baoriyi Biotechnology (Beijing) Co., Ltd.; gel extraction kits and DNA extraction kits were purchased from Omega, USA; T4 DNA ligase was purchased from New England Biolabs; plasmid miniprep kits were purchased from Tiangen Biotech (Beijing) Co., Ltd.; Escherichia coli DH5α competent cells were purchased from Shenzhen Kangti Life Science Co., Ltd.; ChamQ Universal SYBR® qPCR Master Mix (Q711-03) and 5×HiScript II QRT Super Mix for qPCR (R222-01) were purchased from Novizan Biotechnology Co., Ltd.; 96-well white plates for quantitative PCR and sealing film for qPCR plates were purchased from Bio-Rad.
[0033] MSRB3 siRNA was designed and synthesized by Shanghai Gemma Biotechnology Co., Ltd.; Trizol reagent was purchased from Baori Biotechnology (Beijing) Co., Ltd.; DEPC water was purchased from Shanghai Jierui Biotechnology Co., Ltd.; nitrocellulose membrane (NC membrane) was purchased from GE; WesternBrightECL luminescent substrate (K-12045-D50) was purchased from Advansta; WesternBrightECL luminescent solution (100ml) (ultrasensitive, femtogram grade) (phb-0174) was purchased from Abclonal; 4% paraformaldehyde was purchased from Solarbio.
[0034] Example 1: Design of sgRNA targeting porcine MSRB3, construction and validation of recombination knockout plasmids Searching for pigs (Susscrofa) on the NCBI website MSRB3 Gene sequences were used to select three sgRNAs with high knockout efficiency using the CHOPCHOP website. CACCG was added to the 5' end of the coding strand of the sgRNA sequences, and AAAC was added to the 3' end of the template strand to improve ligation. The designed sgRNAs were named susMSRB3-KO#1-F / R, susMSRB3-KO#2-F / R, and susMSRB3-KO#3-F / R. Overexpression plasmid primers for MSRB3 were designed using SnapGene™ 1.1.3 software and named plov-MSRB3-F / R. The primer sequences are shown in Table 1. All primers used in this invention were synthesized by Qingke Biotechnology Co., Ltd.
[0035] First, the lentiCRISPRV2 plasmid was digested with the restriction endonuclease Esp3I at 37°C for 2 hours. The digestion product was separated by agarose gel electrophoresis, followed by gel extraction and purification to obtain the linearized lentiCRISPRV2 vector. Then, 2 μL of each of the sgRNA oligonucleotide primers F and R was dissolved and added to 96 μL of ddH2O for annealing in a PCR instrument to form double-stranded inserts. The annealed product and the linearized vector were ligated using T4 DNA ligase at a volume ratio of 2:1 at room temperature or 16°C for 4-8 hours. The ligation product was then transformed into *E. coli* DH5α competent cells. After plating, single clones were picked and sequenced to confirm the correct construction of the recombinant plasmid. The constructed recombinant plasmid was sent to a biotechnology company for sequencing. Sequence alignment showed that all three sgRNA sequences were correctly inserted into the vector, confirming the correct construction of the recombinant plasmid (see [link to biotechnology documentation]). Figure 1 A, 1B, 1C).
[0036] Example 2: Construction and Identification of MSRB3 Gene Knockout Cell Lines 2.1 Lentiviral Packaging and Infection to Construct Knockout Cell Lines Methods: Healthy HEK293T cells were seeded into 6-well plates. The following day, when cell confluence reached 60%-80%, three sgRNA recombinant plasmids (total 2.5 μg) were co-transfected into the cells with lentiviral packaging helper plasmids LH1 (1.9 μg) and LH2 (1.3 μg). 10-12 h after transfection, the medium was replaced with antibiotic-free medium, and the cells were cultured for another 36-48 h, during which cytopathic effect (CPE) was observed. When cytopathic effects were evident, the cell culture supernatant was collected, filtered through a 0.45 μm filter, and polybrene (8 μg / mL) was added to infect PK-15, IBRS-2, and WSL cells plated the previous day. 24 h after infection, cells were selected using puromycin-containing medium and passaged at least three times to obtain a stable MSRB3 knockout cell line. An empty vector plasmid treatment group served as a control. Results: Given that the designed sgRNA is a porcine sequence, this invention selected three porcine cell lines (PK-15, IBRS-2, and WSL) to knock out the MSRB3 gene in these cells. After three consecutive passages in puromycin-containing medium, the surviving cells were identified. Immunoblotting results showed that a clear MSRB3 protein band was detected in the control group, while the MSRB3 band was significantly weakened or absent in MSRB3-KO cells; the internal control β-actin band remained stable. Figure 2 A, Figure 2 B Figure 2 C). The above results indicate that the MSRB3 knockout cell line was successfully constructed.
