A method for creating low-cadmium accumulation wheat seeds by using transporter gene TaNamp1

Abstract

The application discloses a method for creating wheat with low cadmium accumulation in grains by using a transporter gene TaNramp1. TaNramp1A, TaNramp1B and TaNramp1D The application discloses a nucleic acid sequence of a coding region, a coded protein sequence, further discloses application of biological materials related to the gene, and finally discloses a method for creating wheat with low cadmium accumulation in grains by using the gene. It is found that overexpression of TaNramp1B can reduce the transfer of cadmium from wheat roots to the aboveground part, causes the cadmium content in the wheat roots to increase and the cadmium content in the aboveground part to decrease in a seedling stage water culture experiment, and causes the cadmium content in the wheat grains to significantly decrease in a soil culture experiment, and does not affect the yield and other agronomic characters of the wheat. The application can create new germplasm of wheat with low cadmium accumulation in grains by overexpressing the TaNramp1 gene.

Description

Technical Field

[0001] This invention belongs to the field of plant breeding and biotechnology, specifically relating to a method utilizing transport protein genes. TaNramp1 A method for developing wheat with low cadmium accumulation in grains. Background Technology

[0002] When farmland soil is severely contaminated with cadmium, cadmium in the soil can easily cross the soil-plant barrier and accumulate in the edible parts of crops, threatening human health through the food chain. Understanding the mechanisms of cadmium accumulation and translocation in crops will provide a theoretical basis for safe, high-yield, and stable crop breeding. Currently, there is considerable research on the molecular mechanisms of cadmium absorption and translocation in rice. Several key genes controlling cadmium accumulation and translocation in rice have been cloned and analyzed, and used to create low-cadmium-accumulating rice germplasm. For example, the OsNramp5 gene, responsible for cadmium absorption in rice, is a major gene for cadmium absorption and has been used to create low-cadmium rice varieties. Low-cadmium-accumulating rice varieties with loss of OsNramp5 gene function through mutagenesis have begun to be promoted. Compared with rice, wheat grain cadmium safety standards are more stringent, and grain cadmium levels are more likely to exceed the limit. Furthermore, research on the molecular mechanisms of cadmium absorption and translocation in wheat is limited; only a few genes responsible for cadmium translocation have been cloned and analyzed, greatly restricting the innovation of low-cadmium wheat germplasm.

[0003] Studies have found that wheat's cadmium absorption capacity is much lower than that of rice, but the absorbed cadmium is more easily transferred to the aboveground parts, indicating differences in the molecular mechanisms of cadmium absorption and transport between the two. The major genes responsible for cadmium absorption and transport may also be different. It remains unclear whether homologous genes in the wheat genome are also involved in cadmium absorption in wheat. Due to the lack of key information such as protein cadmium transport activity, tissue and cellular distribution and subcellular localization of proteins, and the cadmium absorption phenotype of mutants, it is impossible to determine the function of wheat transport proteins in wheat cadmium absorption.

[0004] in particular TaNramp1 Current technology only provides preliminary observations of how gene expression is affected by certain conditions, and there are no reports on its actual function in cadmium transport. This lack of understanding of the function of key genes has become a bottleneck for the targeted creation of low-cadmium wheat varieties using molecular techniques. Summary of the Invention

[0005] The purpose of this invention is to address the shortcomings of existing technologies by providing a method that utilizes transport protein genes. TaNramp1 A method for developing wheat with low cadmium accumulation in grains.

[0006] The technical solution adopted by this invention to solve its technical problem is:

[0007] In a first aspect, this invention discloses a transporter protein gene. TaNramp1 Applications in (A1)-(A3) below: (A1) Application in reducing cadmium accumulation in wheat grains; (A2) Application in the preparation of products that reduce cadmium accumulation in wheat grains; (A3) Application in the creation of new wheat germplasm with low cadmium accumulation in grains; The transporter protein gene TaNramp1 Selected from three alleles TaNramp1A , TaNramp1B and TaNramp1D At least one of them ， The TaNramp1A , TaNramp1B and TaNramp1D The CDS sequences are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively; The application uses genes TaNramp1 This is achieved by overexpressing the target wheat.

