Use of a molecular marker affecting the body height trait in sheep

By detecting the genotype of specific nucleotide sequences in the sheep genome, the body height trait can be identified and screened at an early stage, solving the problems of long breeding cycles and low selection efficiency in Suffolk sheep, and achieving the effect of rapidly improving the body height trait in offspring.

CN122168774BActive Publication Date: 2026-07-31INNER MONGOLIA AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INNER MONGOLIA AGRICULTURAL UNIVERSITY
Filing Date
2026-05-12
Publication Date
2026-07-31

AI Technical Summary

Technical Problem

In existing technologies, the breeding of Suffolk sheep mainly relies on traditional phenotypic testing, which results in a long breeding cycle, low efficiency of early selection, and the body height trait is easily affected by the environment, leading to slow genetic progress and difficulty in achieving rapid and accurate genetic improvement.

Method used

By detecting the genotype of specific nucleotide sequences (SEQ ID NO.1 and SEQ ID NO.3) in the sheep genome, and utilizing the C or A mutation at 101bp of SEQ ID NO.1 and the T or G mutation at 101bp of SEQ ID NO.3, early identification and screening of high-quality traits can be achieved, and individuals carrying the dominant genotype can be selected as parents for breeding.

Benefits of technology

It enables genetic assessment in the early stages of sheep growth, significantly shortens the breeding cycle, improves the body height trait in offspring, and supports the rapid development of new strains or populations with outstanding body height traits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122168774B_ABST
    Figure CN122168774B_ABST
Patent Text Reader

Abstract

This invention relates to the field of genetic breeding technology, specifically to the application of a molecular marker affecting the height trait of sheep. The molecular marker is at least one of the following ① and ②: ① the nucleotide sequence shown in SEQ ID NO.1, where the nucleotide at the 101bp site is C or A; ② the nucleotide sequence shown in SEQ ID NO.3, where the nucleotide at the 101bp site is T or G. The application refers to any one of the following (1) and (2): (1) identifying the height of sheep; (2) increasing the height of sheep offspring. By detecting the genotype of the molecular marker described in this invention, the genetic assessment of the height trait can be performed in the early stages of sheep growth and development, which significantly shortens the breeding cycle. This invention provides direct technical support for the rapid breeding of new strains or populations with outstanding height traits, and helps to accelerate the process of sheep breed improvement.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic breeding technology, specifically to the application of a molecular marker that affects the body height trait in sheep. Background Technology

[0002] Suffolk sheep are a large meat sheep breed developed in 1859 through crossbreeding of the Southhill sheep with the robust, lean-meat-proportioned old-type black-headed horned Norfolk sheep. Currently, Suffolk sheep are primarily used for purebred breeding and as a high-quality sire for crossbreeding local sheep breeds. Their significant growth rate and superior meat quality effectively shorten the breeding cycle, reduce feed input costs, and improve overall breeding efficiency.

[0003] With the continued rise in demand for premium lamb, the market potential for high-quality Suffolk sheep meat is becoming increasingly apparent. However, the current population size of purebred Suffolk sheep is limited, and some populations are experiencing significant inbreeding decline, posing a challenge to the protection of genetic diversity.

[0004] Suffolk sheep, as an important meat breed, rely heavily on body height as a key trait directly affecting growth efficiency and production performance. Current breeding methods primarily depend on traditional phenotyping and progeny selection, requiring reliable data only after the sheep reach adulthood. This results in long breeding cycles, low early selection efficiency, and phenotypic susceptibility to environmental influences, leading to slow genetic progress. These shortcomings hinder precise and efficient improvement of this trait. Therefore, developing a new technology capable of accurately identifying and screening the genetic potential associated with body height at an early stage is crucial for establishing an early and accurate genetic assessment system and accelerating the breeding process for high-yielding breeds. Summary of the Invention

[0005] To address the above problems, this invention provides an application of molecular markers that influence the height trait in sheep. These molecular markers can be used to identify the height trait in sheep and to breed tall sheep.

[0006] This invention is achieved through the following technical solution: This invention provides an application of molecular markers that influence the body height trait in sheep, wherein the molecular markers are at least one of the following ① and ②: ①The nucleotide sequence shown in SEQ ID NO.1 has a nucleotide at position 101 bp that is either C or A; ②The nucleotide sequence shown in SEQ ID NO.3 has a T or G nucleotide at the 101 bp position; The application refers to any one of the following (1) and (2): (1) Determine the height of the sheep; (2) Increase the height of sheep offspring.

