A system, kit, method and application for detecting alfalfa mosaic virus based on RT-RPA-CRISPR-Cas12a
By combining RT-RPA and CRISPR-Cas12a technologies, a rapid and efficient method for detecting alfalfa mosaic virus was established, which solves the problems of complex detection, high equipment dependence and long cycle in existing technologies, and achieves high specificity and high sensitivity detection under low temperature conditions.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INNER MONGOLIA UNIV FOR THE NATITIES
- Filing Date
- 2026-05-07
- Publication Date
- 2026-06-09
AI Technical Summary
Existing methods for detecting alfalfa mosaic virus suffer from problems such as complex operation, high equipment dependence, long detection cycle, and insufficient sensitivity and specificity, especially in rapid field detection.
By combining RT-RPA and CRISPR-Cas12a technologies and designing specific RPA primers and crRNA, a method for rapid nucleic acid amplification and highly specific detection under low-temperature conditions was established. The sequence-specific recognition capability and fluorescence signal generation of CRISPR-Cas12a were utilized to achieve rapid and sensitive detection of alfalfa mosaic virus.
It enables rapid detection within 30 minutes under constant temperature conditions of 38℃, significantly shortening the detection time and improving the accuracy and specificity of detection. It is suitable for simple detection in the field and at the grassroots level laboratories.
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant virus detection technology, and particularly relates to a system, kit, method and application for detecting alfalfa mosaic virus based on RT-RPA-CRISPR-Cas12a. Background Technology
[0002] Alfalfa mosaic virus (AMV) belongs to the genus Alfamovirus in the family Bromoviridae. It is a widely distributed plant virus that primarily infects leguminous plants such as alfalfa (Medicago sativa L.). The virus is mainly transmitted non-persistently by aphids, but can also be spread through mechanical inoculation. After infection, AMV causes symptoms such as mosaic, chlorosis, and mottling on the leaf surface. In severe cases, it can lead to leaf deformities and stunted growth, significantly reducing alfalfa yield and nutritional value. Since alfalfa is an important high-quality forage crop, the prevalence of alfalfa mosaic virus has become a significant factor restricting the development of the forage industry.
[0003] Currently, detection methods for alfalfa mosaic virus mainly include reverse transcription polymerase chain reaction (RT-PCR), serological detection (ELISA), and reverse transcription loop-mediated isothermal amplification (RT-LAMP). Serological detection is relatively simple to operate and suitable for routine testing, but it relies on specific antibodies, which have a long preparation cycle, high cost, and limited sensitivity. RT-PCR has high sensitivity and specificity, but its detection process relies on expensive equipment such as thermal cyclers, is complex to operate, and has a long detection cycle, making it unsuitable for rapid field detection. While RT-LAMP offers some speed, non-specific amplification can easily occur during the amplification process, affecting the accuracy of the test results.
[0004] Recombinase polymerase amplification (RPA) is a novel isothermal DNA amplification technique that enables rapid amplification of target nucleic acids at relatively low temperatures (typically 37–39°C). It offers advantages such as short reaction time, ease of operation, and low dependence on equipment. This technique is particularly suitable for rapid on-site testing in grassroots laboratories. However, RPA amplification results typically rely on electrophoresis or dye development for interpretation, and its specificity depends heavily on primer design, thus a certain risk of false positives remains.
[0005] In recent years, the CRISPR-Cas12a system has been widely used in the field of nucleic acid detection due to its high sequence-specific recognition capability. Guided by crRNA, Cas12a can specifically recognize target DNA sequences and, upon recognition, activate its paracleavage activity to non-specifically cleave single-stranded DNA reporter molecules, thereby generating a detectable fluorescent signal. This system has advantages such as high sensitivity, strong specificity, and intuitive detection.