[0008] Secondly, this invention protects transport protein genes. TaNramp1 The encoded transporter TaNramp1 is used in the following (A1)-(A3): (A1) Application in reducing cadmium accumulation in wheat grains; (A2) Application in the preparation of products that reduce cadmium accumulation in wheat grains; (A3) Application in the creation of new wheat germplasm with low cadmium accumulation in grains; The amino acid sequence of the transporter protein TaNramp1 is selected from at least one of SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6; The application uses genes TaNramp1 This is achieved by overexpressing the target wheat.

[0009] Among them, genes TaNramp1A The encoded protein TaNramp1A has the amino acid sequence shown in SEQ ID NO: 4.

[0010] Among them, genes TaNramp1B The encoded protein TaNramp1B has the amino acid sequence shown in SEQ ID NO: 5.

[0011] Among them, genes TaNramp1D The encoded protein TaNramp1D has the amino acid sequence shown in SEQ ID NO: 6.

[0012] Thirdly, this invention protects genes containing transport proteins. TaNramp1 The recombinant vector is used in the following applications (A1)-(A3): (A1) Application in reducing cadmium accumulation in wheat grains; (A2) Application in the preparation of products that reduce cadmium accumulation in wheat grains; (A3) Application in the creation of new wheat germplasm with low cadmium accumulation in grains; The transporter protein gene TaNramp1 Selected from three alleles TaNramp1A , TaNramp1B and TaNramp1D At least one of them ， The TaNramp1A , TaNramp1B and TaNramp1D The CDS sequences are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 respectively.

[0013] In specific implementation schemes, the backbone vector of the vector is not specifically limited, as long as it is a vector known to those skilled in the art that can achieve the purpose of the present invention, including but not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage, etc.), granules (i.e., Cosmids), Ti plasmids, or viral vectors, etc. More specifically, it can be... pTCK303.

[0014] Fourthly, the present invention also protects genes containing transport proteins. TaNramp1 The recombinant microorganisms are used in the following (A1)-(A3): (A1) Application in reducing cadmium accumulation in wheat grains; (A2) Application in the preparation of products that reduce cadmium accumulation in wheat grains; (A3) Application in the creation of new wheat germplasm with low cadmium accumulation in grains; The transporter protein gene TaNramp1 Selected from three alleles TaNramp1A , TaNramp1B and TaNramp1D At least one of them ， The TaNramp1A , TaNramp1B and TaNramp1D The CDS sequences are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 respectively.

[0015] Fifthly, the present invention also protects the use of recombinant microorganisms containing the recombinant vector described above in the following (A1)-(A3): (A1) Application in reducing cadmium accumulation in wheat grains; (A2) Application in the preparation of products that reduce cadmium accumulation in wheat grains; (A3) Application in the creation of new wheat germplasm with low cadmium accumulation in grains; The application involves using genes containing transport proteins. TaNramp1 This was achieved by overexpressing the recombinant vector in the target wheat. The transporter protein gene TaNramp1 Selected from three alleles TaNramp1A , TaNramp1B and TaNramp1D At least one of them ， The TaNramp1A , TaNramp1B and TaNramp1D The CDS sequences are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 respectively.

[0016] In a specific implementation plan, the microorganism is a fungus or a bacterium.

[0017] In a specific implementation plan, the fungus may be yeast, filamentous fungus, etc.

[0018] In a specific implementation plan, the bacteria may be Agrobacterium, Bacillus, Escherichia coli, etc., specifically Agrobacterium GV3101.

[0019] Sixthly, the present invention protects a method for reducing cadmium accumulation in wheat grains, said method by increasing the concentration of transporter protein genes in the target wheat. TaNramp1 The expression level of the transporter gene is used to achieve this. TaNramp1 Selected from three alleles TaNramp1A , TaNramp1B and TaNramp1D At least one of them ， The TaNramp1A , TaNramp1B and TaNramp1D The CDS sequences are shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 respectively.

