West nile virus in vitro transcribed rna quality control and methods of making and using same
By preparing a quality control sample for West Nile virus in vitro transcribed RNA, the problems of stability and biosafety risks of quality control samples in existing technologies have been solved, enabling quality control and monitoring of detection efficiency in multiple scenarios, and making it suitable for West Nile virus nucleic acid detection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SCIENCE & TECHNOLOGY RESEARCH CENTER OF CHINA CUSTOMS
- Filing Date
- 2026-05-12
- Publication Date
- 2026-08-04
AI Technical Summary
Existing technologies lack stable and high-quality control products suitable for West Nile virus detection, and traditional positive controls pose biosafety risks, making it difficult to meet the needs of multi-scenario testing.
This invention provides a West Nile virus in vitro transcribed RNA quality control product, which is prepared by artificially synthesizing a recombinant vector containing a specific West Nile virus target sequence, and then undergoing plasmid extraction, enzyme digestion and linearization, DNA purification, in vitro transcription and RNA purification. It is suitable for quality control of nucleic acid detection.
This quality control product mimics natural RNA viruses, has wide applicability, and can accurately monitor detection efficiency throughout the entire reverse transcription, amplification, and sequencing process. It has good quality control performance, is non-infectious, and is suitable for various detection standards, making it ideal for use in basic laboratories.
Smart Images

Figure CN122168803B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of virus detection technology, specifically to West Nile virus in vitro transcribed RNA quality control products, their preparation methods, and applications. Background Technology
[0002] West Nile virus disease is a zoonotic vector-borne infectious disease caused by West Nile virus (WNV), which has become prevalent in many regions. This disease not only poses a long-term threat to human health but also causes significant economic losses and human casualties. It has been listed as a major global epidemic by the World Health Organization and the World Organisation for Animal Health, becoming a public health concern.
[0003] West Nile virus is a newly emerging neurotropic RNA virus, classified under the Flaviviridae family and Flavivir genus. It replicates within mosquitoes and belongs to the Japanese encephalitis virus group, sharing homology with dengue virus and Zika virus. Currently, there are no effective treatments or vaccines for West Nile virus.
[0004] With the acceleration of globalization, climate change, and the continuous evolution of pathogens, we face the dual threat of both emerging and re-emerging infectious diseases. On the one hand, emerging and re-emerging infectious diseases are highly uncertain and extremely destructive; on the other hand, classic infectious diseases such as influenza and tuberculosis remain widespread. The key to effective prevention and control of infectious diseases lies in the rapid and accurate identification of pathogens. Pathogen detection is the cornerstone of infectious disease prevention and control, and a rigorous quality control system is essential for accurate and reliable test results. In the quality control system for pathogen detection, the establishment of negative and positive controls is a crucial element in ensuring the accuracy of test results. For certain pathogenic pathogens, since my country only experiences imported cases and no local outbreaks, obtaining positive samples has long faced the dual dilemma of scarce sources and biosafety control. Live pathogens, as traditional positive controls, pose safety hazards such as bioaerosol leakage during transportation, storage, and experimental operations, significantly contradicting the mandatory requirements of the "Regulations on Biosafety Management of Pathogenic Microorganism Laboratories." Therefore, developing alternative positive controls with biosafety exemption characteristics and compatibility with multiple testing platforms has dual practical value for improving disease monitoring capabilities and laboratory risk management. Quality control materials are reference substances with known concentrations or activity levels. They can be used not only to assess the repeatability and precision of test results, but also as a benchmark for continuous quality monitoring and for the ongoing evaluation of the consistency of routine laboratory analytical procedures.
[0005] Nucleic acid testing is one of the important rapid virus detection methods. my country has successively issued a number of testing standards, such as SN / T 1761-2006 "Laboratory Inspection Procedures for West Nile Virus Diseases at Ports of Entry and Exit", SN / T 2868-2011 "Technical Specifications for Quarantine of West Nile Virus Diseases", GB / T 27518-2011 "Detection Methods for West Nile Virus Diseases", SN / T 3560-2013 "Multiplex Real-Time Fluorescent RT-PCR Detection Method for Yellow Fever Virus, Dengue Virus, Chikungunya Virus and West Nile Virus at Border Ports", SN / T3742-2013 "Real-Time Fluorescent RT-PCR Method for West Nile Virus Detection at Border Ports", and SN / T 1460-2015 "Detection Method for Imported Mosquitoes Carrying West Nile Virus and St. Louis Encephalitis Virus", all of which use ordinary RT-PCR, nested RT-PCR or real-time fluorescent RT-PCR technology for virus detection. Currently, there is a lack of stable and high-quality control products on the market suitable for West Nile virus detection. Summary of the Invention
[0006] The purpose of this invention is to provide quality control materials for West Nile virus in vitro transcribed RNA, their preparation methods, and applications, so as to provide stable and high-quality control materials for West Nile virus in vitro transcribed RNA for West Nile virus detection.