[0007] Preferably, the method for determining the height of a sheep is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the sheep at position 101 bp of SEQ ID NO.1 or SEQ ID NO.3; If the genotype is at least one of A) and B) below, then the sheep is tall, and tall means that the height value is greater than 77cm; A) The genotype at 101bp of SEQ ID NO.1 is AA; B) The genotype at 101bp of SEQ ID NO.3 is GG.

[0008] Preferably, the method for increasing the body height of sheep offspring is as follows: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the sheep at position 101 bp of SEQ ID NO.1 or SEQ ID NO.3; By selecting sheep individuals carrying at least one of the genotypes shown in a) and b) as parents for breeding, the body height of sheep offspring can be increased. a) The genotype at 101bp of SEQ ID NO.1 is AA; b) The genotype at 101bp of SEQ ID NO.3 is GG.

[0009] Preferably, the genomic DNA is derived from sheep blood.

[0010] Preferably, the genomic DNA is extracted using the phenol-chloroform method.

[0011] Preferably, the sheep is a Suffolk sheep.

[0012] Preferably, the height trait refers to the vertical distance from the highest point of the sheep to the ground.

[0013] Compared with the prior art, the present invention has the following beneficial effects: This invention provides an application of molecular markers affecting the height trait of sheep, wherein the molecular markers are at least one of the following ① and ②: ① the nucleotide sequence shown in SEQ ID NO.1, where the nucleotide at the 101bp site is C or A; ② the nucleotide sequence shown in SEQ ID NO.3, where the nucleotide at the 101bp site is T or G; the application refers to any one of the following (1) and (2): (1) identifying the height of sheep; (2) increasing the height of sheep offspring. This invention screens out two molecular markers affecting the height trait of sheep through methods such as genome sequencing, identification of variant sites, and genome-wide association analysis. Compared with traditional breeding methods that rely on phenotypic measurements, this invention can perform genetic assessment of the height trait in sheep at an early stage of growth and development by detecting the genotype of the molecular markers, which significantly shortens the breeding cycle. Secondly, based on the two key SNP sites and their dominant genotypes of this invention, selecting individuals carrying these dominant genotypes as parents can effectively increase the average height of the offspring population. This invention provides direct technical support for the rapid development of new breeds or populations with outstanding physical traits, which helps to accelerate the process of improving sheep breeds.

[0014] In summary, this invention combines molecular marker technology with breeding practices to achieve targeted genetic improvement of body height traits, which has significant application value and promising prospects for promotion. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1 This is a distribution diagram of the SNPs after quality control in a 1Mb window of the chromosome. The left Y-axis represents the chromosome name, and the upper X-axis represents the window size.

[0017] Figure 2 This is the principal component analysis diagram of the present invention.

[0018] Figure 3 This is a visualization of the G matrix of the present invention.

[0019] Figure 4 The Manhattan Plots and QQ-plots of this invention show the GWAS results of the high body mass trait in Suffolk sheep; A is the Manhattan plot of the high body mass trait in Suffolk sheep, with significant SNPs across the genome shown in red; B is the QQ plot of the high body mass trait in Suffolk sheep. Detailed Implementation

[0020] To facilitate understanding of the present invention, a more comprehensive description is provided below, along with preferred embodiments. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0021] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this invention and in the specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0022] The technical solution of the present invention will be further described below with reference to specific embodiments.

[0023] The following is a list of abbreviations related to this invention: LD: Linkage Disequilibrium; Manhattan Plot; QQ-plots / QQ graph: Quantile-Quantile Plot; SNP: Single nucleotide polymorphism; GWAS: Genome-wide association analysis.

[0024] The experimental animals and phenotypic sources used in this invention are as follows: The sheep used in this invention were all from Sinosheep Technology Co., Ltd. The body height trait of adult Suffolk sheep from 2020 to 2024 was measured and the phenotype was recorded. The description of the body height trait is shown in Table 1.

[0025] Blood samples were collected from 300 Suffolk sheep. All samples were immediately stored at -80°C after collection and transported to the laboratory on dry ice for long-term storage at -80°C.

[0026] Table 1. Description of body height trait in Suffolk sheep

[0027] Example 1 The application of a molecular marker affecting the body height trait in sheep is as follows: 1. Genomic DNA extraction and quality control.

