A three-dimensional upconversion nanowalking fluorescence sensor, its fabrication method, and its application.

Abstract

This invention relates to a three-dimensional upconversion nanowalking fluorescence sensor, its preparation method, and its application, belonging to the field of food safety detection. Addressing the problems of expensive instruments, cumbersome operation, difficulty in simultaneous multi-target detection, and poor stability and insufficient sensitivity of protease-assisted walking systems in traditional heavy metal detection methods, this invention constructs a three-dimensional upconversion nanowalking fluorescence sensor. Two differentially emitting upconversion nanomaterials serve as signal carriers for the walking probe and the orbital probe, respectively. A deoxyribozyme replaces the protease to drive the three-dimensional nanowalker, enabling specific target recognition and signal amplification under target triggering. Independent fluorescence responses are generated at two characteristic wavelengths, achieving simultaneous quantitative detection of two heavy metal ions. The sensor provided by this invention has advantages such as high sensitivity, strong specificity, good stability, and wide versatility, making it suitable for highly sensitive and specific multiplex detection of heavy metal ions in complex sample matrices such as aquatic products.

Description

Technical Field

[0001] This invention belongs to the field of food safety testing, and in particular relates to a three-dimensional upconversion nanowalking fluorescence sensor, its preparation method, and its application. Background Technology

[0002] With the accelerated pace of industrialization, the pollution of food and the environment by harmful substances such as heavy metal ions, pesticide residues, and biotoxins is becoming increasingly prominent. These substances are highly toxic, persistent, and bioaccumulative, and long-term ingestion can cause serious harm to human health. Currently, traditional detection methods for these harmful substances mainly include inductively coupled plasma mass spectrometry (ICP-MS), high-performance liquid chromatography (HPLC), and gas chromatography-mass spectrometry (GC-MS). While these methods offer high precision, they generally suffer from limitations such as expensive equipment, cumbersome operation, and long detection cycles. Furthermore, they are difficult to use for the simultaneous and rapid detection of multiple target analytes, failing to meet the practical needs of rapid screening and parallel monitoring of multiple pollutants. Therefore, developing a new multiplex detection method that combines high sensitivity, high throughput, and broad spectral versatility has become an urgent need in the fields of food safety and environmental monitoring.

[0003] In recent years, biosensors based on functional nucleic acids have attracted widespread attention due to their high sensitivity, strong specificity, and ease of operation. DNA walkers are an important type of DNA molecular machine that can autonomously move along carefully designed DNA tracks triggered by target molecules, continuously accumulating signals during the process to achieve efficient signal amplification of target analytes. Among them, three-dimensional (3D) DNA walkers use nanoparticles as track carriers. Their high surface area and excellent DNA enrichment capabilities significantly increase the local concentration of tracked DNA, thereby greatly improving walking efficiency and signal amplification, giving them a unique advantage in the ultrasensitive detection of trace target analytes. However, the development of existing 3D DNA walkers still faces two major bottlenecks. Existing walkers generally rely on proteases (such as DNase I) as the catalytic driving force, but protease activity is extremely sensitive to temperature and pH fluctuations, resulting in insufficient stability in complex real-world sample matrices, severely limiting their reliability in practical applications. Traditional 3D DNA walkers suffer from limited movement space and a tendency to derail during operation, making it difficult to achieve the expected walking efficiency and signal amplification efficiency, and requiring further improvement in detection sensitivity. Deoxyribonucleases (DNAzymes) are a class of functional nucleic acids with biocatalytic activity. In the presence of specific cofactors, they can cleave substrate chains at recognition sites. Compared with proteases, they have advantages such as better stability in complex systems, less susceptibility to temperature-dependent catalytic performance, lower synthesis costs, and higher specificity. Introducing DNAzymes into 3D DNA walkers as a protease-free driving force holds promise for solving the problem of poor stability in existing systems.

[0004] Upconversion nanomaterials (UCNPs) are a class of rare-earth-doped nanomaterials that can convert near-infrared excitation light into visible or ultraviolet light. They exhibit significant advantages such as low background fluorescence interference, high photochemical stability, and tunable multicolor emission, demonstrating unique strengths in the field of multiplex detection. However, the integration of a DNAzyme-driven two-particle rolling three-dimensional DNA walker with the multicolor emission characteristics of UCNPs to construct a multicolor fluorescence sensing platform that combines protease-free high stability, ultra-high sensitivity, and broad spectral versatility has not yet been reported, and further research is needed.