[0037] 2.2 Cell viability assay Methods: To rule out the impact of MSRB3 gene knockout on cell viability, the newly established knockout cell line was subjected to CCK-8 cell viability testing and compared with wild-type cells. Cells in the logarithmic growth phase were selected, and single-cell suspensions were prepared by trypsin digestion and cell counting was performed. Subsequently, the cells were counted at a rate of 1×10⁻⁶. 4 Cells were evenly seeded into 96-well plates and incubated in a cell culture incubator to allow for adhesion and recovery. At 24 and 40 hours of incubation, 10% (by volume) of CCK-8 working solution was added to each well, mixed thoroughly, and incubated for another 1-4 hours. After incubation, the absorbance of each well was read at 450 nm using a microplate reader, and cell viability was calculated accordingly. Results: The results showed that the overall cell viability levels of the control group and the two independently knocked-out cell lines (MSRB3-KO#1 and MSRB3-KO#2) were similar. Figure 3 This indicates that MSRB3 knockout did not cause a significant decrease in cell viability, thus providing cells in good condition for subsequent virus infection-related experiments.
[0038] Example 3: Effects of MSRB3 gene deletion on FMDV replication in various cell types 3.1. Effects on PK-15 cells Methods: To investigate the effect of MSRB3 knockout on FMDV replication, MSRB3 knockout cell lines were compared with control cell lines. Control PK-15 cells and MSRB3 knockout PK-15 cells were seeded in 12-well plates. After reaching a suitable level of cell confluence, FMDV was introduced at an MOI of 0.1. Cell samples were collected after 16 hours of post-infection culture, and total RNA was extracted using the TRIzol method. The extracted RNA was reverse transcribed using a 5×HiScript II QRTSuperMix II reverse transcription kit to synthesize cDNA. The reverse transcription product was diluted 10–50 times and used to prepare a real-time quantitative PCR (RT-qPCR) reaction system with ChamQ Universal SYBR® qPCR Master Mix, forward and reverse primers, and DEPC-treated water. GAPDH was used as an internal control gene, and the amplification curve was analyzed based on changes in SYBR Green fluorescence signal. Simultaneously, the supernatant after inoculation was collected for viral titer determination. Viral titer was determined using the half-maximal tissue culture infectious dose (TCID). 50 Method for titer determination: Indicator cells for titer determination are seeded in 96-well plates and cultured to a suitable condition; the virus sample to be tested is serially diluted 10-fold with culture medium (e.g., 10^6). -1 -10 -8 The cells were then seeded into the wells at the specified volume. After infection, the cells were incubated in an incubator, and CPE was dynamically observed over a specified time. The number of wells showing lesions at each dilution was recorded, and the proportion of positive wells was calculated. Finally, the Reed-Muench method was used to estimate TCID. 50 And convert it to a unit volume titer.