[0006] Currently, RPA technology is mostly used for the detection of single pathogens, and the results are largely interpreted using traditional detection methods. No publicly reported studies have explored combining RPA technology with the CRISPR-Cas12a system for rapid detection of alfalfa mosaic virus. Therefore, it is necessary to establish a detection method that combines the rapid amplification of RPA with the high specificity of CRISPR to achieve rapid, sensitive, and specific detection of alfalfa mosaic virus. Summary of the Invention
[0007] In view of this, the purpose of this invention is to provide a system, kit, method and application for detecting alfalfa mosaic virus based on RT-RPA-CRISPR-Cas12a.
[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a system for detecting alfalfa mosaic virus based on RT-RPA-CRISPR-Cas12a, including an RT-RPA isothermal amplification system and a CRISPR / Cas12a detection system; The RT-RPA isothermal amplification system includes an RPA primer pair, which includes RPA-F and RPA-R. The nucleotide sequence of RPA-F is shown in SEQ ID NO:1, and the nucleotide sequence of RPA-R is shown in SEQ ID NO:2. The CRISPR / Cas12a detection system includes crRNA and a fluorescent reporter probe; the nucleotide sequence of the crRNA is shown in SEQ ID NO:3 and SEQ ID NO:4, and the nucleotide sequence of the fluorescent reporter probe is shown in SEQ ID NO:5.
[0009] Preferably, the RT-RPA isothermal amplification system further includes nuclease-free water, buffer solution, and magnesium ions.
[0010] Preferably, the RT-RPA isothermal amplification system includes 30 μL of buffer, 6.5 μL of deionized water, 2.5 μL each of upstream and downstream primers with a final concentration of 0.4 μmol / L, 1 μL each of template cDNA, and 2.5 μL of magnesium acetate solution with a final concentration of 280 mmol / L.
[0011] Preferably, the CRISPR / Cas12a detection system comprises 2 μL Holmes buffer, 0.5 μL of 10 μM LbCas12a, 1 μL of 10 μM fluorescent reporter probe, 1 μL of 10 μM crRNA, 1 μL of RPA amplification product, and 14.5 μL of DNase / RNase-free double-distilled water.
[0012] The present invention also provides a kit for detecting alfalfa mosaic virus based on RT-RPA-CRISPR-Cas12a, comprising the aforementioned system.
[0013] The present invention also provides a method for detecting alfalfa mosaic virus using the aforementioned system or kit, comprising the following steps: (1) Add the RNA of the sample to be tested into the RT-RPA isothermal amplification system for RT-RPA isothermal amplification to obtain RT-RPA amplification products; (2) The RT-RPA amplification product was added to the CRISPR / Cas12a detection system for reaction; (3) Observe the generation of fluorescence signal. The presence of fluorescence signal indicates that the sample contains alfalfa mosaic virus, while the absence of fluorescence signal indicates that the sample does not contain alfalfa mosaic virus.
[0014] Preferably, the temperature of the RT-RPA isothermal amplification in step (1) is 35~40℃, and the time of the RT-RPA isothermal amplification is 10~50min.
[0015] Preferably, the temperature of the reaction in step (2) is 35~40℃ and the reaction time is 5~15min.
[0016] The present invention also provides the application of the described system or the described kit in the preparation of products for detecting alfalfa mosaic virus.
[0017] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a diagnostic and detection method for alfalfa mosaic virus based on RPA-CRISPR-Cas12a. By optimizing the nucleic acid extraction method, RPA reaction conditions, and CRISPR detection system, a rapid, efficient, and highly specific detection system is established. Using cDNA as a template, this method performs RPA amplification at a constant temperature of 38℃ for 30 minutes, followed by detection using the CRISPR-Cas12a system for 10-15 minutes to obtain results, significantly shortening the detection time and improving accuracy. This method is simple to operate, requires minimal equipment, and is suitable for rapid detection of alfalfa mosaic virus in field settings and at grassroots laboratories. Detailed Implementation
[0018] This invention provides a system for detecting alfalfa mosaic virus based on RT-RPA-CRISPR-Cas12a, including an RT-RPA isothermal amplification system and a CRISPR / Cas12a detection system; The RT-RPA isothermal amplification system includes an RPA primer pair, which includes RPA-F and RPA-R. The nucleotide sequence of RPA-F is shown in SEQ ID NO:1, and the nucleotide sequence of RPA-R is shown in SEQ ID NO:2. The CRISPR / Cas12a detection system includes crRNA and a fluorescent reporter probe; the nucleotide sequence of the crRNA is shown in SEQ ID NO:3 and SEQ ID NO:4, and the nucleotide sequence of the fluorescent reporter probe is shown in SEQ ID NO:5.