[0005] Therefore, those skilled in the art are eager to develop a DNAzyme-driven three-dimensional upconversion nanowalking fluorescent biosensor to construct a multi-fluorescent sensing platform that combines stability, high sensitivity, and broad spectral versatility. This is expected to provide new ideas and references for the development of multi-sensing technologies in the fields of food safety and environmental monitoring. Summary of the Invention

[0006] This invention addresses the problems of expensive instruments, cumbersome operation, difficulty in simultaneous multi-target detection, insufficient single-target detection capability of existing fluorescence sensors, and poor stability of protease-assisted walking systems in existing heavy metal detection methods. It provides a three-dimensional upconversion nanowalking fluorescence sensor, its preparation method, and its application.

[0007] One objective of this invention is to provide a method for fabricating a three-dimensional upconversion nano-walking fluorescence sensor, the method comprising the following steps:

[0008] S1. Preparation of oil-soluble upconversion nanoparticles: GdCl3·6H2O, YbCl3·6H2O and ErCl3·6H2O were dissolved in methanol and added to a flask containing oleic acid and 1-octadecene under argon protection. The first heating reaction was carried out until the solution was clear and transparent. After cooling to room temperature, 10 mL of methanol solution containing sodium hydroxide and ammonium fluoride was added dropwise. The first stirring reaction was carried out in a closed environment. Then, the temperature was raised to carry out a second heating reaction to evaporate the residual methanol. The temperature was raised again to carry out a third heating reaction. After the reaction was completed and cooled, the mixture was collected by centrifugation, washed with a mixed solution of ethanol and cyclohexane with a volume ratio of 1:1, centrifuged, and vacuum dried to obtain oil-soluble upconversion nanoparticles.

[0009] S2. Preparation of carboxylated upconversion nanoparticles: The oil-soluble upconversion nanoparticles obtained in S1 were dissolved in a mixed solvent of chloroform and toluene with a volume ratio of 2:3 under ultrasonic conditions. An aqueous solution of polyacrylic acid was added, and the mixture was stirred and washed with ethanol to obtain carboxylated upconversion nanoparticles.

[0010] S3. Preparation of polyethyleneimine-modified upconversion nanoparticles: Polyethyleneimine was dissolved in ethylene glycol, and sodium chloride and rare earth chlorides GdCl3·6H2O, YbCl3·6H2O and TmCl3·6H2O were added and stirred until transparent. Ammonium fluoride was dissolved in ethylene glycol and added dropwise. After stirring at room temperature, the mixture was transferred to a reaction vessel and heated. After cooling, the mixture was collected by centrifugation, washed with ethanol, and dried under vacuum to obtain polyethyleneimine-modified upconversion nanoparticles.

[0011] S4. Preparation of carboxylated magnetic nanoparticles: Ferric chloride hexahydrate and trisodium citrate were dissolved in ethylene glycol, sodium acetate was added and stirred, and then the mixture was transferred to a reaction vessel and heated. The magnetic nanoparticles were separated by an external magnetic field and washed with ethanol and ultrapure water to obtain carboxylated iron oxide magnetic nanoparticles.

[0012] S5. Preparation of walking chain functionalized upconversion nanoparticles: The carboxylated upconversion nanoparticles obtained in S2 were dispersed in 4-hydroxyethylpiperazine ethanesulfonic acid buffer, and 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and N-hydroxythiosuccinimide were added to activate the carboxyl groups. After incubation, the nanoparticles were centrifuged and washed. The amino-modified walking chain was added, stirred, centrifuged and washed to obtain walking chain functionalized upconversion nanoparticles. The walking chain contains a first target-responsive deoxyribozyme sequence, which can catalyze the cleavage of the substrate chain with the assistance of the first target.

[0013] S6. Preparation of walking nanoprobes: The walking chain functionalized upconversion nanoparticles obtained in S5, the chain containing the second target-specific aptamer sequence, and the short-chain deoxynucleotide labeled with a fluorescence quencher group were heated and mixed separately, annealed, and then cooled. The three components were assembled according to the base complementary pairing principle, so that the chain completely closed the walking chain. After assembly, the fluorescence quencher group approached the upconversion nanoparticles and generated a fluorescence resonance energy transfer effect, quenching the upconversion fluorescence at the corresponding characteristic wavelength, and the walker was in a quiescent state. When the second target was present, the chain conformation changed and the walking chain was released, the fluorescence quenching was lifted and the walker was activated, thus obtaining the walking nanoprobes.