[0020] In a specific implementation scheme, the method involves passing genes TaNramp1 The goal is to transfer the wheat to the target wheat.

[0021] This invention conducted subcellular localization studies on TaNramp1A, TaNramp1B, and TaNramp1D proteins and found that they are located on the plant cell membrane and are membrane transport proteins.

[0022] This invention investigated the ion transport activity of TaNramp1A, TaNramp1B, and TaNramp1D proteins and found that they possess manganese and cadmium ion transport activity.

[0023] This invention obtains TaNramp1BHomozygous transgenic lines overexpressing the gene. Using transgenic overexpression functional assays, two overexpressing lines were obtained using spring wheat Fielder as the transformation background. TaNramp1B Transgenic homozygous strains of the gene.

[0024] This invention also utilizes CRISPR Cas9 gene editing technology to knock out three alleles of TaNramp1. When constructing the CRISPR Cas9 knockout vector, [the following was selected]. TaNramp1 The forward nucleotide sequence of one target site in the gene coding region is 5'→3', as shown in SEQ ID NO: 7; the forward nucleotide sequence of another target site is 5'→3', as shown in SEQ ID NO: 8; and three homozygous sequences were obtained. TaNramp1 Gene knockout mutant lines, among which TaNramp1A, TaNramp1B and TaNramp1D See mutation types Figure 4 .

[0025] This invention determines wild-type and knockout TaNramp1 Genetic mutants and TaNramp1B The absorption and transport of cadmium in overexpressing homozygous transgenic lines under hydroponic conditions during the seedling stage was observed, and knockout was found to be effective. TaNramp1 The gene slightly increased the cadmium content in wheat roots and aboveground parts, proving... TaNramp1 The gene does not participate in cadmium absorption in wheat. However, overexpression... TaNramp1B The gene significantly reduced the translocation of cadmium from wheat roots to the aboveground parts, resulting in a significant decrease in cadmium content in the aboveground parts and a significant increase in cadmium content in the roots.

[0026] This invention measures knockout TaNramp1 Genetic mutants and TaNramp1B The accumulation of cadmium in wheat grains and agronomic traits of overexpressing homozygous transgenic lines under pot culture conditions in acidic and alkaline cadmium-contaminated soils were studied. Two findings were observed in alkaline soils. TaNramp1B The cadmium content in the grains of the overexpressing transgenic homozygous lines was reduced by 39% and 72%, respectively, while in acidic soils, the cadmium content was significantly lower. TaNramp1B The cadmium content in the grains of the overexpressing transgenic homozygous lines was reduced by 36% and 32%, respectively. In both soil types, the agronomic traits such as plant height and yield of the two overexpressing lines were not significantly affected.

[0027] Beneficial effects

[0028] This invention discloses wheat TaNramp1 The gene does not participate in cadmium absorption in wheat, but it can be overexpressed. TaNramp1Gene B creates a new wheat germplasm with low cadmium accumulation in grains, which can significantly reduce cadmium accumulation in wheat grains without affecting wheat yield. Its application in improving wheat with low heavy metal content has important application value. Attached Figure Description

[0029] Figure 1 This invention relates to the cadmium and manganese transport activities of the TaNramp1A, TaNramp1B, TaNramp1D, TaNramp5A, TaNramp5B, and TaNramp5D proteins; wherein, Figure 1 Figure a in the diagram represents the positive control rice. OsNramp5 The effects of genes and wheat TaNramp1A, TaNramp1B, TaNramp1D, TaNramp5A, TaNramp5B and TaNramp5D genes on cadmium sensitivity in yeast cells; Figure 1 Figure b in the image shows the positive control rice. OsNramp5 Genes and wheat TaNramp1A, TaNramp1B, TaNramp1D, TaNramp5A, TaNramp5B and TaNramp5D The effect of genes on cadmium uptake in yeast cells; Figure 1 Figure c in the diagram represents the positive control rice. OsNramp5 Genes and wheat TaNramp1A, TaNramp1B, TaNramp1D, TaNramp5A, TaNramp5B and TaNramp5D The influence of genes on the manganese deficiency sensitivity of yeast cells.