[0039] In addition, to validate at the protein level, FMDV protein expression was analyzed by Western blot: Samples were collected 0, 6, and 12 hours after FMDV infection. Samples were also collected when cell confluence reached 80%-90%. After discarding the culture medium in the wells, 2×SDS-PAGE loading buffer (containing β-mercaptoethanol) was added directly to lyse the cells, and the cells were incubated at room temperature for approximately 10 minutes. The lysate was then denatured in a 100°C metal bath for 10 minutes. 10 μL of the protein lysate from each sample was added to the wells of an SDS-PAGE gel for electrophoresis separation. Different volumes of protein molecular weight markers were added to both sides of the gel to determine band size and migration location. Once the target protein migrated to the expected separation region, it was transferred from the gel to an NC membrane using a wet / semi-dry transfer method. After transfer, transfer the membrane under constant pressure for approximately 1 hour. Then, place the NC membrane in TBS blocking buffer (5% skim milk powder) and block at room temperature for 30 minutes to 1 hour; alternatively, block overnight at 4°C with shaking to reduce non-specific binding. After blocking, transfer the membrane to primary antibody working buffer (TBST) containing 2.5% skim milk powder for incubation: endogenous protein antibody diluted 1:1000, exogenous tag / overexpression protein antibody diluted 1:2000. Incubation conditions are 4°C with gentle shaking overnight (12-16 hours) or room temperature with gentle shaking for 2 hours. After primary antibody incubation, recover the primary antibody and store at −20°C. Then wash the membrane with TBST containing Tween for 5 minutes each time, for a total of 3 washes (with gentle shaking), discarding the washing buffer. Add secondary antibody working buffer (2.5% skim milk powder TBST diluted 1:5000) and incubate at room temperature with shaking for 1 hour. After incubation, wash the membrane 3-6 times with TBST to remove unbound secondary antibody. Prepare ECL chemiluminescent substrate according to the instructions, and evenly cover the membrane surface under light-protected conditions. Then, use a chemiluminescence imaging system or film exposure and development to acquire and analyze the corresponding protein band signals. Result: As Figure 4 As shown in Figure A, the viral mRNA level in both MSRB3-KO groups was significantly lower than that in the control group, indicating that MSRB3 gene knockout significantly inhibited FMDV replication. Figure 4 The viral titer in control group B reached approximately 5.5 log. 10 TCID 50 / mL, while the MSRB3-KO group had a viral titer of only about 4.5 log at the same time point. 10 TCID 50 / mL, and the viral progeny titer results also confirmed the inhibitory effect of MSRB3 gene knockout on FMDV replication. Western blot results showed ( Figure 4(C) Samples were collected 0, 6, and 12 hours after FMDV infection. With increasing infection time, the expression level of FMDV VP1 protein in the MSRB3-KO group was significantly lower than that in the control group. This further indicates that MSRB3 deletion inhibits viral protein expression. This experiment demonstrates that MSRB3 gene knockout not only inhibits FMDV replication at the RNA and viral titer levels but also exhibits a significant inhibitory effect at the protein level.
[0040] 3.2 Validation in IBRS-2 and WSL cells Methods: To investigate the role of MSRB3 in different cell lines and verify the universality of this effect, IBRS-2 and WSL cells were infected with FMDV and samples were collected at 10h and 24h, respectively, for the detection of viral RNA levels (Q-PCR method as in Example 3.1). Results: The results showed that the relative levels of FMDV RNA in both cell types with MSRB3 deficiency were significantly lower than those in the control group. Figure 4 D、 Figure 4 (E), this result further supports the consistent promoting effect of MSRB3 on FMDV replication.
[0041] Example 4: Effect of knocking down MSRB3 expression via RNA interference on FMDV replication Methods: To eliminate potential off-target effects of CRISPR / Cas9, we employed RNAi technology for complementation verification. Two siRNAs targeting MSRB3 with significant interference effects were designed to knock down MSRB3 expression. The two siRNAs (MSRB3-RNAi#1 and MSRB3-RNAi#2) and the negative control NC siRNA were transfected into PK-15 cells plated the previous day. PepMute siRNA transfection reagent was used for the transfection experiment. Before transfection, the 5×Transfection Buffer provided in the kit was diluted to the working concentration with enzyme-free sterile water at a ratio of 1:5. For a 12-well plate, 75 μL of diluted Transfection Buffer was added sequentially to a 1.5 mL EP tube, followed by 2.25 μL of PepMute Reagent and 3.25 μL of siRNA solution. After gentle mixing, the mixture was incubated at room temperature for 15 min to form a transfection complex. Once the complex formed, it was evenly added to the corresponding wells to complete the transfection. Thirty-six hours after transfection, FMDV was infected with an MOI of 0.1, and cell samples were collected at 10 and 16 hours post-infection for subsequent Q-PCR analysis (using the same method as in Example 3.1). Results: Compared with the NC control, both MSRB3-RNAi#1 and MSRB3-RNAi#2 significantly reduced MSRB3 transcription levels. Figure 5 A). The effect of MSRB3 knockdown on FMDV replication was detected by Q-PCR. Knockdown of the host protein MSRB3 significantly reduced FMDV RNA levels, such as... Figure 5 As shown in B, this result corroborates the conclusions of the knockout experiment, further supporting the conclusion that MSRB3 promotes FMDV replication, and together demonstrating that MSRB3 is a host factor required for FMDV replication.
