Application of the ubiquitin E3 ligase gene TRIM37 in inhibiting the reproductive capacity of whiteflies

Abstract

This invention discloses the application of the ubiquitin E3 ligase gene TRIM37 in inhibiting the reproductive capacity of whiteflies, belonging to the field of plant protection. This invention discovers a ubiquitin E3 ligase gene, TRIM37, in whiteflies and clarifies that knocking down the expression level of TRIM37 in whiteflies can promote the level of the transcription factor CREB protein, thereby inhibiting the transcription of the key reproductive gene Vasa, ultimately suppressing the reproductive capacity of whiteflies. This provides a theoretical and applied basis for the development and production of green biological pesticides for the control of whiteflies.

Description

Technical Field

[0001] This invention belongs to the field of plant protection and relates to the application of a ubiquitin E3 ligase gene TRIM37 in pest control, specifically the application of dsRNA of the E3 ligase gene TRIM37 in inhibiting the reproductive capacity of whiteflies. Background Technology

[0002] Ubiquitination is a common post-translational modification (PTM) that plays a fundamental role in hormone responses, growth and development, lifespan, and reproduction. In the ubiquitin-proteasome (UPS) system, E3 ubiquitin ligases are highly specific enzymes in the ubiquitination process. RING-type proteins constitute a large E3 family, possessing conserved cysteine-rich regions (40-60 residues) arranged in a specific pattern. Numerous studies have reported the important role of E3 ligases in regulating stress resistance in mammals and plants. Therefore, ubiquitin E3 ligases have great potential as novel targets in insecticide development and pest control, and the development of pest control technologies targeting E3 ligases has practical value.

[0003] CREB (cAMP Response Element-Binding protein) is an important nuclear transcription factor that can be activated by multiple signaling pathways. It serves as a crucial bridge connecting extracellular signals and gene expression, and is also a key regulatory protein with diverse functions. In insects, its functions are prominently manifested in learning and memory, immunity, and stress responses. In reproduction, it is deeply involved in multiple core processes, from gamete formation and hormone integration to the regulation of reproductive behavior, serving as a vital molecular hub connecting environmental signals, internal physiological states, and successful reproduction.

[0004] The Vasa gene is involved in a series of early oogenesis events, including GSC differentiation, cyst stem cell differentiation, oocyte formation, and ovum formation, serving as one of the "command centers" for germline development. Through precise posttranscriptional regulation, it coordinates the complex process from gamete formation to the production of healthy offspring. Its indispensable function and high conservation make it irreplaceable in both basic research and applied fields. Knockdown or knockout of Vasa in Drosophila can cause mutants to exhibit reduced germ cell numbers, abnormal oocyte development, ovarian developmental defects or malformations, decreased female fertility, or infertility, demonstrating the crucial role of the oogenesis gene Vasa in maintaining insect fertility.

[0005] The tobacco whitefly (Bemisia tabaci), belonging to the genus Bemisia of the family Aleyrodidae in the order Hemiptera, is a global "super pest" that damages a wide variety of vegetables, flowers, and horticultural crops. First discovered on tobacco in Greece in 1998, it has since been found in many countries and regions worldwide. Due to its wide host range (over 600 species), rapid reproduction, high population explosion potential, strong invasiveness, transmission of various plant viruses, and susceptibility to pesticide resistance, it has been listed as the "second largest plant pest in the world" by the Food and Agriculture Organization of the United Nations (FAO). However, the overuse of pesticides has led to increasingly serious pesticide resistance in tobacco whiteflies, which is spreading rapidly globally. Based on these findings, this invention aims to explore a method for regulating the reproductive development of tobacco whiteflies to control them through a green biological approach. Summary of the Invention

[0006] Based on the above problems, this invention aims to provide an application of the ubiquitin E3 ligase gene TRIM37 in pest control, especially in inhibiting the reproductive capacity of whiteflies. By knocking down the expression level of TRIM37 in whiteflies, the transcription factor CREB protein level can be promoted, thereby inhibiting the transcription of the key reproductive gene Vasa, and ultimately inhibiting the reproductive capacity of whiteflies. The effect is significant, providing a theoretical and applied basis for the development and production of green biological pesticides for the control of whiteflies.

[0007] First, the present invention provides a ubiquitin E3 ligase gene TRIM37 and dsTRIM37 containing its gene interference fragment.