[0030] Figure 2 The figure shows the subcellular localization of TaNramp1A, TaNramp1B, and TaNramp1D proteins of this invention; the figure shows that the GFP fluorescence signal (green fluorescence) of TaNramp1 completely overlaps with the fluorescence signal (red fluorescence) of the plasma membrane dye FM4-64.

[0031] Figure 3 As described in this invention TaNramp1 base Because it expresses responses to different elemental treatments in wheat roots. Different letters indicate significant differences (p < 0.05).

[0032] Figure 4 This invention utilizes CRISPR-Cas9 gene editing technology to knock out... TaNramp1 The nucleotide changes in the coding regions of gene target sites and knockout mutants; among them, Figure 4 Figure a in the middle is in TaNramp1 Information on two target sites selected from the gene coding region; Figure 4 Figure b shows the three homozygous knockout mutant lines obtained. TaNramp1A Types of nucleotide mutations in genes Figure 4 Figure c shows the three homozygous knockout mutant lines obtained. TaNramp1BTypes of nucleotide mutations in genes; Figure 4 Figure d shows the three homozygous knockout mutant lines obtained. TaNramp1D Types of nucleotide mutations in genes.

[0033] Figure 5 For the present invention TaNramp1B In the roots of the two homozygous lines overexpressing TaNramp1 Gene expression levels.

[0034] Figure 6 For the purposes of this invention TaNramp1 Gene knockout mutants, overexpression TaNramp1B Cadmium accumulation phenotypes in hydroponic experiments of transgenic homozygous lines and wild-type seedlings; among them... Figure 6 Figure a in the figure shows the cadmium concentration in the aboveground parts of wheat. Figure 6 Figure b shows the cadmium concentration in wheat roots; Figure 6 Figure c in the diagram shows the translocation coefficient of cadmium from roots to aboveground parts. WT represents the wild-type (Fielder), tanramp1-1, tanramp1-2, and tanramp1-3 are three knockout mutant lines, and OX-1 and OX-2 are overexpression lines. TaNramp1B Two transgenic homozygous lines. Different letters indicate significant differences (p < 0.05).

[0035] Figure 7 For the purposes of this invention TaNramp1 Gene knockout mutants, overexpression TaNramp1B Phenotypic and cadmium accumulation in grains of transgenic homozygous lines and wild-type plants grown in pots in alkaline soil; among them, Figure 7 Figure a in the diagram shows the wheat growth phenotype; Figure 7 Figure b in the diagram represents the plant height; Figure 7 Figure c in the diagram represents the number of ears per plant; Figure 7 The d-th graph in the figure represents the yield per plant; Figure 7 The graph in Figure e represents the weight per thousand grains; Figure 7 Figure f in the figure represents the cadmium concentration in the grains. WT represents the wild type (Fielder), tanramp1-1, tanramp1-2, and tanramp1-3 are three knockout mutant lines, and OX-1 and OX-2 are two transgenic homozygous lines overexpressing TaNramp1B. Different letters indicate significant differences (p < 0.05).

[0036] Figure 8 For the purposes of this invention TaNramp1 Gene knockout mutants, overexpression TaNramp1B Phenotypic and cadmium accumulation in seeds of transgenic homozygous lines and wild-type plants in pots grown in acidic soil; Figure 8 Figure a in the diagram shows the wheat growth phenotype; Figure 8Figure b in the diagram represents plant height; Figure 8 Figure c in the diagram shows the number of ears per plant; Figure 8 The d-th graph in the figure represents the yield per plant; Figure 8 The graph in Figure e represents the weight per thousand grains; Figure 8 The f-plot in the figure represents the cadmium concentration in the grains. WT represents the wild-type (Fielder), tanramp1-1, tanramp1-2, and tanramp1-3 are three knockout mutant lines, and OX-1 and OX-2 are overexpression lines. TaNramp1B Two transgenic homozygous lines. Different letters indicate significant differences (p < 0.05). Detailed Implementation

[0037] The present invention will be further described in detail below with reference to the embodiments. Reagents or instruments used without a specified manufacturer are considered to be conventional products that can be purchased on the market.