[0028] DNA was extracted from blood samples using the phenol-chloroform method. DNA concentration was measured using a NanoDrop2000 spectrophotometer. The absorption wavelength ratio of the highest absorption peak at 260 nm to 280 nm was calculated to measure the content of DNA, protein, and phenolic substances. The absorption wavelength ratio of the highest absorption peak at 260 nm to 230 nm was calculated to measure the content of DNA and carbohydrates. DNA quality was then assessed using 1% (w / v) agarose gel electrophoresis.

[0029] 2. Library construction and sequencing.

[0030] The qualified genomic DNA was randomly fragmented into 350bp fragments using a Covaris ultrasonic disruptor. The DNA fragments underwent end repair, poly(A) addition, sequencing adapter addition, purification, and PCR amplification to complete the library preparation. After library construction, preliminary quantification was performed using Qubit 2.0, and qPCR was used to accurately quantify the effective concentration of the library to ensure library quality. After passing quality checks, sequencing was performed using the BGI MGI-T7 sequencing platform in PE150 mode.

[0031] 3. Identification, screening, and annotation of variant sites.

[0032] Raw reads were filtered into clean reads using FastP software version 0.20.0, and a genome index was built on the reference genome. The quality-controlled clean reads were aligned with the reference genome using Burrows-Wheeler Aligner software version 0.7.17. The aligned SAM files were converted to BAM files using SAMtools software version 1.8-20, and the BAM files were sorted. Duplicates were removed from the sorted BAM files using the MarkDuplicates program in Genome Analysis Toolkit version 3.8, resulting in the final BAM file. An index was built on the final BAM file, and SNP variant detection was performed using the HaplotypeCaller module in GATK software. The resulting VCF file was then filtered using the VariantFiltration module. Functional annotation of the detected gene variants was performed using the ANNOVAR software package. Based on the location of the variant sites on the reference genome and the gene location information on the reference genome, the region in which the variant sites occurred and the impact of the variants, such as synonymous or non-synonymous mutations, can be determined.

[0033] The reference genome used in this invention is Oar_v4.0, GCF_000298735.2.

[0034] 4. Data quality control and group stratification correction.

[0035] Whole-genome resequencing was performed on 300 Suffolk sheep individuals to establish a genotype database, generating a total of 17243.32 Gb of raw reads and obtaining 47,506,993 SNPs.

[0036] The obtained genotyping data were quality controlled using Plink V1.90 software, and individuals with a genotype detection rate of less than 98%, SNPs with a detection rate of less than 98%, SNPs with a minimum allele frequency of less than 5%, and Hardy-Weinberg equilibrium test p-values ​​of less than 10 were removed. -6 SNPs. A total of 20,182,599 high-quality SNPs were identified in the Suffolk population. These loci are evenly distributed across the 26 pairs of autosomes in sheep, such as... Figure 1 As shown.

[0037] The first five principal components were calculated using the "--pca5" parameter in Plink software version 1.90. A PCA plot was then drawn using R version 3.6.0, and the results are as follows. Figure 2 As shown, the top density distribution of PC1 displays principal component 1, i.e., the distribution of all data points on PC1 and the degree of data variation along the PC1 axis; the right-hand density distribution of PC2 displays principal component 2, i.e., the distribution of all data points on PC2 and the degree of data variation along the PC2 axis. The results indicate that the experimental sample exhibits population stratification and a high degree of genetic correlation among individuals. The first five principal components need to be used as covariates to correct for the population stratification of Suffolk sheep. Genomic kinship analysis based on the G matrix was performed on this population using Plink V1.90, and the results are as follows: Figure 3 As shown, Figure 3 Each small square in the table represents the kinship value between two samples. The smaller the value, the closer it is to light green, indicating that the two individuals are more distantly related, and vice versa. The results show that the average kinship between Suffolk sheep individuals is relatively distant.

[0038] 5. Genome-wide association analysis.

[0039] The association analysis between SNPs and body height traits was performed using the fastGWA-mlm model in GCTA software version V1.94.0beta. The formula is as follows: .

[0040] in y It is a phenotypic vector; X snpIt is a genotype vector, and its effect is β snp ; X c This is the correlation matrix with the first five PCA variables as fixed covariates, and its corresponding coefficients are... β c ; g It is a vector of total genetic effects captured by the genetic relationship matrix derived from SNPs. g ~N(0, ); π is a genetic relation matrix vector derived from SNP, where all off-diagonal elements are set to 0; e It is the residual vector. e ~N(0, ).