[0007] This invention is achieved through the following technical solution: This invention provides a quality control product for West Nile virus in vitro transcribed RNA, which is obtained by artificially synthesized recombinant vector containing some targets of West Nile virus, after plasmid extraction, enzyme digestion and linearization, DNA purification, in vitro transcription, and RNA purification. The sequences of the West Nile virus partial targets include: partial sequences of the 5'UTR and capsid protein C binding region, partial sequences of the membrane glycoprotein precursor prM and envelope protein E binding region, partial sequences of envelope protein E, partial sequences of non-structural protein NS1, partial sequences of the binding regions of non-structural protein NS1 and non-structural protein NS2A, partial sequences of the NS5 gene, and partial sequences of the 3'UTR region. The partial nucleotide sequence of the binding region of the membrane glycoprotein precursor prM and the envelope protein E of the West Nile virus partial target is shown in SEQ ID NO:2; The partial nucleotide sequences of the binding regions of the non-structural protein NS1 and the non-structural protein NS2A of the West Nile virus target are shown in SEQ ID NO:5; The partial nucleotide sequence of the NS5 gene, a partial target of the West Nile virus, is shown in SEQ ID NO:6.
[0008] Furthermore, in the West Nile virus in vitro transcribed RNA quality control, the partial nucleotide sequence of the 5'UTR and capsid protein C binding region of the West Nile virus is shown in SEQ ID NO:1; The partial nucleotide sequence of the envelope protein E of the West Nile virus partial target is shown in SEQ ID NO:3; The partial nucleotide sequence of the non-structural protein NS1, a partial target of the West Nile virus, is shown in SEQ ID NO:4; The partial nucleotide sequence of the 3'UTR region of the West Nile virus partial target is shown in SEQ ID NO:7.
[0009] The present invention provides a recombinant vector for expressing the above-mentioned West Nile virus in vitro transcribed RNA quality control, the recombinant vector comprising: an initial vector and a partial target of the West Nile virus.
[0010] More specifically, in the recombinant vector used to express West Nile virus in vitro transcribed RNA quality control material, the initial vector used for the recombinant vector is pBluescript II SK(+) plasmid.
[0011] This invention also provides a method for preparing the above-mentioned West Nile virus in vitro transcribed RNA quality control, comprising the following steps: After synthesizing a recombinant vector by combining a portion of the West Nile virus target with the initial vector, the vector was transferred into Escherichia coli. The resulting RNA was then extracted, linearized by enzyme digestion, purified by DNA, and transcribed in vitro to obtain a quality control sample of the West Nile virus in vitro transcribed RNA.
[0012] More specifically, in the above-mentioned method for preparing West Nile virus in vitro transcribed RNA quality control, the *Escherichia coli* is *Escherichia coli* TOP10.
[0013] Further specifying, in the above-mentioned method for preparing West Nile virus in vitro transcribed RNA quality control, the enzymatic linearization is as follows: Sma I enzyme linearization.
[0014] Further specifying, in the above-mentioned method for preparing West Nile virus in vitro transcribed RNA quality control material, the in vitro transcription is followed by purification, and the purification includes the following steps: RNA obtained from in vitro transcription was collected, residual DNA was removed, and the RNA was purified by the Trizol method to obtain purified West Nile virus in vitro transcribed RNA quality control material.
[0015] Further specifying, in the above-described method for preparing the West Nile virus in vitro transcribed RNA quality control, the concentration of the West Nile virus in vitro transcribed RNA quality control is 3.76 × 10⁻⁶. 13copies / mL.
[0016] The present invention also provides the application of the West Nile virus in vitro transcribed RNA quality control product, the recombinant vector, or the West Nile virus in vitro transcribed RNA quality control product prepared by the above-mentioned method in the preparation of West Nile virus nucleic acid detection kits, West Nile virus detection positive controls, or West Nile virus detection quality control products.