[0038] Example 1: Study on ion transport activities of TaNramp1A, TaNramp1B, TaNramp1D, TaNramp5A, TaNramp5B and TaNramp5D by heterologous expression in yeast

[0039] Using cDNA from wheat Shannong 28 as a template, the full-length coding sequences of TaNramp1A (as shown in SEQ ID NO: 1), TaNramp1B (as shown in SEQ ID NO: 2), TaNramp1D (as shown in SEQ ID NO: 3), TaNramp5A, TaNramp5B, and TaNramp5D were amplified. Simultaneously, the full-length coding sequence of OsNramp5 was cloned from rice as a positive control. The amplified fragments were inserted between the SacI and EcoRI restriction sites of the yeast expression vector pYES2.0. After sequencing verification, the constructed plasmids and empty vector (control) were transformed into yeast strains ∆ycf1 and ∆smf1 using a yeast transformation kit.

[0040] Successfully transformed yeast strains were selected and cultured in liquid SD-U medium containing 2% glucose at 30°C and 200 rpm for approximately 12 hours (until OD). 600 = 0.8~1.0). Centrifuge the cultured yeast cells and resuspend them in sterile water to the initial OD. 600=0.8, and three concentration gradients were sequentially diluted at a ratio of 1:10. For the determination of Cd transport activity, 2.5 μl of ∆ycf1 yeast cell dilution was titrated on SD-U plates containing 2% galactose and 0 or 25 μM CdCl2, and incubated at 30℃ for 2-4 days. For the determination of Mn transport activity, 2.5 μl of ∆smf1 yeast cell dilution was titrated on SD-U (-Mn) plates containing 2% galactose and 0 or 2 mM EGTA, and incubated at 30℃ for 2-4 days. To determine the Cd uptake of yeast, ∆ycf1 yeast cells were transferred to liquid SD-U medium containing 2% glucose and cultured at 30℃ and 200 rpm until OD600 was reached. 600 The concentration was approximately 0.8. The bacterial cells were collected by centrifugation, then resuspended in 15 ml of SD-U (galactose) liquid medium and incubated at 30°C and 200 rpm for 2 h. Then, 10 mM CdCl2 solution was added to a final concentration of 10 μM. After further incubation for 3 h, the bacterial cells were enriched by centrifugation at 4°C. After washing, the yeast samples were digested using a graphite digester for Cd content determination.

[0041] Experimental results are as follows Figure 1 As shown, expression of the TaNramp1A, TaNramp1B, or TaNramp1D genes increased the yeast strain's sensitivity to cadmium and its uptake of cadmium, similar to strains expressing OsNramp5. Figure 1 (See Figures a and b in the original text). Expression of TaNramp5A, TaNramp5B, and TaNramp5D did not affect the yeast strain's sensitivity to cadmium or its uptake. When using 2mM EGTA chelated medium to induce manganese deficiency in yeast strains, expression of OsNramp5, TaNramp1A, TaNramp1B, or TaNramp1D made the yeast strains more tolerant to manganese deficiency, while expression of TaNramp5A, TaNramp5B, and TaNramp5D did not affect the yeast strain's sensitivity to manganese deficiency. Figure 1 (See Figure c in the original text). These results indicate that the proteins encoded by the TaNramp1A, TaNramp1B, and TaNramp1D genes have cadmium and manganese transport activities, while the proteins encoded by the TaNramp5A, TaNramp5B, and TaNramp5D genes do not.