[0041] Because using the Bonferroni correction method with a ratio of 0.05 / number of SNPs to determine the significance threshold of GWAS is too stringent, this invention employs linkage disequilibrium screening to remove redundancy, obtaining independent SNPs for threshold calculation. The parameters are: 150: window size, i.e., number of SNPs; 50: step length, i.e., number of SNPs; 0.5: r 2 Delete one of the SNP pairs where LD is greater than 0.5.

[0042] This invention adjusts the threshold for genome-wide significant association to P=1 / 1462608, where 1462608 is the number of independent SNPs screened by LD. The genome expansion factor, λ, is calculated using the slope of a linear regression between the observed quantiles and the theoretical quantiles in R version V3.6.0. The calculated λ value for the body height trait is 1.057, indicating no genome expansion.

[0043] Based on resequencing data from 300 Suffolk sheep, 74 significant SNP loci associated with body height were detected. These loci are located on chromosomes 1, 2, 3, 4, 6, 8, 9, 11, 12, 13, 15, 19, 22, and 23, as shown in Table 2. Figure 4 As shown.

[0044] Table 2 Significant SNP loci associated with body height trait

[0045] 6. SNPs affecting body height trait in Suffolk sheep.

[0046] (1) Further research on SNPs that reached the level of genome-wide significance revealed that the C→A mutation at position 25990670 on chromosome 9 of the Suffolk sheep genome can significantly affect the height trait of Suffolk sheep.

[0047] The association analysis between the SNP locus at position 25990670 on chromosome 9 of the Suffolk sheep genome and the body height trait is shown in Table 3.

[0048] Table 3. Polymorphism at position 25990670 on chromosome 9 of the Suffolk sheep genome.

[0049] Note: In the column height of Table 3, different lowercase letters indicate significant differences. P <0.05, where the same letter indicates no significant difference. P >0.05.

[0050] As shown in Table 3, individuals with the genotype AA have the highest body height, while individuals with the genotype CC have the lowest body height.

[0051] In the genome-wide association analysis, the SNP molecular marker at position 25,990,670 on chromosome 9 of the Suffolk sheep genome reached a genome-wide significance level, indicating that this molecular marker is significantly associated with the height trait of Suffolk sheep. Furthermore, when the base of this molecular marker is A, it is beneficial for Suffolk sheep to have a higher height, which is greater than 77 cm.

[0052] The frequency of the SNP gene and genotype at position 25,990,670 on chromosome 9 of the Suffolk sheep genome were then analyzed, as shown in Table 4.

[0053] Table 4. SNP gene frequency and genotype frequency at position 25990670 on chromosome 9.

[0054] The nucleotide sequence of the molecular marker containing the C→A mutation site at position 25990670 on chromosome 9 is shown in SEQ ID NO.1 and SEQ ID NO.2.

[0055] SEQ ID NO.1: AATGAAAGCAAAGCCTAAGGAAATGCCATCTGACTAATTTCTAACCAAGGCAAATCATCTCTTTTAGTCACCCTCAACAAAAATGTCAGTGTTCCCCAATCGCAGCGAGGTACCAAGGTCCATGTCAGCCTCCCAAGTTTGCTCTGCTTTACACGGGGAGCTGGGATCCAGTGCAGAGCCGGGTGGCTCAGAGCTGTGC.

[0056] SEQ ID NO.2: AATGAAAGCAAAGCCTAAGGAAATGCCATCTGACTAATTTCTAACCAAGGCAAATCATCTCTTTTAGTCACCCTCAACAAAAATGTCAGTGTTCCCCAATAGCAGCGAGGTACCAAGGTCCATGTCAGCCTCCCAAGTTTGCTCTGCTTTACACGGGGAGCTGGGATCCAGTGCAGAGCCGGGTGGCTCAGAGCTGTGC.

[0057] (2) Further research on SNPs that reached the level of genome-wide significance revealed that the T→G mutation at position 26005909 on chromosome 9 of the Suffolk sheep genome can significantly affect the height trait of Suffolk sheep.

[0058] The association analysis between the SNP locus at position 26005909 on chromosome 9 of the Suffolk sheep genome and the body height trait is shown in Table 5.

[0059] Table 5. Polymorphism at position 26005909 on chromosome 9 of the Suffolk sheep genome.

[0060] Note: In the column height of Table 5, different lowercase letters indicate significant differences. P <0.05, where the same letter indicates no significant difference. P >0.05.