[0008] The ubiquitin E3 ligase gene TRIM37 was retrieved online using the Whitefly Genome Database (http: / / www.whiteflygenomics.org / cgi-bin / bta / index.cgi), and the nucleotide sequence of the TRIM37 gene is shown as Gene ID Bta11294.

[0009] This invention provides an application of dsRNA in pest control, wherein the dsRNA is dsTRIM37, and its nucleotide sequence is shown in SEQ ID No. 5.

[0010] Furthermore, the application is in the suppression of the reproductive capacity of female whiteflies.

[0011] Preferably, the application involves feeding or injecting female whiteflies with dsTRIM37, a double-stranded RNA containing a TRIM37 interfering fragment, to inhibit their reproductive capacity.

[0012] Furthermore, the inhibition of the reproductive capacity of female whiteflies is achieved by: inhibiting ovarian development in female whiteflies, reducing the number of oviducts, the number of eggs, and / or the total number of eggs laid in female whiteflies.

[0013] The method of feeding dsTRIM37 is as follows: feed the whiteflies with a feeding solution containing double-stranded RNA containing the interfering fragment, namely dsTRIM37.

[0014] Meanwhile, the present invention also provides a method for controlling pests, wherein the pest is the whitefly, and the reproductive capacity of the whitefly is inhibited by suppressing the expression level of TRIM37 in the whitefly.

[0015] Preferably, the method is achieved by administering dsRNA targeting the ubiquitin E3 ligase gene TRIM37.

[0016] The present invention also provides the application of the ubiquitin E3 ligase gene TRIM37 in the preparation of an insecticide, wherein the drug comprises an interference fragment of the TRIM37 gene.

[0017] Furthermore, the application of the E3 ligase gene TRIM37 as a target in the preparation of insecticides, specifically targeting the whitefly.

[0018] The application of the ubiquitin E3 ligase gene TRIM37 described in this invention in entomological research and pest control.

[0019] The application of the E3 ligase gene TRIM37 as a target in the development of insecticide drugs, as described in this invention.

[0020] This invention discovered a whitefly ubiquitin E3 ligase gene, TRIM37, and clarified that knocking down the expression level of TRIM37 in whiteflies can promote the increase of transcription factor CREB protein levels, thereby inhibiting the transcription of the key reproductive gene Vasa and ultimately suppressing the reproductive capacity of whiteflies. This provides a theoretical and applied basis for the development and production of green biological pesticides for the control of whiteflies. The functional products related to the E3 ligase gene TRIM37 described in this invention can be applied to: 1) pest control; 2) pest reproductive capacity management; and 3) drug design and development as insecticide targets.

[0021] Those skilled in the art will recognize that certain modifications can be made to this invention without departing from the concept or scope of the invention.

[0022] The following embodiments further illustrate the present invention in detail, but should not be construed as limiting the scope of the present invention or the specific methods described herein. Attached Figure Description

[0023] Figure 1This image shows the gene structure diagram and conserved domain analysis results of the ubiquitin E3 ligase gene TRIM37. In the diagram, A shows the gene structure diagram of TRIM37 obtained from cloning, and B shows the predicted conserved domains of TRIM37.

[0024] Figure 2 The expression level of TRIM37 gene in whiteflies after knockdown of the ubiquitin E3 ligase gene TRIM37 was shown.

[0025] Figure 3 This study aimed to analyze the protein expression level and fluorescence signal of Vasa in the whitefly after knockdown of the ubiquitin E3 ligase gene TRIM37. In diagram A, the protein expression levels of TRIM37, Vasa, and β-actin in the whitefly after knockdown of the ubiquitin E3 ligase gene TRIM37 are shown. In diagram B, the fluorescence signal level of Vasa in the whitefly after knockdown of the ubiquitin E3 ligase gene TRIM37 is shown.

[0026] Figure 4 This study aimed to detect the reproductive phenotype of whiteflies after knocking down the ubiquitin E3 ligase gene TRIM37. Image A shows the number of oviducts and eggs in whiteflies on day 3 after TRIM37 knockdown; image B shows the number of eggs and oviducts in whiteflies on day 7 after TRIM37 knockdown; image C shows the number of eggs on days 3 and 7 after TRIM37 knockdown; image D shows the cumulative oviposition of whiteflies over 12 days after TRIM37 knockdown; and image E shows the total oviposition of whiteflies over 12 days after TRIM37 knockdown.