[0042] Example 2: TaNramp1A, TaNramp1B and TaNramp1D Subcellular localization of gene-encoded proteins

[0043] The cloned TaNramp1A, TaNramp1B or TaNramp1DThe full-length coding region sequence was ligated to the N-terminus of the GFP tag protein coding sequence and inserted after the CaMV 35S promoter of the pCAMBIA1301 vector to construct fusion expression vectors 35S::TaNramp1A~eGFP, 35S::TaNramp1B~eGFP, and 35S::TaNramp1D~eGFP. Using the 35S::eGFP vector as a control, the constructed vectors were transformed into Agrobacterium GV3101. Positive strains were selected, injected into tobacco leaves, and the subcellular localization of the GFP protein was observed using confocal fluorescence microscopy after 48 h.

[0044] Experimental results are as follows Figure 2 As shown, GFP tag protein fusion revealed that TaNramp1A~eGFP, TaNramp1B~eGFP, and TaNramp1D~eGFP are all located on the cell membrane in tobacco cells, and their GFP fluorescent protein signals overlap with the cell membrane-specific dye FM4-64. This indicates that TaNramp1A, TaNramp1B, and TaNramp1D are all membrane proteins. Figure 2 ).

[0045] Example 3: TaNramp1 Genes expressing responses to different elemental treatments in wheat roots

[0046] Wheat seedlings were cultured in 1 / 2 KimuraB nutrient solution for 8 days, and then subjected to either nutrient deficiency treatment or cadmium treatment. Nutrient deficiency treatment involved 1 / 2 KimuraB nutrient solution lacking the corresponding element, while cadmium treatment involved a concentration of 0.1 μM. Root samples were harvested 7 days after treatment, RNA was extracted, and quantitative real-time PCR was used to determine RNA levels. TaNramp1 For gene expression quantification, the upstream primer is 5'-3': CTCACACTGGACTCGTCTTCCTT (SEQ ID NO: 9), and the downstream primer is 5'-3': GGTGCCAGTGATACTCGAGC (SEQ ID NO: 10).

[0047] The test results are as follows Figure 3 As shown, in wheat roots TaNramp1 Gene expression was strongly induced by iron deficiency treatment, but was not affected by manganese, zinc, copper, or cadmium deficiency treatments. Figure 3 ).

[0048] Example 4: CRISPR-Cas9 gene editing technology to knock out wheat TaNramp1 Gene

[0049] Using the CRISPR-P website TaNramp1 Gene knockout target design. Target selection in... TaNramp1A, TaNramp1B and TaNramp1D Homologous regions of genes were identified, and two target sites were designed to simultaneously knock out three genes. The sequences of the two target sites are as follows:

[0050] 5'-3': GATGTCGACTTCTTCCTTGCCGG (SEQ ID NO: 7) and

[0051] 5'-3': ATACTCTGACTTGCACAGCTCGG (SEQ ID NO: 8).

[0052] Primers were designed using the online software toolkit CRISPR-GE to construct a CRISPR knockout vector, with the selected vector being pYLCRISPR / Cas9P. ubi The -H vector was constructed using U6a and U6b promoters. The constructed vector was transformed into Agrobacterium, which was then used to infect wheat Fielder. The wheat transgenic process was completed by Jiangsu Weimi Biotechnology Co., Ltd.

[0053] After obtaining positive transgenic wheat plants, primers were designed to clone sequences near the target sites of wheat TaNramp1A, TaNramp1B, and TaNramp1D, respectively, to determine the editing type. The selected gene-edited wheat plants were propagated until mutant plants with homozygous knockout of all three genes (TaNramp1A, TaNramp1B, and TaNramp1D) were selected.

[0054] Experimental results are as follows Figure 4 As shown, a total of three homozygous lines with TaNramp1A, TaNramp1B, and TaNramp1D all knocked out were obtained. Their mutation types are shown in [reference needed]. Figure 4 .

[0055] Example 5: Creation and screening of TaNramp1B overexpressing transgenic wheat plants

[0056] The wheat TaNramp1B gene was cloned and inserted into the BamHI and SacI restriction sites of the pTCK303 vector using homologous recombination. The constructed vector was then transformed into Agrobacterium GV3101 for wheat genetic transformation.

[0057] The expression of the TaNramp1 gene in the roots of the obtained transgenic wheat plants was measured, and plants with high expression levels were selected and screened to homozygote.