[0014] S7. Preparation of magnetic nanoparticle-orbital chain complex: 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride, N-hydroxythiosuccinimide, and carboxylated iron oxide magnetic nanoparticles obtained in S4 were mixed, the carboxyl groups were activated by low-temperature stirring, and after magnetic separation and washing, the 3'-terminal amino-modified orbital chain was added for incubation. Unbound orbital chains were removed by magnetic separation, and after washing, the mixture was resuspended in 4-hydroxyethylpiperazine ethanesulfonic acid buffer to obtain the magnetic nanoparticle-orbital chain complex. The orbital chain contains ribonucleotide cleavage sites and can be used as a substrate chain for deoxyribozymes to be catalytically cleaved during the operation of the walker.

[0015] S8. Preparation of orbital nanoprobes: The magnetic nanoparticle-orbital chain complex obtained in S7 was added to a tris(2-carboxyethyl)phosphine hydrochloride solution to activate the 5' end thiol group of the orbital chain, thus obtaining the thiol-activated magnetic nanoparticle-orbital chain complex.

[0016] The polyethyleneimine-modified upconversion nanoparticles obtained in S3 were added to 4-hydroxyethylpiperazine ethanesulfonic acid buffer, sonicated, and then 4-(N-maleimidemethyl)cyclohexane-1-carboxylic acid-3-thio-N-succinimide ester sodium salt was added. The precipitate was collected by centrifugation and washed with 4-hydroxyethylpiperazine ethanesulfonic acid buffer by centrifugation to obtain a maleimine-activated upconversion nanoparticle solution.

[0017] The thiol-activated magnetic nanoparticle-orbit chain complex was added to a maleimide-activated upconversion nanoparticle solution for reaction, so that the upconversion nanoparticles were connected to the 5' end of the orbital chain through thioether bonds to obtain orbital nanoprobes.

[0018] The walking chain functionalized upconversion nanoparticles obtained in S9 and S5, the orbital nanoprobe obtained in S8, and the walking nanoprobe obtained in S6 constitute an upconversion nanowalking fluorescent sensor.

[0019] In a preferred embodiment of the present invention, the molar ratio of GdCl3·6H2O, YbCl3·6H2O, and ErCl3·6H2O in S1 is 0.80:0.18:0.02; the amount of methanol used is 5 mL, the amount of oleic acid used is 4 mL, and the amount of 1-octadecene used is 9 mL; the first heating reaction temperature is 160°C and the time is 30 min; the molar amounts of sodium hydroxide and ammonium fluoride in the 10 mL methanol solution are 2.5 mmol and 4 mmol, respectively; the first stirring reaction temperature is 50°C and the time is 40 min; the second heating reaction temperature is 100°C; the third heating reaction temperature is 300°C and the time is 1 h; the centrifugation speed is 10000 rpm and the time is 10 min; the vacuum drying temperature is 60°C.

[0020] In a preferred embodiment of the present invention, the amount of oil-soluble upconversion nanoparticles used in S2 is 50 mg; the amount of the chloroform and toluene mixed solvent is 10 mL; the amount of the polyacrylic acid aqueous solution is 15 mL, wherein the mass of the polyacrylic acid is 400 mg; the stirring time is 24 h; and the concentration of the ethanol solution is 50%.

[0021] In a preferred embodiment of the present invention, the amount of polyethyleneimine in S3 is 0.4 g, dissolved in 18 mL of ethylene glycol; the molar ratio of sodium chloride, GdCl3·6H2O, YbCl3·6H2O, and TmCl3·6H2O is 2.402:0.72:0.474:0.006. The amount of ammonium fluoride is 231.1 mg, dissolved in 12 mL of ethylene glycol; the stirring time at room temperature is 10 min; the heating temperature of the reaction vessel is 200℃ for 1.5 h; the concentration of the ethanol solution is 50%; and the vacuum drying temperature is 60℃ for 8 h.