[0027] Figure 5 The effect of the ubiquitin E3 ligase gene TRIM37 on the protein level of transcription factor CREB was investigated. In the figures, A shows the immunoprecipitation of TRIM37 and CREB proteins; B shows the protein expression levels of TRIM37, CREB, and β-actin after TRIM37 knockdown; and C shows the protein expression levels of phosphorylated CREB protein, total CREB protein, and β-actin after feeding with a 50 μM proteasome inhibitor (MG132).

[0028] Figure 6 The effect of CREB knockdown on Vasa gene abundance in whiteflies was investigated. In the figures, A represents CREB interference efficiency; B represents Vasa gene expression level after CREB knockdown; C represents protein expression levels of phosphorylated CREB protein, total CREB protein, Vasa protein, and β-actin after CREB knockdown; and D represents Vasa fluorescence signal level after CREB knockdown.

[0029] Figure 7This study aimed to detect the reproductive phenotype of whiteflies after CREB knockdown. Image A shows the number of oviducts and eggs in whiteflies on day 3 after CREB knockdown; image B shows the number of oviducts and eggs in whiteflies on day 7 after CREB knockdown; image C shows the number of eggs on days 3 and 7 after CREB knockdown; image D shows the cumulative oviposition of whiteflies over 12 days after CREB knockdown; and image E shows the total oviposition of whiteflies over 12 days after CREB knockdown. Detailed Implementation

[0030] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention.

[0031] Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but such modifications and substitutions all fall within the protection scope of the present invention.

[0032] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0033] Unless otherwise specified, all reagents and materials used in the following examples were obtained commercially.

[0034] Explanation of the source of experimental materials used in the following examples:

[0035] Trizol reagent: purchased from Merck Sigma-Aldrich.

[0036] cDNA reverse transcription kit: purchased from TaKaRa;

[0037] PCR product recovery kit: purchased from New England Biolabs;

[0038] Promega Product Recovery Kit: Purchased from PROMEGA Corporation;

[0039] Real-time PCR kit: purchased from Beijing Tiangen Biotech Co., Ltd.;

[0040] dsRNA Synthesis Kit T7: Purchased from PROMEGA;

[0041] Total protein extraction kit: purchased from Beyotime.

[0042] SDS-PAGE loading buffer: purchased from CWBIO.

[0043] BCA protein quantification kit: purchased from Beyotime.

[0044] 4-15% SDS-PAGE preform: purchased from Lablead Biotech;

[0045] PVDF membrane: purchased from Merck Millipore;

[0046] IgG-HRP secondary antibody: purchased from CWBIO.

[0047] SuperSignal West Pico chemiluminescent substrate: purchased from Thermo Fisher;

[0048] Rabbit polyclonal antibodies against TRIM37, CREB, Vasa protein, and phosphorylated P-CREB are all synthesized peptides based on specific amino acid sequences or obtained commercially.

[0049] β-actin (1:5000): purchased from Abcam.

[0050] Immunostaining blocking buffer kit: purchased from Beyotime.

[0051] DAPI: Purchased from Abcam.

[0052] Leica tissue paraffin standard kit: purchased from Leica Biosystems;

[0053] Immunoprecipitation kit: purchased from Beaver.

[0054] The primers used in the examples were all synthesized by Qingke Biotechnology Co., Ltd.

[0055] The MED whitefly population involved in the examples was collected from cucumbers in Changping, Beijing in 2019.

[0056] Example 1: Cloning and reproductive correlation analysis of TRIM37.

[0057] The ubiquitin E3 ligase gene TRIM37 was retrieved online using the Whitefly Genome Database (http: / / www.whiteflygenomics.org / cgi-bin / bta / index.cgi), and the sequence of dsTRIM37 is shown as Gene ID Bta11294. The full-length sequence of the TRIM37 gene was obtained through molecular cloning based on the Whitefly Genome Database.