[0017] Compared with the prior art, the present invention has the following advantages and beneficial effects: The in vitro transcribed RNA quality control product provided by this invention contains partial nucleotide sequences of the West Nile virus 5'UTR and capsid protein C binding region, partial nucleotide sequences of the membrane glycoprotein precursor prM and envelope protein E binding region, partial nucleotide sequences of envelope protein E, partial nucleotide sequences of non-structural protein NS1, partial nucleotide sequences of non-structural protein NS1 and non-structural protein NS2A binding region, partial nucleotide sequences of the NS5 gene, and partial nucleotide sequence fragments of the 3'UTR. These fragments can be used for West Nile virus 5'UTR and capsid protein C binding region, partial sequences of the membrane glycoprotein precursor prM and envelope protein E binding region, partial sequences of envelope protein E, partial sequences of non-structural protein NS1, partial sequences of non-structural protein NS1 and non-structural protein NS2A binding region, partial sequences of the NS5 gene, and 3'UTR. This quality control product is designed for nucleic acid detection of West Nile virus targeting partial sequences of the 5'UTR region. It mimics natural RNA viruses, enabling accurate monitoring of detection efficiency throughout the entire process, including reverse transcription, amplification, and sequencing. It has broad applicability and is non-infectious, safe for use in basic laboratory environments. Furthermore, it can be stably and mass-produced through in vitro synthesis. It is suitable for quality control of nucleic acid detection methods targeting partial sequences of the 5'UTR and capsid protein C binding region of West Nile virus, partial sequences of the membrane glycoprotein precursor prM and envelope protein E binding region, partial sequences of envelope protein E, partial sequences of the non-structural protein NS1, partial sequences of the non-structural protein NS1 and non-structural protein NS2A binding regions, partial sequences of the NS5 gene, and partial sequences of the 3'UTR region, as well as for evaluating detection reagents and laboratory capabilities.
[0018] The West Nile virus in vitro transcribed RNA quality control product provided by this invention contains a partial sequence fragment of the West Nile virus non-structural protein NS1, which is a target of the standard GB / T 27518-2011 "Detection Method for West Nile Virus Disease"; it contains a partial sequence fragment of the West Nile virus envelope protein E, which is a target of the standard GB / T 27518-2011 "Detection Method for West Nile Virus Disease", SN / T 2868-2011 "Technical Specification for Quarantine of West Nile Virus Disease", and SN / T 1460-2015 "Detection Method for Imported Mosquitoes Carrying West Nile Virus and St. Louis Encephalitis Virus"; and it contains a partial sequence fragment of the West Nile virus capsid protein C, which is a target of the standard GB / T27518-2011 "Detection Method for West Nile Virus Disease" and SN / T 1460-2015 "Detection Method for Imported Mosquitoes Carrying West Nile Virus and St. Louis Encephalitis Virus". Therefore, this quality control material can also be used for the fluorescent RT-PCR detection of West Nile virus in the above standards, for the quality control of detection methods and reagents.
[0019] The West Nile virus in vitro transcribed RNA quality control product provided by this invention has high purity, no plasmid DNA residue, and good quality control performance.
[0020] The West Nile virus in vitro transcribed RNA quality control provided by this invention can be determined using the real-time quantitative RT-PCR method, and can be used for quantitative analysis of samples and evaluation of detection methods and reagents. Attached Figure Description
[0021] To more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly described below. It should be understood that the following drawings only show some embodiments of the present invention and should not be considered as a limitation of the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort. In the drawings: Figure 1 The images show agarose gel electrophoresis results of the West Nile virus recombinant vector after enzyme digestion and purification. In the images, 1 is the DL 10000bp Marker; 2 is the DL 5000bp Marker; 3 is the negative control; 4 is the recombinant vector; 5 is the linearized DNA; 6 is the purified DNA; 7 is the recombinant vector; 8 is the linearized DNA; and 9 is the purified DNA. Figure 2 Results of detecting gradient-dilution in vitro transcribed RNA using a real-time quantitative RT-PCR method for West Nile virus detection; Figure 3 Results of detecting gradient-dilution in vitro transcribed RNA using a real-time quantitative RT-PCR method for West Nile virus detection; Figure 4The results of the accuracy test; Figure 5 The results of inspections on different batches of quality control products; Figure 6 The test results are for quality control samples stored at three different temperatures: -20℃, 4℃, and 25℃ for 3 days, 7 days, and 14 days. Detailed Implementation
[0022] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments and accompanying drawings. The illustrative embodiments and descriptions of this invention are for explanation only and are not intended to limit the invention. Unless otherwise specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.
[0023] This invention provides a quality control product for West Nile virus in vitro transcribed RNA, which is obtained by artificially synthesized recombinant vector containing some targets of West Nile virus, after plasmid extraction, enzyme digestion and linearization, DNA purification, in vitro transcription, and RNA purification. The sequences of the West Nile virus partial targets include: partial sequences of the 5'UTR and capsid protein C binding region, partial sequences of the membrane glycoprotein precursor prM and envelope protein E binding region, partial sequences of envelope protein E, partial sequences of non-structural protein NS1, partial sequences of the binding regions of non-structural protein NS1 and non-structural protein NS2A, partial sequences of the NS5 gene, and partial sequences of the 3'UTR region.
[0024] The partial nucleotide sequence of the 5'UTR and capsid protein C binding region of the West Nile virus target is shown in SEQ ID NO:1, specifically including: .