[0022] In a preferred embodiment of the present invention, the amounts of ferric chloride hexahydrate and trisodium citrate in S4 are 4 mmol and 1.36 mmol, respectively; the amount of ethylene glycol solution is 20 mL; the amount of sodium acetate is 1.2 g; the heating temperature of the reaction vessel is 198°C and the reaction time is 16 h.

[0023] In a preferred embodiment of the present invention, the amount of carboxylated upconversion nanoparticles used in S5 is 10 mg, the amount of 4-hydroxyethylpiperazine ethanesulfonic acid buffer is 10 mL; the amount of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride is 3 mg, the amount of N-hydroxythiosuccinimide is 1.5 mg; the amount of amino-modified walking chain is 260 μL; the first target includes, but is not limited to, metal ions, organic pollutants, biotoxins, and target analytes with DNAzyme-responsive properties.

[0024] In a preferred embodiment of the present invention, the molar ratio of the walking chain functionalized upconversion nanoparticles to the chain in S6 is 1:1.2; the amount of the short-chain deoxynucleotide solution is 6 μM; the heating temperature is 95°C and the heating time is 2 min; the annealing temperature is 95°C and the annealing time is 5 min; the cooling endpoint is 25°C; the second target includes, but is not limited to, metal ions, pesticide residues, biotoxins, antibiotics, and target analytes with aptamer recognition characteristics.

[0025] In a preferred embodiment of the present invention, the concentration of the 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride solution in S7 is 0.25 mg / mL; the concentration of the N-hydroxythiosuccinimide solution is 0.25 mg / mL; the amount of the carboxylated magnetite nanoparticles is 250 μL and the concentration is 5 mg / mL; the amount of the orbital chain is 44 μL; the incubation temperature is 4°C and the time is 12 h; and the amount of the 4-hydroxyethylpiperazine ethanesulfonic acid buffer used for resuspension is 1 mL.

[0026] In a preferred embodiment of the present invention, the appropriate volume ratio of the magnetic nanoparticle-orbital chain complex to the tris(2-carboxyethyl)phosphine hydrochloride solution in S8 is 1:1, the concentration of the tris(2-carboxyethyl)phosphine hydrochloride solution is 3 mM; the amount of the polyethyleneimine-modified upconversion nanoparticles is 30 mg; the amount of the 4-hydroxyethylpiperazine ethanesulfonic acid buffer is 20 mL; and the amount of the sodium salt of 4-(N-maleiminomethyl)cyclohexane-1-carboxylic acid-3-thio-N-succinimidyl ester is 5 mg.

[0027] The second objective of this invention is to provide a three-dimensional upconversion nanowalking fluorescence sensor, which is obtained using the above-described preparation method.

[0028] The third objective of this invention is to provide the application of the above-mentioned three-dimensional upconversion nanowalking fluorescence sensor in heavy metal detection. The method of using the three-dimensional upconversion nanowalking fluorescence sensor in this application includes the following steps:

[0029] (1) Establishment of the standard curve of the first target: The functionalized upconversion nanoparticles of the walking chain in the three-dimensional upconversion nanowalking fluorescence sensor are mixed with the orbital nanoprobes, and the test sample containing the first target is added. The first incubation reaction is carried out in the buffer solution. After the reaction, magnetic separation is performed by applying an external magnetic field to remove the uncut orbital nanoprobes. The supernatant is collected, and the fluorescence intensity at the characteristic wavelength is detected by an upconversion fluorescence spectrometer to realize the quantitative detection of the first target.

[0030] (2) Establishment of the standard curve of the second target: The test sample containing the second target is added to the walking nanoprobe in the three-dimensional upconversion nanowalking fluorescence sensor and the first incubation reaction is carried out in the buffer solution; then the orbital nanoprobe and the first target solution are added to the system and the second incubation reaction is carried out to drive the walker to run; after the reaction, magnetic separation is carried out by an external magnetic field, the supernatant is collected, and the fluorescence intensity at two characteristic wavelengths is detected by an upconversion fluorescence spectrometer to achieve highly sensitive quantitative detection of the second target.