[0058] The CDS nucleotide sequence of the ubiquitin E3 ligase gene TRIM37 is shown in SEQ ID No. 1, and the encoded amino acid sequence is shown in SEQ ID No. 2. Gene structure mapping and conserved domain analysis of the TRIM37 sequence were performed, and the results are as follows: Figure 1 As shown. The TRIM37 gene is 2625 bp in length and contains 18 exons and 17 introns. Figure 1 TRIM37 (SEQ ID No. 2), encoding 874 amino acids, has a protein size of 98.89 kDa. The TRIM37 amino acid sequence contains five conserved domains: RING (Really Interesting New Gene), Bbox (B-box type zinc finger superfamily), CC-brat like (coil-and-coil CC domain), MATH (meprin and TRAF-C homology domain)... Figure 1 (B)

[0059] Example 2: Knockdown of TRIM37 expression levels

[0060] I. Synthesis of dsRNA.

[0061] Design specific interference primers with the T7 adapter (RNA polymerase promoter sequence). The primer sequence is as follows: dsTRIM37-F: TAATACGACTCACTATAGG AATGCTGTAAAAGGTAGCTCTTCA (SEQ ID No. 3).

[0062] dsTRIM37-R: TAATACGACTCACTATAGG ACTATCACTAAATGTTGGACTGGC (SEQ ID No. 4).

[0063] 2) Place the whitefly sample in a 1.5 mL centrifuge tube on ice, add 1 mL of Trizol reagent, add two sterilized steel balls, and grind in an automated grinder at low temperature for 30 s. Repeat 4-6 times.

[0064] 3) Place the ground sample on ice and let it stand for 5 minutes to allow the nucleic acid to separate. Add 200 μL of chloroform.

[0065] 4) The above samples were placed in a pre-cooled centrifuge at 4°C and centrifuged at 12,000 rpm for 15 min.

[0066] 5) Slowly remove the sample, carefully pipette 400 μL of supernatant into a new 1.5 mL centrifuge tube, add 400 μL of isopropanol, invert and mix until the oily substance disappears, and place on ice for 10-30 min.

[0067] 6) After the ice bath, the sample was placed in a centrifuge at 4°C and centrifuged at 12,000 rpm for 10 min.

[0068] 7) Remove the sample, discard the supernatant, add 1 mL of 75% ethanol to wash the precipitate, and place it in a centrifuge at 4℃, centrifuge at 8000 rpm for 5 min.

[0069] 8) Discard the supernatant, let stand for 2 minutes to allow the alcohol to evaporate, and when the total RNA precipitate from the whiteflies at the bottom of the centrifuge tube is translucent, add 10-20 μL of enzyme-free sterile water and place the RNA on ice.

[0070] 9) After the total RNA has been fully dissolved, measure the concentration using a NanoDrop 2000c. The OD260 / OD280 ratio should be between 1.9 and 2.0, and the OD260 / OD230 ratio should be between 1.8 and 2.0.

[0071] 10) The first-strand cDNA was synthesized using the PrimeScript® RT reagent Kit (TaKaRa). The obtained whitefly first-strand cDNA was used as a template to clone the TRIM37 target interference fragment, which was then excised and recovered. The recovered DNA product was used to synthesize TRIM37 dsRNA (as shown in SEQ ID No. 5) using the Promega RNA Double-Strand Synthesis Kit for later use.

[0072] Meanwhile, dsRNA synthesized with green fluorescent protein (GFP) (dsGFP) was used as a control group for subsequent RNA interference (RNAi) experiments.

[0073] II. RNAi: RNA interference in adult whiteflies via feeding.

[0074] The synthesized dsTRIM37 and dsGFP double strands were prepared into a 0.5 μg / L interference feeding solution (30% sucrose + 5% yeast powder). A 60 μL interference feeding layer was prepared at one end of a glass tube, and 80-100 adult whiteflies were placed inside. The other end was sealed with Parafilm, and after making ventilation holes, a black tube sleeve was placed inside. The end with the interference feeding solution was placed flat facing the light. The interference was carried out in a greenhouse, and the insects were collected every 24 h after feeding for subsequent experiments.

[0075] III. qRT-PCR.

[0076] The relative expression level of TRIM37 in surviving whiteflies was detected by qPCR. The specific steps were as follows: RNA was extracted and cDNA was obtained by reverse transcription for qRT-PCR quantitative detection of TRIM37 expression. The treatment group was a TRIM37 interference group, and the control group was an EGFP interference group. Each treatment was performed in triplicate. The interference efficiency was calculated as: (TRIM37 expression level in control group - TRIM37 expression level in treatment group) / TRIM37 expression level in control group × 100%.