[0025] The partial nucleotide sequence of the membrane glycoprotein precursor prM and envelope protein E binding regions of the West Nile virus partial target is shown in SEQ ID NO:2, specifically including: GGTGGCCCCAGCTTACAGCTTCAACTGCCTTGGAATGAGCAACAGAGACTTCTTGGAAGGAGTGTCTGGAGCAACATGGGTGGATTTGGTTCTCGAAGGCGACAGCTGCGTGACTATCATGTCTAAGGACAAGCCTACCATCGATGTGAAGATGATGAATATGGAGGCGGCCAACCTGGCAGAGGTCCGCAGTTATTGCTATTTGGCTACCGTCAGCGATCTCTCCACCAAAGCTGCGTGCCCGACCATGGGAGAAGCTCACAATGACAAACGTGCTGACCCAGCTTTTGTGTGCAGACAAGGAGTGGTGGACAGGGGCTGGGGCAACGGCTGCGGACTATTTGGCAAAGGAAGCATTGACACATGCGCCAAATTTGCCTGCTCTA。
[0026] The partial nucleotide sequence of the envelope protein E of the West Nile virus partial target is as shown in SEQ ID NO: 3, specifically including: GTCATTTGAAGTGTAGAGTGAAGATGGAAAAATTGCAGTTGAAGGGAACAACCTATGGCGTCTGTTCAAAGGCTTTCAAGTTTCTTGGGACTCCCGCAGACACAGGTCACGGCACTGTGGTGTTGGAATTGCAGTACACTGGCACGGATGGACCTTGCAAAGTTCCTATCTCGTCAGTGGCTTCATTGAACGACCTAACGCCAGTGGGCAGATTGGTCACTGTCAACCCTTTTGTTTCAGTGGCCACGGCCAACGCTAAGGTCCTGATTGAATTGGAACCACCCTTTGGAGACTCATACATAGTGGTGGGCAGAGGAGAACAACAGATCAATCACCATTGGCACAAGTCTGGAAGCAGCATTGGCAAAGCCTTTACAACCACCCTCAAAGGAGCGCAGAGACTAGCCGCTCTAGGAGACACAGCTTGGGACTTTGGATCAGTTGGAGGGGTGTTCACCTCAGTTGGGAAGGCTGTCCATCAAG。
[0027] The partial nucleotide sequence of the non-structural protein NS1, a partial target of the West Nile virus, is shown in SEQ ID NO:4, and specifically includes: GATACGTGGAAGCTTGAAAGGGCAGTTCTGGGTGAAGTCAAATCATGTACGTGGCCTGAGACGCATACCTTGTGGGGCGATGGAATCCTTGAGAGTGACTTGATAATACCAGTCACACTGGCGGGACCACGAAGCAATCACAATCGGAGACCTGGGTACAAGACACAAAACCAGGGCCCATGGGACGAAGGCCGGGTAGA.
[0028] The partial nucleotide sequences of the binding regions of the non-structural protein NS1 and the non-structural protein NS2A of the West Nile virus partial target are shown in SEQ ID NO:5, specifically including: GAGACATGATGAAAAGACCCTCGTGCAGTCACAAGTGAATGCTTATAATGCTGATATGATTGACCCTTTTCAGTTGGGCCTTCTGGTCGTGTTCTTGGCCACCCAGGAGGTCCTTCGCAAGAGGTGGACAGCCAAGATCAGCATGCCAGCTATACTGATTGCTC.
[0029] The partial nucleotide sequence of the NS5 gene, a partial target of the West Nile virus, is shown in SEQ ID NO:6, and specifically includes: ACATGAAGAGCCCCAACTAGTGCAAAGTTATGGATGGAACATTGTCACCATGAAGAGTGGAGTGGATGTGTTCTACAGACCTTCTGAGTGTTGTGACACCCTCCTTTGTGACATCGGAGAGTCCTCGTCAAGT GCTGAGGTTGAAGAGCATAGGACGATTCGGGTCCTTGAAATGGTTGAGGACTGGCTGCACCGAGGGCCAAGGGAATTTTGCGTGAAGGTGCTCTGTCCCTACATGCCGAAAGTCATAGAGAAGATGGAGCTGC.