[0019] In this invention, the RT-RPA isothermal amplification system further includes nuclease-free water, buffer solution, and magnesium ions; the RT-RPA isothermal amplification system includes 30 μL of buffer solution, 6.5 μL of deionized water, 2.5 μL each of upstream and downstream primers with a final concentration of 0.4 μmol / L, 1 μL each of template cDNA, and 2.5 μL of magnesium acetate solution with a final concentration of 280 mmol / L; the CRISPR / Cas12a detection system includes 2 μL of Holmes buffer, 0.5 μL of 10 μM LbCas12a, 1 μL of 10 μM fluorescent reporter probe, 1 μL of 10 μM crRNA, 1 μL of RPA amplification product, and 14.5 μL of DNase / RNase-free double-distilled water.
[0020] The present invention also provides a kit for detecting alfalfa mosaic virus based on RT-RPA-CRISPR-Cas12a, comprising the aforementioned system.
[0021] The present invention also provides a method for detecting alfalfa mosaic virus using the aforementioned system or kit, comprising the following steps: (1) Add the RNA of the sample to be tested into the RT-RPA isothermal amplification system for RT-RPA isothermal amplification to obtain RT-RPA amplification products; (2) The RT-RPA amplification product was added to the CRISPR / Cas12a detection system for reaction; (3) Observe the generation of fluorescence signal. The presence of fluorescence signal indicates that the sample contains alfalfa mosaic virus, while the absence of fluorescence signal indicates that the sample does not contain alfalfa mosaic virus.
[0022] In this invention, the temperature of the RT-RPA isothermal amplification is 35~40℃, preferably 36~39℃, and more preferably 38℃; the time of the RT-RPA isothermal amplification is 10~50min, preferably 20~40min, and more preferably 30min; the temperature of the reaction is 35~40℃, preferably 36~39℃, and more preferably 37℃; and the reaction time is 5~15min, preferably 10min.
[0023] The present invention also provides the application of the described system or the described kit in the preparation of products for detecting alfalfa mosaic virus.
[0024] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0025] Example 1
[0026] 1. Design of AMV-specific primers, probes, and crRNA
[0027] (1) Design of RPA primers
[0028] Referring to the AMV genome (the genomic RNA of the AMV Tongliao strain (AMV-TL), specifically RNA1 (GenBank accession number PV779664, 3505 nucleotides), RNA2 (GenBank accession number PV779665, 2477 nucleotides), and RNA3 (GenBank accession number PV779666, 1827 nucleotides), specific RPA primer pairs for AMV detection were designed using Primer Premier 6.0 software and manually revised, following the principles of RPA primer design. The RPA-specific primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. The primer sequences are as follows: RPA-F:acgttctcagaactatgctgccttacgcaa (SEQ ID NO:1), RPA-R: cgaacttctcattagcgtgaaacgcgccat (SEQ ID NO: 2).