[0061] As shown in Table 5, individuals with the genotype GG have the highest height, while individuals with the genotype TT have the lowest height.

[0062] In the genome-wide association analysis, the SNP molecular marker at position 26005909 on chromosome 9 of the Suffolk sheep genome reached a genome-wide significance level, indicating that this molecular marker is significantly associated with the height trait of Suffolk sheep. Furthermore, when the base of this molecular marker is G, it is beneficial for Suffolk sheep to have a higher height, which is greater than 77 cm.

[0063] The frequency of the SNP gene and genotype at position 26005909 on chromosome 9 of the Suffolk sheep genome were then calculated, as shown in Table 6.

[0064] Table 6. SNP gene frequency and genotype frequency at position 26005909 on chromosome 9.

[0065] The nucleotide sequence of the molecular marker containing the T→G mutation site at position 26005909 on chromosome 9 is shown in SEQ ID NO.3 and SEQ ID NO.4.

[0066] SEQ ID NO.3: ACAGAAAACTGACCAATCTGATCACATGGACCACACCCTTGTCTAACTCAGTGAAACTATGAGCCATGATGTAGGACCACCCAAGACGGATGGGTCATCATAGAGAGGTCTGACAAAACGTGGTCCACTGGAGGAGGGAATGGCCAACCACTTCAGTATTCTTGCCTTGAGAACCCCATGAACAGTATGAAAAGGCAAAAG.

[0067] SEQ ID NO.4: ACAGAAAACTGACCAATCTGATCACATGGACCACACCCTTGTCTAACTCAGTGAAACTATGAGCCATGATGTAGGACCACCCAAGACGGATGGGTCATCAGAGAGGTCTGACAAAACGTGGTCCACTGGAGGAGGGAATGGCCAACCACTTCAGTATTCTTGCCTTGAGAACCCCATGAACAGTATGAAAAGGCAAAAG.

[0068] Therefore, it can be seen that: 1) The Suffolk sheep breed is selected by C→A mutation at position 25990670 on chromosome 9 of the Suffolk sheep genome. Individuals with the AA genotype are selected as the father or mother to improve the body height of Suffolk sheep offspring.

[0069] 2) The T→G mutation at position 26005909 on chromosome 9 of the Suffolk sheep genome is used to breed tall Suffolk sheep. Individuals with the GG genotype are selected as the father or mother to improve the body height of Suffolk sheep offspring.

[0070] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.

[0071] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0072] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. Those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of this invention should be determined by the appended claims.

Claims

1. Use of a molecular marker affecting the body height trait in sheep, characterized in that, The molecular marker is any one of the following ① and ②: ①The nucleotide sequence shown in SEQ ID NO.2 has a nucleotide at position 101 bp that is either C or A; when the genotype at position 101 bp is AA, the sheep have a tall stature. ②The nucleotide sequence shown in SEQ ID NO.4 has a nucleotide at position 101 bp that is either T or G; when the genotype at position 101 bp is GG, the sheep have a tall body height. The application refers to any one of the following (1) and (2): (1) Determine the height of the sheep; (2) Increase the height of sheep offspring; The sheep in question are Suffolk sheep.

2. The application as described in claim 1, characterized in that, The methods for determining the height of a sheep are as follows: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the sheep at position 101 bp of SEQ ID NO.2 or SEQ ID NO.4; If the genotype is either A) or B) below, then the sheep is tall-bodied; A) The genotype at 101bp of SEQ ID NO.2 is AA; B) The genotype at 101bp of SEQ ID NO.4 is GG.

3. The application as described in claim 1, characterized in that, Methods to increase the body height of sheep offspring include: Genomic DNA was extracted from the sheep to be tested and sequenced. Determine the genotype of the sheep at position 101 bp of SEQ ID NO.2 or SEQ ID NO.4; By selecting sheep individuals carrying either of the genotypes shown in a) and b) as parents for breeding, the body height of the offspring can be increased. a) The genotype at 101bp of SEQ ID NO.2 is AA; b) The genotype at 101bp of SEQ ID NO.4 is GG.

4. The application as described in claim 2 or claim 3, characterized in that, The genomic DNA was derived from sheep blood.

5. The application as described in claim 2 or claim 3, characterized in that, The genomic DNA was extracted using the phenol-chloroform method.

6. The application as described in claim 1, characterized in that, The body height trait refers to: The vertical distance from the highest point of the sheep to the ground.