[0030] The partial nucleotide sequence of the 3'UTR region of the West Nile virus partial target is shown in SEQ ID NO:7, specifically including: GTCAGGCCGGGAAGTTCCCGCCACCGGAAGTTGAGTAGACGGTGCTGCCTGCGACTCAACCCCAGGAGGACTGGGTGAACAAAGCCGCGAAGTGATCCATGTAAGCCCTCAGAACCGTCTCGGAAGGAGGACCCACATGTTGTAACTTCAAAGCCCAATGTCAGACCACGCTACGGCGTGCTACTCTGCGGAGAGTGCAGTCTGCGATAGTGCCCCAGGAGGACTGGGTTAACAAAGGCAAAC CAACGCCCCACGCGGCCCTAGCCCCGGTAATGGTGTTAACCAGGGCGAAAGGACTAGAGGTTAGGAGACCCCGCGGTTTAAAGTGCACGGCCCAGCCTGGCTGAAGCTGTAGGTCAGGGGAAGGACTAGAGGTTAGTGGAGACCCCGTGCCACAAAACACCACAACAAAACAGCATATTGACACCTGGGATAGACTAGGAGATCTTCTGCTCTGCACAACCAGCCACACGGCACAGTGCGCCG This quality control product can mimic natural RNA viruses, enabling accurate monitoring of detection efficiency throughout the entire process of reverse transcription, amplification, and sequencing. The sequence is flexibly customizable and has a wide range of applications. At the same time, this quality control product is non-infectious, can be safely used in basic laboratory environments, and can be stably and mass-produced through in vitro synthesis.
[0031] To further illustrate the present invention, the following description, in conjunction with embodiments, illustrates the West Nile virus in vitro transcribed RNA quality control product, its preparation method, and its application. However, it should be understood that these embodiments are implemented under the premise of the technical solution of the present invention, providing detailed implementation methods and specific operating procedures. They are only for further illustrating the features and advantages of the present invention and are not intended to limit the scope of the claims of the present invention. The protection scope of the present invention is not limited to the following embodiments.
[0032] 1. Materials The synthesis and transfer of glycerol-containing bacteria (Escherichia coli TOP10), pBluescript II SK-5UTR-C-prM-E-NS1-NS2A-NS5-3UTR, were completed by Sangon Biotech (Shanghai) Co., Ltd.
[0033] 2. Methods 2.1 Synthesis of pBluescript II SK-5UTR-C-prM-E-NS1-NS2A-NS5-3UTR By reviewing relevant domestic and international literature, the following nucleotide sequences were ultimately selected as the design sequences: West Nile virus lineage 1 (NC_009942.1) 5'UTR and capsid protein C binding region (SEQ ID NO:1), membrane glycoprotein precursor prM and envelope protein E binding region (SEQ ID NO:2), envelope protein E binding region (SEQ ID NO:3), non-structural protein NS1 binding region (SEQ ID NO:4), non-structural protein NS1 and non-structural protein NS2A binding region (SEQ ID NO:5), NS5 gene binding region (SEQ ID NO:6), and 3'UTR region binding region (SEQ ID NO:7).
[0034] A PstI restriction site CTGCAG was added to the 5' end of SEQ ID NO:1, and a SmaI restriction site CCCGGG and a BamHI restriction site GGATCC were added to the 3' end of SEQ ID NO:7. The sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd., which provided a pBluescript II SK plasmid containing the target fragment, named pBluescript II SK-5UTR-C-prM-E-NS1-NS2A-NS5-3UTR. This plasmid was then transformed into E. coli TOP10 and delivered as a glycerol bacterium for subsequent experiments.
[0035] 2.2 Strain activation and plasmid extraction Use an inoculation loop to pick up the bacterial culture and place it in LB liquid medium. Incubate overnight on a shaker at 37°C with a rotation speed of 80 rpm. Extract plasmid DNA using a rapid plasmid miniprep kit. Add 1 mL of overnight culture to a centrifuge tube and centrifuge at 12,000 rpm (~13,400 × g) for 1 min using a standard benchtop centrifuge, removing as much supernatant as possible. Add 150 μL of solution P1 to the centrifuge tube containing the bacterial pellet and resuspend the pellet using a pipette or vortex. Add 150 μL of solution P2 to the centrifuge tube and gently invert 6-8 times to fully lyse the bacteria. Add 350 μL of solution P5 to the centrifuge tube and immediately and rapidly invert 12-20 times to mix thoroughly; a flocculent precipitate will appear at this point. Centrifuge at 12,000 rpm (~13,400 × g) for 2 min. Transfer the supernatant collected in the previous step to the adsorption column CP3 using a pipette, being careful not to remove the pellet. Centrifuge at 12,000 rpm (~13,400 × g) for 30 minutes. Centrifuge for 30 seconds, discarding the waste liquid in the collection tube, and place the adsorption column CP3 into the collection tube. Add 300 μL of wash buffer PWT to the adsorption column CP3, centrifuge at 12,000 rpm (~13,400×g) for 30 seconds, discard the waste liquid in the collection tube, and place the adsorption column CP3 into the collection tube. Centrifuge the adsorption column CP3 into the collection tube at 12,000 rpm (~13,400×g) for 1 min to remove residual wash buffer from the adsorption column. Place the adsorption column CP3 into a clean centrifuge tube, add 100 μL of elution buffer RTB to the middle of the adsorption membrane, centrifuge at 12,000 rpm (~13,400×g) for 30 seconds to collect the plasmid solution into the centrifuge tube.