[0029] (2) Design of crRNA
[0030] The intra-ambulb sequence between the upstream and downstream primers of the RPA was identified as the unique target region for crRNA. Within the locked amplicon sequence, the PAM sequence of LbCas12a was searched, and the immediate downstream sequence of the PAM was the target region. A 20-23 nt tract of the positive strand was extracted, and the DNA base T was replaced with U to generate an RNA spacer sequence. The seed region was strictly conserved, with no mismatches, ensuring efficient binding and activation of Cas12a. The 3' end of the fixed Scaffold sequence was directly ligated to the 5' end of the Spacer sequence without a spacer base, forming a complete crRNA sequence. The specificity of crRNA for the DNA template was verified by BLAST alignment to the GenBank database. The crRNA was synthesized by Beijing Qingke Biotechnology Co., Ltd. The crRNA sequence is as follows: crRNA-1: UAAUUUCUACUAAGUGUAGAUGAUCCCUCAGGCUGCGCAUCGAA (SEQ ID NO:3); crRNA-2: UAAUUUCUACUAAGUGUAGAUAGUUGGUCUUCACAGCUCCUACC (SEQ ID NO: 4).
[0031] (3) Design of fluorescent reporter probe
[0032] Based on the trans-cleavage activity of CRISPR-Cas12a, the required reporter probe was designed. A fluorescent reporter group (FAM) was added to the 5' end, and a fluorescent quencher group (BHQ1) was added to the 3' end. The reporter probe was synthesized by Beijing Qingke Biotechnology Co., Ltd. The fluorescent reporter probe sequence is as follows: AATTTCAAGCATTCCTATGCCGTAGCCCTT / iFAMdT / idSpace / T / iBHQ1dT / TGGACTTCGATGCGC-C3 spacer (SEQ ID NO: 5).
[0033] 2. Rapid extraction of nucleic acids from alfalfa samples
[0034] Place 0.1g of alfalfa leaf sample in a clean and sterilized mortar, add liquid nitrogen and grind thoroughly into powder, then add 1mL of Trizol Reagent and mix well. Transfer the homogenized sample to a 2 mL RNase-free centrifuge tube, cap and vortex vigorously to mix, and incubate at room temperature for 5 min. Add 0.2 mL chloroform, invert and mix for 15 s, and incubate at room temperature for 15 min. Centrifuge at 12,000 rpm for 20 min at 4 °C, and transfer the colorless aqueous phase to a new 1.5 mL RNase-free centrifuge tube. Add an equal volume of isopropanol (450 μL), mix, and incubate at room temperature for 10 min. Centrifuge at 12,000 rpm for 10 min at 4 °C. Carefully discard the supernatant to obtain a gelatinous RNA precipitate. Add 1 mL of 75% anhydrous ethanol (prepared with RNase-free ddH2O), mix well to ensure sufficient contact between RNA and ethanol. Centrifuge at 7,500 rpm for 5 min at 4 °C. Carefully discard the supernatant. Place in air for 5–10 min to dry the RNA precipitate. Dissolve in an appropriate amount of RNase-free ddH2O, and store at -80 °C after concentration determination and electrophoresis.
[0035] 3. Reverse transcription
[0036] Use 2 μL of total RNA (approximately 2 μg RNA) as a template, add 1 μL of Oligo dT primer (0.5 μg / μL), 1 μL of random primer (0.5 μg / μL), and 1 μL of dNTPs (10 mM), and bring the volume to 14.5 μL with DEPC water. Incubate at 70℃ for 5 min, then place on ice for 3–5 min. Add 4 μL of 5× reverse transcription buffer, 0.5 μL of Ribonuclease Inhibitor (40 U / μL), and 1 μL of M-MLV reverse transcriptase (200 U / μL), mix well, and incubate at 42℃ for 1 h. Store the obtained cDNA at -20℃ for later use.
[0037] 4. RPA Response Time Optimization
[0038] Using cDNA prepared by reverse transcription of total RNA as a template, RPA amplification was performed using primers RPA-F and RPA-R. The RPA amplification system was as follows: 30 μl of rehydration buffer, 6.5 μl of deionized water, 2.5 μl each of forward and reverse primers (final concentration 0.4 μmol / L), and 1 μl of template cDNA were added to a 0.2 ml TwistAmp reaction tube (TwistAmp Basic kits, Twist). Finally, 2.5 μl of magnesium acetate solution (280 mmol / L) was added. The RPA amplification system was thoroughly mixed and incubated in a 38°C water bath for 10 min, 20 min, 30 min, 40 min, and 50 min, respectively. After the RPA reaction, the PCR product was purified using a purification kit and electrophoresed on a 1.0% agarose gel. The results were observed using a gel imaging system.