[0031] In a preferred embodiment of the present invention, the mixing volume ratio of the walking chain functionalized upconversion nanoparticles to the orbital nanoprobes in (1) is 1:8; the first incubation reaction temperature is 37°C;

[0032] (2) The mixing volume ratio of the walking chain functionalized upconversion nanoparticles to the orbital nanoprobes is 1:8; the temperature of the first incubation reaction is 37°C; the buffer solution is 4-hydroxyethylpiperazine ethanesulfonic acid buffer with pH 7.5; the temperature of the second incubation reaction is 37°C and the incubation time is 60 min.

[0033] In a preferred embodiment of the present invention, the heavy metals include, but are not limited to, Pb(II) and As(III); the test samples include, but are not limited to, aquatic products, meat products, dairy products and environmental water samples; if the test sample is a liquid sample, it is directly tested after coarse filtration; if the test sample is a solid sample, it is tested after homogenization and acid digestion pretreatment.

[0034] In a preferred embodiment of the present invention, the application can be extended to single or multiple detection of various target analytes such as heavy metal ions, pesticide residues, biotoxins, and antibiotics by replacing the nucleic acid sequence and / or deoxyribozyme sequence of the chain probe in the three-dimensional upconversion nanowalking fluorescence sensor.

[0035] Compared with the prior art, the beneficial effects of the present invention are as follows: The present invention provides a three-dimensional upconversion nano-walking fluorescence sensor, which uses two different emission upconversion nanomaterials as signal carriers for walking probe and orbital probe, respectively, and uses deoxyribonuclease (DNAzyme) instead of protease as the walking driving force to solve the problems of insufficient single-target detection capability and poor stability of protease-assisted walking system of existing fluorescence sensors, thereby realizing highly sensitive and specific multiplex detection of heavy metal ions in aquatic products.

[0036] 1. This invention uses deoxyribozyme instead of protease as the driving force for a three-dimensional DNA walker. The operating conditions are mild, and there is no need for a complex thermal cycling process. This effectively avoids the problem that the activity of protease is easily affected by temperature and pH fluctuations, and improves the stability and reliability of the sensing system in complex sample matrices.

[0037] 2. This invention uses a dual nanoparticle rolling mode to construct a three-dimensional DNA walker. The multi-legged walking chain and the track chain work together to enhance walking affinity and effectively reduce derailment. Moreover, the three-dimensional configuration improves walking efficiency and signal accumulation rate, greatly improving detection sensitivity.

[0038] 3. This invention utilizes two different upconversion nanomaterials with differentiated emission to construct walking nanoprobes and orbital nanoprobes respectively, achieving independent responses to fluorescence signals at two characteristic wavelengths. This enables simultaneous multiple detection of two target analytes on a single sensing platform, reducing detection costs and simplifying operation steps.

[0039] 4. This invention uses magnetic nanoparticles as the framework of orbital nanoprobes, which can achieve rapid magnetic separation by applying an external magnetic field. It is easy to operate, effectively reduces background fluorescence interference, simplifies the detection process, and eliminates the need for complex separation and purification equipment. It is suitable for the rapid detection of target analytes in complex sample matrices and has good practical application value.

[0040] 5. By replacing the aptamer sequence in the chain probe and / or the deoxyribozyme sequence in the walking chain, this invention can be extended to the detection of a variety of target analytes such as heavy metal ions, pesticide residues, biotoxins, and antibiotics. It has wide applicability and broad application prospects. Attached Figure Description

[0041] Figure 1 This is a schematic diagram illustrating the working principle of the three-dimensional upconversion nanowalking fluorescence sensor used for target multiple detection in Example 1;

[0042] Figure 2 The images show the characterization of NaGdF4:Yb,Er UCNPs particles in Example 1; A is a transmission electron microscope image of the NaGdF4:Yb,Er upconversion nanoparticles; B is an X-ray diffraction pattern of the NaGdF4:Yb,Er upconversion nanoparticles; C is a Fourier mid-infrared characterization of the NaGdF4:Yb,Er upconversion nanoparticles; and D is an EDS spectrum of the NaGdF4:Yb,Er upconversion nanoparticles.

[0043] Figure 3 A is a characterization image of NaGdF4:Yb,Tm upconversion nanoparticles in Example 1; B is a transmission electron microscope image; C is an X-ray diffraction pattern; D is a Fourier transform mid-infrared image; EDS spectrum.