[0036] 2.3 DNA linearization, DNA purification, and agarose gel electrophoresis use Sma Linearization of enzyme I was performed, and the enzyme digestion reaction system was prepared (taking a 50 uL system as an example): DNA template (plasmid) ≤1 ug, 10×QuickCut Green Buffer 5 uL, QuickCut Sma Add 1 μL of sterile water to the specified volume. After preparing the system, gently mix and briefly centrifuge, then incubate at 30°C for 5 min. Purify the DNA using a DNA purification kit. Prepare a 1% agarose gel, add nucleic acid dye and mix well. Pour the gel into a casting plate, insert a comb, and allow it to cool and solidify. Add DNA marker, negative control, non-linearized plasmid DNA, linearized DNA, and purified DNA to each well, respectively. Incubate at 80V for 60 min. Results should be visible. Figure 1 As shown.
[0037] from Figure 1It can be seen that the negative control (lane 3) had no band, the recombinant vector (lanes 4 and 7) and linearized DNA (lanes 5 and 8) had faint bands, and the purified DNA (lanes 6 and 9) had the faintest bands.
[0038] 2.4 In vitro transcription, removal of residual DNA, and RNA purification Using the purified DNA as a template, in vitro transcription was performed using the T7 transcription kit (100 μL reaction system as an example): Add the reaction components suitable for T7 RNA polymerase at room temperature to a 1.5 mL centrifuge tube. The components included: T7 Transcription 5X Buffer (20 μL), rNTPs (25 mM ATP, CTP, GTP, UTP, 7.5 μL each of the four rNTPs), DNA template (total 5-10 µg), nuclease-free water (40 μL), and Enzyme Mix (T7) (10 μL). After adding all components, gently aspirate the reaction mixture to mix thoroughly, then incubate at 37°C for 4 hours. After the in vitro transcription reaction was completed, residual DNA was immediately removed. 7 μL of RQ1 RNase-Free DNase was added to the template DNA, and the mixture was incubated at 37°C for 15 minutes. RNA purification was then performed using the Trizol method: 500 μL of TRI Reagent was added to the sample, and the mixture was incubated at room temperature for 5 minutes to allow for complete lysis. 150 μL of chloroform was added, vortexed, and incubated at room temperature for 3 minutes. The mixture was centrifuged at 12,000 rpm at 4°C for 15 minutes. The upper colorless aqueous phase containing total RNA was then transferred to a new 1.5 mL centrifuge tube, and 250 μL of the upper colorless aqueous phase was added. An equal volume of isopropanol was added to the aspirated upper colorless aqueous phase, and the mixture was inverted several times to mix. The mixture was incubated at room temperature for 10 minutes. After centrifugation at 12,000 rpm at 4°C for 10 minutes, RNA precipitate was visible at the bottom of the tube; the supernatant was discarded. 500 μL of 75% ethanol was added, vortexed, and the RNA precipitate was washed once. The mixture was centrifuged at 8000 rpm. Centrifuge at 4°C for 5 minutes and discard the supernatant. The precipitate is the extracted RNA. Let it air dry at room temperature for 10 minutes. After the RNA has dried slightly, add 50 μL of sterile water to dissolve it.
[0039] 2.5 Gradient dilution and validation of RNA samples RNA concentration was measured using a fluorometer and found to be 56.3 ng / μL. The RNA was then serially diluted with RNase-free water, with each dilution being 10⁻⁶ ng / μL. 4 times (3.76×10 9(copies / mL). RNA was validated using a West Nile Virus Nucleic Acid Detection Kit (fluorescent PCR method). 18 μL of WNV nucleic acid fluorescent PCR detection mixture, 1 μL of internal control, and 1 μL of RT-PCR enzyme were placed in a thin-walled PCR reaction tube, vortexed for a few seconds, and then briefly centrifuged for a few seconds. 20 μL of the mixture was placed in a thin-walled PCR reaction plate. Then, the treated sample (5 μL), positive control (5 μL), and DEPC-H2O (5 μL) were added to the PCR reaction plate, the PCR reaction plate was covered, and the PCR amplification reaction was immediately performed after centrifugation for a few seconds. The reaction tube was placed on a quantitative fluorescence PCR instrument, and the cycling parameters were set as follows: 45℃, 10 min; 95℃, 15 min; then 95℃, 15 sec → 60℃, 60 sec, for 40 cycles. Single-point fluorescence detection was performed at 60℃. Fluorescence channel selection: FAM and HEX2. Results are shown in [link to results]. Figure 2 As shown.