[0042] Example 5: Effect of MSRB3 overexpression on FMDV replication 5.1 Construction of the overexpression cell line: HEK293T cells in good growth condition were seeded in 10 cm cell culture dishes. The following day, when cell confluence reached 60%-80%, lentiviral expression vector Plov-MSRB3-Flag (7.5 μg) and packaging helper plasmids LH1 (7.5 μg) and LH2 (5 μg) were simultaneously introduced into the cells via co-transfection. 10-12 h post-transfection, the original culture medium was discarded and replaced with fresh, antibiotic-free / antifungal-free medium. The cells were then cultured for another 36-48 h, and the cytopathic effect (CPE) was dynamically observed. Once the cytopathic effect was evident, the culture supernatant was collected and filtered through a 0.45 μm filter. Polybrene (8 μg / mL) was added to the filtered viral solution and used to infect PK-15 cells seeded the previous day. 24 h after infection, the cells were screened using puromycin-containing medium and passaged ≥3 times to eventually establish a stable MSRB3-Flag overexpressing cell line in parallel with the Plov-STOP empty vector control group.
[0043] 5.2 Effects of MSRB3 overexpression on viral replication To further investigate the effect of MSRB3 overexpression on FMDV replication, MSRB3-overexpressing cells and control cells were plated for 12 h and infected with FMDV at different time points (MOI=0.1). Cell samples and cell supernatants were then collected, and FMDV RNA levels were detected by RT-qPCR (method as in Example 3.1). TCID45 was used to analyze the results. 50 Viral titers were detected using the same method as in Example 3.1, and MSRB3 overexpression and viral protein levels were verified by Western blot (the same method as in Example 3.1). Results: RT-q-PCR results showed that MSRB3 overexpression significantly increased FMDV RNA levels. Figure 6 As shown in Figure A, during FMDV infection, the FMDV RNA level in the overexpression group was significantly higher than that in the control group at 6 h and 12 h after infection. Figure 6Western blot results for B validated the protein expression at the protein level; the MSRB3-Flag band indicated successful overexpression, and MSRB3 overexpression promoted FMDV VP1 protein expression. TCID 50 Experiments show that ( Figure 6 (C) Cells overexpressing MSRB3-Flag produced significantly higher viral titers than the control group. Therefore, overexpression of MSRB3 promotes FMDV replication, which is consistent with the previous conclusion that MSRB3 knockout significantly inhibits FMDV replication. This experiment further demonstrates from the opposite direction that MSRB3 can promote FMDV replication.
[0044] Statistical analysis of the test data was performed using GraphPad Prism for statistical plotting and significance testing. All experiments were independently repeated three times. Statistical notation is as follows: ns indicates no statistically significant difference; * indicates P < 0.01, ** indicates P < 0.001, *** indicates P < 0.0001, and **** indicates P < 0.00001, all indicating statistically significant differences.
[0045] Foot-and-mouth disease virus (FMDV) replication is highly dependent on host cytokines. This invention systematically elucidates for the first time the crucial promoting role of the host protein MSRB3 in FMDV replication. First, using CRISPR / Cas9 gene editing technology, stable MSRB3 knockout cell lines of PK-15, IBRS-2, and WSL were successfully constructed, and this knockout did not significantly affect basic cell viability, providing a reliable model for functional studies. Second, multi-level assays confirmed that MSRB3 deletion significantly inhibited FMDV replication in different cell lines. Specifically, in PK-15 cells, the viral RNA level (… Figure 4 A) Expression level of viral structural protein VP1 ( Figure 4 C) and progeny virus titer ( Figure 4 B) Both decreased significantly; viral RNA levels were also significantly suppressed in IBRS-2 and WSL cells. Figure 4 D, E). Third, to rule out off-target effects and verify from multiple perspectives, RNA interference technology was used to transiently knock down MSRB3 expression, which also resulted in a significant decrease in FMDV RNA levels (D, E). Figure 5 This corroborates the gene knockout results. Finally, from a functional gain perspective, it was demonstrated that overexpression of MSRB3 in PK-15 cells significantly increased FMDV RNA levels, viral protein expression, and progeny virus titers. Figure 6 This indirectly confirms the promoting effect of MSRB3 on viral replication.