[0077] The qPCR detection results of the TRIM37 gene are as follows: Figure 2 As shown. By Figure 2 It was found that after feeding on dsTRIM37 for 24 hours, the expression level of TRIM37 in whiteflies was significantly reduced to 0.39 times that of the control group.

[0078] The above results indicate that feeding the target gene dsRNA for 24 hours successfully knocked down the expression level of TRIM37 in whiteflies.

[0079] Example 3: Verification of the effect of TRIM37 knockdown on the reproductive capacity of whiteflies

[0080] I. Detecting Vasa abundance after TRIM37 knockdown, the specific steps are as follows:

[0081] After feeding whiteflies with dsTRIM37 / dsEGFP for 24 h, 200 adult whiteflies were treated per sample. Protein extraction was performed using the ProteinExt mammalian total protein extraction kit according to the manufacturer's instructions. The protein extract was replenished with SDS-PAGE loading buffer, and the concentration was determined using a BCA protein quantification kit. The extract was then denatured by boiling at 100°C for 8-10 minutes. Further Western blot analysis was performed: proteins were separated by 4-15% SDS-PAGE pre-cast gel electrophoresis and transferred to PVDF membranes. The PVDF membranes containing the target proteins were incubated overnight at 4°C with rabbit polyclonal antibody, followed by the addition of goat anti-rabbit IgG-HRP secondary antibody (1:5000). The levels of TRIM37, Vasa, and β-actin were detected using SuperSignal West Pico chemiluminescent substrates, and images were acquired using a Tanon-5200 chemiluminescence imaging system (Tanon). TRIM37 (1:5000) and Vasa (1:5000) proteins were used as rabbit polyclonal antibodies. β-actin (Abocon, 1:5000) antibody was used as an internal control primary antibody.

[0082] Immunofluorescence assay: The ovaries and midgut tissues of female adult whiteflies were meticulously dissected using a Leica microscope. Samples were permeated with 75% ethanol for 25 minutes and then fixed in 4% paraformaldehyde (PFA) solution at room temperature for 2.5 hours. After three washes with PBST buffer, the samples were blocked at 4°C for 3 hours using an immunostaining blocking buffer kit, followed by overnight incubation at 4°C with 1:600 ​​diluted Vasa-specific primary antibody. The samples were then placed in a light-protected container and incubated at room temperature for 2 hours with Alexa Fluor® 555 goat anti-rabbit IgG secondary antibody (1:500), followed by five washes with PBST. Ovarian samples were fixed on adhesive slides and stained with DAPI counterstain at room temperature. Fluorescence images were acquired using a Leica LSM 980 confocal microscope at 10x magnification, with high-resolution images taken at 20x magnification.

[0083] The abundance results of Vasa after TRIM37 was knocked down are as follows: Figure 3 As shown. By Figure 3 It can be seen that when TRIM37 is knocked down, the content of Vasa protein in whiteflies decreases significantly. Figure 3 Immunofluorescence results showed a significant decrease in Vasa protein signaling on whitefly eggs (A). Figure 3 (B) The above results indicate that the decrease in TRIM37 expression significantly suppressed the abundance of the reproductive gene Vasa in the whitefly.

[0084] II. Phenotypic detection of the reproductive capacity of whiteflies after TRIM37 knockdown, the specific steps are as follows:

[0085] Oviduct and oocyte counts: Whiteflies were fed dsTRIM37 / dsEGFP for 24 hours after emergence. Only female individuals were selected for day 3 and day 7 reproductive assessments and ovarian development analysis. Adult female whiteflies were transferred to centrifuge tubes and anesthetized on ice for 30 minutes. The ovaries of each female were dissected in 0.1M phosphate-buffered saline (PBS, pH 7.2). The number of tubules and oocytes in each female's ovary was counted using the Leica tissue paraffin standard kit. Oocyte counts were photographed using a Leica microscope at different treatment stages or under different treatment conditions. Images were taken at 100x magnification. Additionally, at least 60 adult females in each treatment group were examined.

[0086] Total oviposition assessment: Whiteflies were fed dsTRIM37 / dsEGFP for 24 hours after emergence. A total of 120 individuals (male and female) were placed in the same test tube and mated for 4 hours. Females were then randomly selected and placed in centrifuge tubes (5 ml). Fresh cotton leaves were replaced daily for 12 days. Oviposition counts were recorded daily using a 20x microscope. At least four groups of 60 females were measured in each treatment group (replicated samples).