[0040] Figure 2 The results indicate that the verification was successful.
[0041] 2.6 Gradient dilution of RNA samples RNA was serially diluted using 75% ethanol as a protective agent, at a concentration of 1 × 10⁻⁶. 6 5×10 6 times (3.76×10 7 copies / mL, 7.52×10 6 (copies / mL).
[0042] 2.7 RNA extraction using magnetic beads Remove the pre-packaged reagent plate from the kit, invert and mix several times to resuspend the magnetic beads, gently shake the plate to concentrate the reagents at the bottom of the deep wells, and carefully peel off the sealing film to prevent liquid from splashing out. Add 200 μL of sample to each well, followed by 20 μL of proteinase K, and extract RNA using an automated nucleic acid extractor.
[0043] 2.8 Testing with Commercial Reagent Kits RNA was detected using a West Nile Virus Nucleic Acid Detection Kit (fluorescent PCR method). 18 μL of WNV nucleic acid fluorescent PCR detection mixture, 1 μL of internal control, and 1 μL of RT-PCR enzyme were placed in a thin-walled PCR reaction tube. The mixture was vortexed for a few seconds and then briefly centrifuged for a few seconds. 20 μL of the mixture was placed in a thin-walled PCR reaction plate. Then, 5 μL of the pre-treated sample, 5 μL of the positive control, and 5 μL of DEPC-H2O were added to the PCR reaction plate. The PCR reaction plate was covered, and after centrifugation for a few seconds, PCR amplification was immediately performed. The reaction tubes were placed on a quantitative PCR instrument, and the cycling parameters were set as follows: 45℃, 10 min; 95℃, 15 min; then 95℃, 15 sec → 60℃, 60 sec, for 40 cycles. Single-point fluorescence detection was performed at 60℃. Fluorescence channel selection: FAM and HEX2 (see...). Figure 3 ).
[0044] Dilute 5×10 6 times (7.52×10 6 The Ct value of the sample (copies / mL) was around 26.
[0045] 3. Dilution, dispensing, and storage of quality control materials Based on the above determination results, the in vitro transcribed RNA obtained in Example 1 was diluted to 7.52 × 10⁻⁶ with 75% ethanol. 7 After mixing, aliquot the reagents into 0.5 mL cryovials and store at -80°C. Amplify in vitro transcribed RNA using TaKaRa One StepPrimeScript™ III RT-qPCR Mix and pre-synthesized primers and probes (RT-qPCR primer sequences are shown in Table 1). Amplification conditions were as follows: 52°C for 5 min, 95°C for 10 sec; 95°C for 5 sec, 60°C for 30 sec, for 40 cycles. Signal acquisition was performed at 60°C, with the detection channel set to FAM. The reaction system used was as recommended by the kit.
[0046] Table 1 RT-qPCR primer sequences
[0047] 4. Validation of quality control products 4.1 Accuracy Verification Five different concentrations (C1: 7.52 × 10⁻⁶) were analyzed by quantitative real-time RT-PCR. 10 copies / mL, C2: 1.50 × 10 9 copies / mL, C3: 6.00×10 5copies / mL, C4: 3.00 × 10 7 copies / mL, C5: 7.50 × 10 3 West Nile virus in vitro transcribed RNA (copies / mL) and five negative samples were tested. The results were recorded and compared with known results. See [the table below for details]. Figure 4 As shown.
[0048] from Figure 4 As can be seen, the positive concordance rate is 100%, and the negative concordance rate is 100%.
[0049] 4.2 Inspection of different batches Two batches of quality control samples were inspected, with 5 samples in each batch, and each sample was tested twice using technical methods. Figure 5 After RNA purification, the Ct values of the quality control samples were detected using quantitative real-time RT-PCR. GraphPad Prism was used to perform t-tests on the data; no significant difference was found between the two batches of quality control samples. P > 0.05). Data in the figure is Mean ± SD, * P < 0.05,** P <0.01, *** P < 0.001, **** P < 0.0001, ns indicates no significant difference.