[0044] Figure 4 Characterization diagrams of Fe3O4MNPs nanoparticles in Example 1; where A is a transmission electron microscope image; B is an X-ray diffraction pattern; C is a Fourier mid-infrared characterization pattern; and D is the hysteresis loop of Fe3O4MNPs.

[0045] Figure 5 A is a sensitivity analysis graph of the sensor for detecting the first target Pb(II) in Example 1; B is a fluorescence spectrum corresponding to different concentrations of Pb(II); C is a linear relationship graph between the upconversion fluorescence intensity at 801 nm wavelength and the logarithm of the Pb(II) concentration.

[0046] Figure 6 Figure A shows the sensitivity analysis of the sensor for the second target As(III) in Example 1; Figure B shows the fluorescence spectra corresponding to different concentrations of As(III); Figure C shows the linear relationship between the upconversion fluorescence intensity at 540 nm and the logarithm of the As(III) concentration; Figure C shows the linear relationship between the upconversion fluorescence intensity at 801 nm and the logarithm of the As(III) concentration.

[0047] Figure 7 Figure A shows the sensor specificity and anti-interference evaluation results in Example 1; Figure B shows the specificity evaluation results. Detailed Implementation

[0048] Those skilled in the art can refer to the content of this document and appropriately improve the process parameters to achieve the desired results. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments, and those skilled in the art can obviously make modifications or appropriate alterations and combinations to the methods and applications described herein without departing from the content and scope of this invention to implement and apply the technology of this invention.

[0049] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the materials, reagents, methods, and instruments used are all conventional materials, reagents, methods, and instruments in the art, and can be obtained commercially by those skilled in the art.

[0050] The DNA sequence used in this invention was purchased from Shanghai Sangon Biotech, and the sequence is as follows:

[0051] The walking chain sequence is shown in SEQ ID NO.1:

[0052] 5'-NH2-TTTTTTTTTTTATTACCTCTCTTCTCCGAGCCGGTCGAAATAGTGA-3';

[0053] The chain sequence is shown in SEQ ID NO.2:

[0054] 5'-AGAGAGGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATTTTACAGAACAACCAACGTCGCTCCGGTACTTCTTCATCGAGATAGTAAGTGCAATCTCCCTATAGTGACGTACGCGGCACCA-3';

[0055] The short-chain DNA-TAMRA sequence is shown in SEQ ID NO.3:

[0056] 5'-TGGTGCCGCGTACGTAAAA-TAMRA-3';

[0057] The orbital chain sequence is shown in SEQ ID NO.4:

[0058] 5'-SHSH-T(15)TTTTTTTCACTATrAGGAAGAGAATTTTTTTT(20)-NH2-3'; where rA represents riboadenosine, which is an RNA adenine nucleotide embedded in the DNA sequence of the DNAzyme.

[0059] Example 1: Application of a three-dimensional upconversion nanowalking fluorescence sensor in the detection of Pb(II) and As(III) in fish meat samples

[0060] Figure 1 This is a schematic diagram illustrating the working principle of the three-dimensional upconversion nanowalking fluorescence sensor used for multiplex target detection in this embodiment.

[0061] Step 1: Preparation of oil-soluble NaGdF4:Yb,Er upconversion nanoparticles:

[0062] 0.80 mmol GdCl3·6H2O, 0.18 mmol YbCl3·6H2O, and 0.02 mmol ErCl3·6H2O were added to 5 mL of methanol and sonicated until completely dissolved to obtain a rare earth chloride methanol solution. The obtained rare earth chloride methanol solution was added to a flask containing 4 mL oleic acid and 9 mL 1-octadecene, and a first heating reaction was carried out under argon protection (temperature 160℃, time 30 min) until the mixed solution was clear and transparent. Heating was stopped, and the solution was cooled to room temperature to obtain a clear and transparent mixed liquid.