[0087] The reproductive phenotype of whiteflies after TRIM37 knockdown is as follows: Figure 4 As shown. By Figure 4 It was found that when TRIM37 was knocked down, the number of oviducts in whiteflies decreased by 23% and the number of eggs decreased by 17% on day 3. Figure 4 (A); On day 7, the number of oocytes decreased by 23%, and the number of oocytes decreased by 21%. Figure 4 (B) Ovarian autopsy results of whiteflies showed a decrease in the number of oocytes on days 3 and 7 after TRIM37 knockdown. Figure 4 (C) 12-day cumulative fertility reduction ( Figure 4 (D), and the total number of eggs laid decreased by 29% ( Figure 4 (E). The above results indicate that decreased TRIM37 expression significantly inhibited the reproductive capacity of whiteflies.

[0088] Example 4: Verify the effect of TRIM37 on the protein level of transcription factor CREB.

[0089] I. Verifying the interaction between TRIM37 and CREB

[0090] Immunoprecipitation (Co-IP) experiment: Total protein from whiteflies was extracted using the ProteinExt Mammalian Total Protein Extraction Kit, following the manufacturer's instructions. TRIM37 and Vasa proteins were extracted from the total protein sample using immunoprecipitation, according to the kit guidelines. The specific steps were as follows: Equal volumes of total protein from adult whiteflies were mixed with the target protein-specific antibody and incubated overnight at 4°C. Subsequently, the sample was incubated with A / G magnetic beads from the kit for 3 hours. The sample was then washed five times with 1×PBS and centrifuged at 2500 rpm for 10 minutes at 4°C to remove the supernatant. The agarose suspension containing the immune complex was washed with NP-40 lysis buffer to remove unbound proteins. The precipitated protein was eluted three times with glycine, incubating for 10 minutes each time with frequent mixing, followed by gentle centrifugation. The elution buffer was neutralized by adding an equal volume of Tris buffer at pH 8.0. The magnetic beads were washed twice with lysis buffer before being combined with the elution buffer for neutralization. Then, Western blot analysis was performed to identify the target protein in the precipitate, with IgG antibody used as a negative control.

[0091] The results of the immunoprecipitation of TRIM37 protein and CREB protein are as follows: Figure 5 As shown in Figure A: TRIM37 and CREB can interact directly in the body of adult whiteflies.

[0092] II. After TRIM37 is knocked down, the CREB protein level is detected. The specific steps are as follows:

[0093] After feeding whiteflies dsTRIM37 / dsEGFP for 24 h, 200 adult whiteflies were treated per sample. Protein extraction and Western blot were performed as described in Example 3. TRIM37 (1:5000), CREB (1:2500), and the phosphorylated form of CREB, p-CREB (1:2000), were used as rabbit polyclonal antibodies. β-actin (Ebopro, 1:5000) antibody was used as an internal control primary antibody.

[0094] The results of CREB protein level detection after TRIM37 knockdown are as follows: Figure 5 As shown in Figure B: After TRIM37 was knocked down, the content of phosphorylated CREB protein and total protein in whiteflies decreased significantly.

[0095] III. Detection of CREB via the proteasome pathway, the specific steps are as follows:

[0096] After feeding whiteflies 50 μM MG132 proteasome inhibitor for 24 h (CK was the control group fed with the same concentration of DMSO), 200 adult whiteflies were treated for each sample. Protein extraction and Western blot were performed as described in Example 3.

[0097] The experimental results of CREB's MG132 inhibitor are as follows: Figure 5 As shown in Figure C: After treatment with the proteasome inhibitor MG132, the content of total CREB protein and phosphorylated protein in adult whiteflies increased significantly.

[0098] The above results indicate that the ubiquitin E3 ligase TRIM37 directly targets the transcription factor CREB and degrades CREB via the proteasome pathway. Treatment with dsTRIM37 significantly increased the CREB protein level in adult whiteflies.

[0099] Example 5: Verification of the effect of knockdown of transcription factor CREB on the reproductive capacity of whiteflies.