[0050] 4.3 Stability Test To assess the stability of the quality control samples during short-term transportation, three temperatures (-20℃, 4℃, and 25℃) were set. Three samples were randomly selected at days 3, 7, and 14, with each sample tested in triplicate. RNA was extracted using a nucleic acid extractor, and the Ct value of the quality control samples was detected using quantitative real-time RT-PCR. The results are shown below. Figure 6 A two-way ANOVA was performed on the data using GraphPad Prism, and the results showed a significant interaction between temperature and time. P = 0.0015), indicating that the stability of the quality control sample is affected by both temperature and time. The Ct values of the quality control samples varied significantly over time under different temperature conditions. The Ct values of the -20℃ group showed no significant changes at 3, 7, and 14 days, suggesting that -20℃ can effectively maintain the stability of the RNA in the quality control sample; the Ct values of the 4℃ group showed a significant difference only between 3 and 14 days (…). P < 0.01), the overall fluctuation range was much smaller than that of the 25℃ group; the Ct value of the 25℃ group increased significantly with time, and the Ct value at 14 days was significantly higher than that at 3 days and 7 days (both < 0.01). P< 0.0001 indicates severe degradation of the RNA in the quality control sample at room temperature. At the 14-day time point, the Ct value of the 25℃ group was significantly higher than that of the -20℃ and 4℃ groups ( P < 0.0001 P < 0.001), while there was no significant difference between the -20℃ and 4℃ groups, verifying the protective effect of low temperature on the RNA of the quality control sample, and the stability at -20℃ was better than that at 4℃.
[0051] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A quality control product for West Nile virus in vitro transcribed RNA, characterized in that, The West Nile virus in vitro transcribed RNA quality control was obtained by artificially synthesized recombinant vector containing some of the West Nile virus targets, after plasmid extraction, enzyme digestion and linearization, DNA purification, in vitro transcription, and RNA purification. The sequences of some targets of the West Nile virus are: partial sequences of the 5'UTR and capsid protein C binding region, partial sequences of the membrane glycoprotein precursor prM and envelope protein E binding region, partial sequences of envelope protein E, partial sequences of non-structural protein NS1, partial sequences of non-structural protein NS1 and non-structural protein NS2A binding regions, partial sequences of the NS5 gene, and partial sequences of the 3'UTR region. The partial nucleotide sequence of the 5'UTR and capsid protein C binding region of the West Nile virus partial target is shown in SEQ ID NO:1; The partial nucleotide sequence of the binding region of the membrane glycoprotein precursor prM and the envelope protein E of the West Nile virus partial target is shown in SEQ ID NO:2; The partial nucleotide sequence of the envelope protein E of the West Nile virus partial target is shown in SEQ ID NO:3; The partial nucleotide sequence of the non-structural protein NS1, a partial target of the West Nile virus, is shown in SEQ ID NO:4; The partial nucleotide sequences of the binding regions of the non-structural protein NS1 and the non-structural protein NS2A of the West Nile virus target are shown in SEQ ID NO:5; The partial nucleotide sequence of the NS5 gene, a partial target of the West Nile virus, is shown in SEQ ID NO:6; The partial nucleotide sequence of the 3'UTR region of the West Nile virus partial target is shown in SEQ ID NO:
7.
2. A recombinant vector for expressing a West Nile virus in vitro transcribed RNA quality control sample as described in claim 1, characterized in that, The recombinant vector includes: an initial vector and a partial target sequence of the West Nile virus.
3. The recombinant vector for expressing West Nile virus in vitro transcribed RNA quality control material according to claim 2, characterized in that, The recombinant vector used was the pBluescript II SK(+) plasmid as the initial vector.
4. A method for preparing a West Nile virus in vitro transcribed RNA quality control product as described in claim 1, characterized in that, Includes the following steps: After synthesizing a recombinant vector by combining a portion of the West Nile virus target with the initial vector, the vector was transferred into Escherichia coli. The resulting RNA was then extracted, linearized by enzyme digestion, purified by DNA, and transcribed in vitro to obtain a quality control sample of the West Nile virus in vitro transcribed RNA.
5. The method for preparing the West Nile virus in vitro transcribed RNA quality control product according to claim 4, characterized in that, The Escherichia coli mentioned is the Escherichia coli TOP10.
6. The method for preparing the West Nile virus in vitro transcribed RNA quality control product according to claim 4, characterized in that, The enzyme digestion linearization is as follows: Sma I enzyme linearization.
7. The method for preparing the West Nile virus in vitro transcribed RNA quality control according to claim 4, characterized in that, The in vitro transcription is followed by purification, which includes the following steps: RNA obtained from in vitro transcription was collected, residual DNA was removed, and the RNA was purified by the Trizol method to obtain purified West Nile virus in vitro transcribed RNA quality control material.
8. The method for preparing West Nile virus in vitro transcribed RNA quality control material according to claim 4 or 7, characterized in that, The concentration of the West Nile virus in vitro transcribed RNA quality control is 3.76 x 10 13 copies / mL.
9. The use of West Nile virus in vitro transcribed RNA quality control material prepared by the method of the West Nile virus in vitro transcribed RNA quality control material according to claim 1, the recombinant vector according to claim 2 or 3, or any one of claims 4-8 in the preparation of West Nile virus nucleic acid detection kits, West Nile virus detection positive controls, or West Nile virus detection quality control materials.