[0063] 2.5 mmol sodium hydroxide and 4 mmol ammonium fluoride were dissolved in 10 mL methanol to obtain a sodium hydroxide-ammonium fluoride methanol solution. The obtained sodium hydroxide-ammonium fluoride methanol solution was added dropwise to the clear and transparent mixture obtained above, and a first stirring reaction was carried out in a closed environment (temperature 50℃, time 40 min) to obtain a first stirring reaction mixture. After the reaction was completed, the device was opened, and the first stirring reaction mixture was subjected to a second heating reaction (temperature 100℃) to evaporate the residual methanol. Then, the obtained solution was heated to 300℃ for a third heating reaction (time 1 h). After the reaction was completed, the heating was stopped, and the mixture was allowed to cool naturally to room temperature. The product was collected by centrifugation, and a 1:1 volume ratio of ethanol and cyclohexane mixture was added to the product for a first centrifugal washing (centrifugation speed 10000 rpm, time 10 min). The above centrifugal washing operation was repeated 3 times. The washed precipitate was placed in a vacuum drying oven at 60℃ for drying to obtain oil-soluble upconversion nanoparticles.

[0064] Step 2: Preparation of water-soluble carboxylated upconversion nanoparticles:

[0065] 50 mg of the oil-soluble upconversion nanoparticles obtained in step one were added to 10 mL of a chloroform and toluene mixture (volume ratio 2:3) and sonicated until completely dissolved to obtain an oil-soluble upconversion nanoparticle mixture solution. 15 mL of an aqueous solution containing 400 mg of polyacrylic acid was added to the obtained oil-soluble upconversion nanoparticle mixture solution, and a first stirring reaction was carried out (time 24 h) to obtain a first stirring reaction mixture. After the reaction was completed, 50% ethanol solution was added to the obtained first stirring reaction mixture for a first centrifugal washing. This centrifugal washing operation was repeated three times to remove excess polyacrylic acid. The precipitate was collected to obtain water-soluble carboxylated upconversion nanoparticles (abbreviated as NaGdF4:Yb,Er upconversion nanoparticles). The NaGdF4:Yb,Er upconversion nanoparticles were redispersed in 4-hydroxyethylpiperazine ethanesulfonic acid buffer to obtain a NaGdF4:Yb,Er upconversion nanoparticle solution, which was stored at 4°C for later use.

[0066] like Figure 2 As shown, the prepared NaGdF4:Yb,Er upconversion nanoparticles exhibit regular morphology, a near-hexagonal phase, an average particle size of approximately 21 nm, and uniform dispersion. The diffraction peaks of the prepared upconversion nanoparticles match the standard card, demonstrating that the prepared NaGdF4:Yb,Er upconversion nanoparticles have high purity and good crystallinity. The Fourier transform mid-infrared characterization and EDS spectrum both indicate that the NaGdF4:Yb,Er UCNPs nanomaterials were successfully synthesized and modified.

[0067] Step 3: Preparation of polyethyleneimine-modified NaGdF4:Yb,Tm upconversion nanoparticles:

[0068] 0.4 g of polyethyleneimine was added to 18 mL of ethylene glycol solution and stirred until completely dissolved to obtain a polyethyleneimine ethylene glycol solution. 0.1404 g of sodium chloride, 0.2676 g of GdCl3·6H2O, 0.1836 g of YbCl3·6H2O, and 0.0023 g of TmCl3·6H2O were added sequentially to the obtained polyethyleneimine ethylene glycol solution, and the mixture was stirred thoroughly until the solution became clear and transparent to obtain a transparent mixed solution. 231.1 mg of ammonium fluoride was added to 12 mL of ethylene glycol solution and stirred until completely dissolved to obtain an ammonium fluoride ethylene glycol solution. The obtained ammonium fluoride ethylene glycol solution was added dropwise to the obtained transparent mixed solution, and the mixture was stirred at room temperature for 10 min to obtain a stirred reaction mixture. The obtained stirred reaction mixture was transferred to a polytetrafluoroethylene-lined reactor and heated at 200 °C for 1.5 min. h); After the reaction was completed, the mixture was cooled to room temperature and the product was collected by centrifugation. 50% ethanol solution was added to the product for the first centrifugal washing. The centrifugal washing operation was repeated 3 times. The precipitate after washing was placed in a vacuum drying oven at 60℃ and dried for 8 h to obtain polyethyleneimine modified upconversion nanoparticles (abbreviated as: NaGdF4:Yb,Tm upconversion nanoparticles).

[0069] like Figure 3 As shown, the NaGdF4:Yb,Tm upconversion nanoparticles (UCNPs) prepared above are approximately spherical with a particle size of about 50 nm. The particle size is uniform, and the diffraction peaks are consistent with the standard card, indicating that the synthesized UCNPs have good crystal form. The Fourier transform mid-infrared characterization and EDS spectrum also show the successful preparation of NaGdF4:Yb,Tm UCNPs nanomaterials.