[0046] In summary, this invention, through three complementary experimental strategies—gene knockout, RNA interference, and overexpression—consistently demonstrates in various porcine cell models that the host protein MSRB3 is a key factor promoting FMDV replication. This discovery not only provides new experimental evidence for elucidating the molecular mechanism of FMDV-host interaction but also lays a solid theoretical foundation for developing novel anti-foot-and-mouth disease virus agents (such as drug or vaccine adjuvants) targeting MSRB3. Furthermore, the MSRB3 gene knockout cell line and related sgRNA constructed in this invention provide an effective tool and platform for subsequent antiviral drug screening and in-depth research on viral replication mechanisms.
Claims
1. The application of the MSRB3 gene / protein as a target in the preparation or screening of drugs against foot-and-mouth disease virus, characterized in that, The drug inhibits the replication of foot-and-mouth disease virus by suppressing the expression of the MSRB3 gene.
2. The application as described in claim 1, characterized in that, The drug comprises an expression inhibitor of the MSRB3 gene / protein, wherein the expression inhibitor comprises at least one of a small interfering RNA targeting MSRB3 and an sgRNA targeting and knocking out the MSRB3 gene; the sgRNA comprises at least one of susMSRB3-KO#1, susMSRB3-KO#2, and susMSRB3-KO#3; the primer sequence of the sgRNA is as follows: susMSRB3-KO#1-F: CACCGTCCTACGGGATGCACAGGG; susMSRB3-KO#1-R:AAACCCCTGTGCATCCCGTAGGAAC; susMSRB3-KO#2-F: CACCGTGAGTGACATGGTACTGCAG; susMSRB3-KO#2-R:AAACCTGCAGTACCATGTCACTCAC; susMSRB3-KO#3-F:CACCGTTCCACCCTGTGCATCCCGT; susMSRB3-KO#3-R:AAACACGGGATGCACAGGGTGGAAC.
3. A gRNA that targets and knocks out the MSRB3 gene, characterized in that, The sgRNA includes at least one of susMSRB3-KO#1, susMSRB3-KO#2, and susMSRB3-KO#3; the primer sequence of the sgRNA is: susMSRB3-KO#1-F: CACCGTCCTACGGGATGCACAGGG; susMSRB3-KO#1-R:AAACCCCTGTGCATCCCGTAGGAAC; susMSRB3-KO#2-F: CACCGTGAGTGACATGGTACTGCAG; susMSRB3-KO#2-R:AAACCTGCAGTACCATGTCACTCAC; susMSRB3-KO#3-F:CACCGTTCCACCCTGTGCATCCCGT; susMSRB3-KO#3-R:AAACACGGGATGCACAGGGTGGAAC.
4. The application of the sgRNA as described in claim 3 in the construction of MSRB3 gene knockout cell lines.
5. A method for constructing an MSRB3 gene knockout cell line, characterized in that, Includes the following steps: (1) Construct the sgRNA described in claim 3 into a CRISPR / Cas9 vector to obtain a recombinant knockout plasmid; (2) The recombinant knockout plasmid and the lentiviral packaging helper plasmid were co-transfected into the packaging cell line to obtain lentivirus; (3) The obtained lentivirus was used to infect host porcine cell lines. After drug screening and passage purification, a stable MSRB3 gene knockout cell line was obtained.
6. The construction method according to claim 4, characterized in that, The host porcine cell line is PK-15 cells, IBRS-2 cells, or WSL cells; the packaging cell line is HEK293T cells; and the drug screening uses puromycin.
7. The use of the MSRB3 gene knockout cell line constructed by the method of claim 5 or 6 in any of the following: (1) Application in screening or preparing drugs against foot-and-mouth disease virus; (2) Application in breeding pigs resistant to foot-and-mouth disease virus; (3) Application in the study of foot-and-mouth disease virus replication mechanism.
8. The application of the MSRB3 gene / protein as a target in the preparation or screening of foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production enhancers, characterized in that, The synergist enhances the replication level of foot-and-mouth disease virus by promoting the expression of the MSRB3 gene / protein.
9. Application of MSRB3 gene / protein overexpression cell lines in the preparation of foot-and-mouth disease virus or foot-and-mouth disease virus vaccine production cell lines.
10. The application according to claim 9, characterized in that, The method for constructing the MSRB3 gene / protein overexpression cell line includes the following steps: (1) Preparation of MSRB3 overexpression plasmid; (2) Construct a recombinant lentivirus containing the MSRB3 overexpression plasmid described in step (1); (3) The recombinant lentivirus prepared in step (2) was transduced into host cells, and after screening and culture, MSRB3 overexpression cell lines were obtained.