[0039] Experimental Results: At a reaction time of 10 min, no clear target amplification band matching the expected fragment size was observed; only a weak primer dimer signal was visible. This indicates that the isothermal amplification reaction was not fully initiated at this time, and a stable and detectable effective target product could not be obtained. When the reaction time was extended to 20 min, a target band could be observed, but the band brightness was weak, the signal abundance was low, and the amount of amplified product was insufficient, failing to meet the sensitivity and stability requirements for subsequent detection. When the reaction time reached 30 min, the electrophoresis results showed a single, bright, and clearly defined target-specific band with no obvious non-specific bands or primer dimers. The target fragment amplification efficiency reached its peak, and both the reaction specificity and product yield were at their optimal levels. When the reaction time was further extended to 40 min and 50 min, the brightness and signal abundance of the target band did not significantly improve, and the amount of effective amplified product did not increase further. At the same time, obvious non-specific amplification bands and tailing phenomena appeared in the gel, and the primer dimer signal was also significantly enhanced. This indicates that an excessively long reaction time not only fails to improve the effective amplification efficiency but also exacerbates non-specific amplification, severely reducing the specificity of detection. In summary, a reaction time of 30 minutes is sufficient for efficient and highly specific amplification of the target cDNA fragment. Further extending the reaction time does not yield positive gain and can lead to decreased detection specificity and prolonged detection cycles. Therefore, in subsequent studies, 30 minutes was adopted as the reaction time for all routine RT-RPA assays.
[0040] 5. CRISPR-Cas12a detection system
[0041] A CRISPR-Cas12a detection system was established using RPA amplification products as a template. The CRISPR-Cas12a reaction system included Cas12a protein, crRNA, a fluorescent reporter probe, reaction buffer, and RPA amplification products. Specifically, the system consisted of 2 μL Holmes buffer (10×), 0.5 μL LbCas12a (10 μM), 1 μL reporter probe (10 μM), 1 μL crRNA (10 μM), 1 μL RPA amplification products, and 14.5 μL DNase / RNase-free double-distilled water, for a total reaction volume of 20 μL. After thorough mixing, the reaction was carried out at 37℃ for 10 min, and the fluorescence signal was observed after the reaction.
[0042] Experimental results: When the sample contained the target fragment of alfalfa mosaic virus, the system produced a significant fluorescence signal; when the sample did not contain the target fragment, the system did not produce a fluorescence signal. This indicates that the established CRISPR-Cas12a detection system can be used for the rapid detection of alfalfa mosaic virus.
[0043] 6. Specific detection
[0044] To verify the specificity of the RPA-CRISPR detection system, plant materials infected with other common alfalfa viruses (LTSV, PeSV, MsAPV1, and MsAPV2) and healthy alfalfa plants were selected as controls. Using cDNA obtained by reverse transcription of extracted total RNA as a template, RPA amplification was performed according to the above method, followed by CRISPR-Cas12a detection. Fluorescence detection was used to observe the reaction results to verify the specificity of the detection system.
[0045] Experimental results: No obvious fluorescence signals were produced in samples infected with non-target viruses (LTSV, PeSV, MsAPV1 and MsAPV2) or healthy plant samples. Only samples infected with alfalfa mosaic virus produced obvious fluorescence signals, indicating that the RPA-CRISPR detection system established in this invention has good specificity.
[0046] 7. Sensitivity Testing
[0047] The RPA amplification product was ligated into a T vector and sequenced. After successful sequencing, the plasmid was extracted, and its concentration and copy number were calculated. The plasmid containing the alfalfa mosaic virus target fragment was diluted to a certain concentration and then serially diluted 10-fold to obtain 10... 7 10 6 10 5 10 4 10³, 10², 10¹ and 10 0Serial dilutions of the template were prepared using copies / μL. Different concentrations of plasmid were used as templates, and detection was performed according to the established RPA-CRISPR detection system. Comparative experiments were also conducted using conventional PCR methods.