[0058] Experimental results are as follows Figure 5 As shown, this application obtained two transgenic wheat lines overexpressing TaNramp1B, whose root expression levels of the TaNramp1 gene were increased by 174 and 269 times, respectively, compared with the control. Figure 5 ).

[0059] Example 6: Effects of TaNramp1 gene knockout and overexpression of TaNramp1B on cadmium uptake and translocation in wheat under hydroponic conditions

[0060] Three lines of TaNramp1 gene knockout mutant, two lines of transgenic wheat overexpressing TaNramp1B, and seeds of wild-type Fielder were selected. After germination, they were cultured in 1 / 2 Kimura B nutrient solution for 2 weeks. Then, they were treated with different concentrations of manganese and exposed to 0.1 μM CdCl2. After 2 weeks of treatment, the wheat roots and aboveground parts were harvested and the cadmium content was measured.

[0061] Experimental results are as follows Figure 6 As shown, with increasing manganese concentration, the concentration of cadmium in wheat roots and aboveground parts significantly decreased. Knocking out TaNramp1 increased cadmium accumulation in wheat roots and aboveground parts, while overexpression of TaNramp1B significantly reduced cadmium accumulation in aboveground parts and significantly increased cadmium accumulation in roots. The cadmium translocation coefficient from roots to aboveground parts in overexpressing transgenic plants was significantly lower than that in wild-type plants. This result indicates that the TaNramp1 gene does not participate in cadmium uptake in wheat, but overexpression of TaNramp1B inhibits cadmium translocation from wheat roots to aboveground parts, significantly reducing cadmium accumulation in aboveground parts of wheat.

[0062] Example 7: Effects of TaNramp1 gene knockout and overexpression of TaNramp1B on cadmium accumulation and agronomic traits in wheat grains under alkaline soil pot cultivation conditions

[0063] A pot experiment was conducted using cadmium-contaminated soil from region A. The soil pH was 7.8, and the cadmium concentration was 0.80 mg / kg. -1 Three lines of TaNramp1 gene knockout mutant, two lines of transgenic wheat overexpressing TaNramp1B, and wild-type Fielder were selected for pot experiments. The wheat was grown in a greenhouse until maturity, agronomic traits were recorded, and the cadmium content of the harvested wheat grains was measured.

[0064] Experimental results are as follows Figure 7 As shown, knockout of the TaNramp1 gene and overexpression of the TaNramp1B gene did not significantly affect agronomic traits such as plant height, number of spikes per plant, yield per plant, and thousand-grain weight in wheat. Two lines with TaNramp1 gene knockout showed significantly increased cadmium content in grains, while transgenic wheat with TaNramp1B gene overexpression showed significantly decreased cadmium concentration in grains, with the two lines OX-1 and OX-2 showing reductions of 39% and 72%, respectively.

[0065] Example 8: Effects of TaNramp1 gene knockout and overexpression of TaNramp1B on cadmium accumulation and agronomic traits in wheat grains under acidic soil pot cultivation conditions

[0066] A pot experiment was conducted using cadmium-contaminated soil from region B. The soil pH was 5.2 and the cadmium concentration was 0.56 mg / kg. -1 Three lines of TaNramp1 gene knockout mutant, two lines of transgenic wheat overexpressing TaNramp1B, and wild-type Fielder were selected for pot experiments. The wheat was grown in a greenhouse until maturity, agronomic traits were recorded, and the cadmium content of the harvested wheat grains was measured.

[0067] Experimental results are as follows Figure 8 As shown, except for a few knockout strains, the knockout TaNramp1 Genes and overexpression TaNramp1B None of the genes had a significant effect on agronomic traits of wheat, such as plant height, number of spikes per plant, yield per plant, and thousand-grain weight. Knocking out the TaNramp1 gene did not affect the cadmium content of wheat grains, while the cadmium concentration in transgenic wheat grains overexpressing the TaNramp1B gene was significantly reduced, with the cadmium concentration in the grains of the two lines OX-1 and OX-2 decreasing by 36% and 32%, respectively.