[0100] I. Vasa abundance was detected after CREB was knocked down. The specific steps are as follows:

[0101] After feeding whiteflies dsCREB / dsEGFP for 24 h: qRT-PCR was used to detect the mRNA expression levels of CREB and Vasa genes, and the RNAi and qRT-PCR methods were the same as described in Example 2; Western blot was used to detect the protein levels of CREB and Vasa, and the protein extraction and Western blot methods were the same as described in Example 3; the ovaries of female adult whiteflies were dissected, and the methods were the same as described in Example 3; the Vasa protein signal was detected by immunofluorescence, and the immunofluorescence method was the same as described in Example 3.

[0102] Vasa abundance results after CREB was knocked down are as follows: Figure 6 As shown. By Figure 6 It was found that 24 hours after ingestion of dsCREB, the expression level of CREB in whiteflies was significantly reduced to 0.27 times that of the control group. Figure 6 (A); When CREB was knocked down, the expression level of the Vasa gene mRNA in whiteflies was significantly lower than that in the control group. Figure 6 (B) and protein content ( Figure 6 The C-value was significantly increased; immunofluorescence results showed that after CREB was knocked down, the Vasa protein signal on whitefly eggs was significantly increased. Figure 6 (D). The above results indicate that the decrease in the expression level of transcription factor CREB significantly enhanced the abundance of the reproductive gene Vasa in the whitefly.

[0103] II. Phenotypic detection of whitefly reproductive capacity after CREB knockdown, the specific steps are as follows:

[0104] After knocking down CREB: the number of oviducts and eggs were detected on days 3 and 7, and the number of whitefly eggs was photographed on days 3 and 7; the number of eggs laid by female whiteflies and the total number of eggs laid were detected over 12 consecutive days. The methods for detecting the number of oviducts and eggs were the same as those described in Example 3; the method for assessing the total number of eggs was the same as that described in Example 3.

[0105] The reproductive phenotype of whiteflies after CREB knockdown was as follows: Figure 7 As shown. By Figure 7 It can be seen that when CREB was knocked down, the number of oocytes in whiteflies increased by 13% on day 3, and the number of eggs increased by 13%. Figure 7 (A); On day 7, the number of ovarian follicles increased by 11%, and the number of ovaries increased by 12%. Figure 7 (B) Dissection of the whitefly ovaries showed that knocking down CREB increased the number of oocytes. Figure 7 (C) 12-day cumulative fertility increases ( Figure 7 (D), and the total number of eggs laid increased by 25% ( Figure 7 (E). The above results indicate that decreased CREB expression significantly promotes the reproductive capacity of whiteflies.

[0106] The results of Examples 1-5 above indicate that knocking down the expression level of TRIM37 in the whitefly can inhibit the transcription of the key reproductive gene Vasa by promoting the level of the transcription factor CREB protein, thereby ultimately suppressing the whitefly's reproductive capacity. This demonstrates that dsTRIM37 can inhibit the reproductive capacity of the whitefly.

Claims

1. An application of dsRNA in pest control, characterized in that: The dsRNA is dsTRIM37, and its nucleotide sequence is shown in SEQ ID No. 5; the application is in the inhibition of the reproductive capacity of female whiteflies.

2. The application as described in claim 1, characterized in that: The inhibition of female whitefly reproductive capacity is achieved by: inhibiting ovarian development in female whiteflies, reducing the number of oviducts, the number of eggs, and / or the total number of eggs laid in female whiteflies.

3. The application as described in claim 1 or 2, characterized in that: The method involves feeding or injecting dsTRIM37 into the whiteflies to inhibit their reproductive capacity.

4. The application as described in claim 3, characterized in that: The reproductive capacity of female whiteflies is inhibited by feeding them dsTRIM37.

5. The application as described in claim 4, characterized in that: The method of feeding dsTRIM37 is as follows: feed the whiteflies with a feeding solution containing double-stranded RNA containing the interfering fragment, namely dsTRIM37.

6. A method for controlling pests, characterized in that: The pest is a female whitefly. By feeding or injecting female whiteflies with dsRNA, the reproductive capacity of female whiteflies is inhibited by suppressing the expression level of TRIM37 in their bodies. The dsRNA is dsTRIM37, and its nucleotide sequence is shown in SEQ ID No.

5.

7. The application of a dsRNA containing an interference fragment of the ubiquitin E3 ligase gene TRIM37 in the preparation of an insecticide, wherein the dsRNA is dsTRIM37, the nucleotide sequence of which is shown in SEQ ID No. 5, the pest being a female whitefly, and the application being the use of inhibiting the reproductive capacity of the female whitefly.

Images