[0048] After the reaction was completed, the results were observed by fluorescence detection and the detection results at different template concentrations were recorded to determine the lowest detection limit of the detection system.
[0049] Experimental results: The RPA-CRISPR detection method established in this invention can detect concentrations as low as 10. 0 The target template is measured in copies / μL, while the detection limit of conventional PCR methods is 10³ copies / μL, indicating that this method has higher sensitivity.
[0050] 8. Field sample testing
[0051] RPA-CRISPR detection was performed on alfalfa samples collected from the field according to the above method; at the same time, parallel detection was performed on the same batch of samples using conventional RT-PCR method, and the detection results were observed, compared and recorded.
[0052] Experimental results: Of the 12 field samples tested, 4 were positive for alfalfa mosaic virus, while the remaining samples were negative. The results of this method were completely consistent with those of RT-PCR, but the RPA-CRISPR method requires less time, is simpler to operate, and can obtain results quickly.
[0053] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A system for detecting alfalfa mosaic virus based on RT-RPA-CRISPR-Cas12a, characterized in that, This includes the RT-RPA isothermal amplification system and the CRISPR / Cas12a detection system; The RT-RPA isothermal amplification system includes an RPA primer pair, which includes RPA-F and RPA-R. The nucleotide sequence of RPA-F is shown in SEQ ID NO:1, and the nucleotide sequence of RPA-R is shown in SEQ ID NO:
2. The CRISPR / Cas12a detection system includes crRNA and a fluorescent reporter probe; the nucleotide sequence of the crRNA is shown in SEQ ID NO:3 and SEQ ID NO:4, and the nucleotide sequence of the fluorescent reporter probe is shown in SEQ ID NO:
5.
2. The system according to claim 1, characterized in that, The RT-RPA isothermal amplification system also includes nuclease-free water, buffer solution, and magnesium ions.
3. The system according to claim 2, characterized in that, The RT-RPA isothermal amplification system includes 30 μL of buffer, 6.5 μL of deionized water, 2.5 μL each of upstream and downstream primers with a final concentration of 0.4 μmol / L, 1 μL each of template cDNA, and 2.5 μL of magnesium acetate solution with a final concentration of 280 mmol / L.
4. The system according to claim 1, characterized in that, The CRISPR / Cas12a detection system includes 2 μL Holmes buffer, 0.5 μL 10 μM LbCas12a, 1 μL 10 μM fluorescent reporter probe, 1 μL 10 μM crRNA, 1 μL RPA amplification product, and 14.5 μL DNase / RNase-free double-distilled water.
5. A kit for detecting alfalfa mosaic virus based on RT-RPA-CRISPR-Cas12a, characterized in that, Includes the system described in any one of claims 1 to 4.
6. A method for detecting alfalfa mosaic virus using the system described in any one of claims 1 to 4 or the kit described in claim 5, characterized in that, Includes the following steps: (1) The RNA of the sample to be tested was added to the RT-RPA isothermal amplification system for RT-RPA isothermal amplification to obtain RT-RPA amplification products; (2) The RT-RPA amplification product was added to the CRISPR / Cas12a detection system for reaction; (3) Observe the generation of fluorescence signal. The presence of fluorescence signal indicates that the sample contains alfalfa mosaic virus, while the absence of fluorescence signal indicates that the sample does not contain alfalfa mosaic virus.
7. The method according to claim 6, characterized in that, The temperature of the RT-RPA isothermal amplification in step (1) is 35~40℃, and the time of the RT-RPA isothermal amplification is 10~50min.
8. The method according to claim 6, characterized in that, The reaction temperature in step (2) is 35~40℃, and the reaction time is 5~15min.
9. The use of the system according to any one of claims 1 to 4 or the kit according to claim 5 in the preparation of products for detecting alfalfa mosaic virus.