[0068] The scope of protection of this invention is not limited to the above embodiments. Variations and advantages that can be conceived by those skilled in the art without departing from the spirit and scope of the inventive concept are included in this invention and are protected by the appended claims.

Claims

1. Transporter protein genes TaNramp1 Applications in (A1)-(A3) below: (A1) Application in reducing cadmium accumulation in wheat grains; (A2) Application in the preparation of products that reduce cadmium accumulation in wheat grains; (A3) Application in the creation of new wheat germplasm with low cadmium accumulation in grains; The transporter protein gene TaNramp1 Selected from three alleles TaNramp1A , TaNramp1B and TaNramp1D At least one of them ， The TaNramp1A , TaNramp1B and TaNramp1D The CDS sequences are shown in SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively; The application uses genes TaNramp1 This is achieved by overexpressing the target wheat.

2. Transporter protein genes TaNramp1 The encoded transporter protein is used in the following (A1)-(A3): (A1) Application in reducing cadmium accumulation in wheat grains; (A2) Application in the preparation of products that reduce cadmium accumulation in wheat grains; (A3) Application in the creation of new wheat germplasm with low cadmium accumulation in grains; The amino acid sequence of the transporter protein is selected from at least one of SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6; The application uses genes TaNramp1 This is achieved by overexpressing the target wheat.

3. Contains a transporter protein gene TaNramp1 The recombinant vector is used in the following applications (A1)-(A3): (A1) Application in reducing cadmium accumulation in wheat grains; (A2) Application in the preparation of products that reduce cadmium accumulation in wheat grains; (A3) Application in the creation of new wheat germplasm with low cadmium accumulation in grains; The transporter protein gene TaNramp1 Selected from three alleles TaNramp1A , TaNramp1B and TaNramp1D At least one of them ， The TaNramp1A , TaNramp1B and TaNramp1D The CDS sequences are shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 respectively.

4. The application according to claim 3, characterized in that, The skeletal carrier of the carrier is pTCK303 .

5. Contains a transporter protein gene TaNramp1 The recombinant microorganisms are used in the following (A1)-(A3): (A1) Application in reducing cadmium accumulation in wheat grains; (A2) Application in the preparation of products that reduce cadmium accumulation in wheat grains; (A3) Application in the creation of new wheat germplasm with low cadmium accumulation in grains; The transporter protein gene TaNramp1 Selected from three alleles TaNramp1A , TaNramp1B and TaNramp1D At least one of them ， The TaNramp1A , TaNramp1B and TaNramp1D The CDS sequences are shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 respectively.

6. The application according to claim 5, characterized in that, The microorganism in question is Agrobacterium.

7. Applications of recombinant microorganisms containing recombinant vectors in the following (A1)-(A3): (A1) Application in reducing cadmium accumulation in wheat grains; (A2) Application in the preparation of products that reduce cadmium accumulation in wheat grains; (A3) Application in the creation of new wheat germplasm with low cadmium accumulation in grains; The recombinant vector is a recombinant vector containing the transport protein gene TaNramp1; The application involves using genes containing transport proteins. TaNramp1 This was achieved by overexpressing the recombinant vector in the target wheat. The transporter protein gene TaNramp1 Selected from three alleles TaNramp1A , TaNramp1B and TaNramp1D At least one of them ， The TaNramp1A , TaNramp1B and TaNramp1D The CDS sequences are shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 respectively.

8. The application according to claim 7, characterized in that, The microorganism in question is Agrobacterium.

9. A method for reducing cadmium accumulation in wheat grains, characterized in that, The method improves the transporter protein gene in the target wheat. TaNramp1 The expression level of the transporter gene is used to achieve this. TaNramp1 Selected from three alleles TaNramp1A , TaNramp1B and TaNramp1D At least one of them ， The TaNramp1A , TaNramp1B and TaNramp1D The CDS sequences are shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3 respectively.

10. The method according to claim 9, characterized in that, The method involves gene TaNramp1 The goal is to transfer the wheat to the target wheat.

Images