[0070] Step 4: Preparation of carboxylated magnetic nanoparticles:

[0071] 4 mmol of ferric chloride hexahydrate and 1.36 mmol of trisodium citrate were added to 20 mL of ethylene glycol solution and stirred until completely dissolved to obtain an iron salt ethylene glycol solution. 1.2 g of sodium acetate was added to the obtained iron salt ethylene glycol solution, and a first rapid stirring reaction was carried out for 30 min to obtain a first stirring reaction mixture. The first stirring reaction mixture was transferred to a polytetrafluoroethylene-lined reactor and subjected to a first heating reaction at 198 °C for 16 h. After the reaction was completed, the mixture was cooled to room temperature, and the product was magnetically separated using an external magnetic field. Magnetic nanoparticles were collected, and ethanol and ultrapure water were added to the obtained magnetic nanoparticles for a first centrifugal washing. This centrifugal washing operation was repeated three times to obtain carboxylated iron(III) oxide magnetic nanoparticles (abbreviated as: Fe3O4MNPs nanoparticles), which were stored at 4 °C for later use.

[0072] like Figure 4As shown, the Fe3O4MNPs nanoparticles prepared above have regular morphology and uniform particle size; they are basically consistent with the standard card of Fe3O4 nanomaterials, proving that they have good crystal form; the hysteresis loop diagram of the magnetic nanoparticles shows that the MNPs nanoparticles have good magnetic response performance and can be quickly separated by an external magnetic field.

[0073] Step 5: Preparation of walking chain functionalized upconversion nanoparticles:

[0074] 10 mg of the water-soluble carboxylated upconversion nanoparticles obtained in step two were added to 10 mL of 4-hydroxyethylpiperazine ethanesulfonic acid buffer and sonicated until uniformly dispersed to obtain a carboxylated upconversion nanoparticle dispersion. 3 mg of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and 1.5 mg of N-hydroxythiosuccinimide were added to the obtained carboxylated upconversion nanoparticle dispersion, and a first shaking reaction was carried out at 37 °C for 2 h to activate the carboxyl groups on the surface of the upconversion nanoparticles. After the reaction, the product was collected by centrifugation, and 4-hydroxyethylpiperazine ethanesulfonic acid buffer was added for a first centrifugal washing. This centrifugal washing operation was repeated 3 times, and the precipitate was collected to obtain carboxyl-activated upconversion nanoparticles.

[0075] 260 μL of amino-modified walking chain solution was added to the obtained carboxyl-activated upconversion nanoparticles, and the first stirring reaction was carried out at 4 °C for 12 h, so that the walking chain was covalently linked to the surface of the upconversion nanoparticles through amide bonds. After the reaction, the product was collected by centrifugation, and ultrapure water was added for a second centrifugation and washing. The above centrifugation and washing operation was repeated 3 times, and the precipitate was collected. The precipitate was redispersed in 10 mL of 4-hydroxyethylpiperazine ethanesulfonic acid buffer and stored at 4 °C for later use, thus obtaining walking chain functionalized upconversion nanoparticles. The walking chain contains a lead ion (Pb(II)) responsive deoxyribonuclease sequence (the sequence is shown in SEQ ID NO.1), which can catalyze the cleavage of substrate chains containing ribonucleotide cleavage sites with the assistance of lead ion (Pb(II)).

[0076] Step 6: Preparation of walking nanoprobes:

[0077] The solution of functionalized upconversion nanoparticles with walking chains obtained in step 5, 260 μL (6 μM) of chain-locked solution, and 300 μL (6 μM) of tetramethylrhodamine-labeled short-chain deoxynucleotide solution were placed in centrifuge tubes and subjected to a first heating reaction at 95 °C for 2 min to obtain their respective heating solutions. The three heating solutions were then mixed and subjected to a first annealing reaction at 95 °C for 5 min to obtain an annealed mixture. Subsequently, the annealed mixture was cooled to 25 °C, and the chain (nucleotide sequence shown in SEQ ID NO.2) and the short-chain deoxynucleotide (nucleotide sequence shown in SEQ ID NO.3) were assembled with the functionalized upconversion nanoparticles with walking chains according to the base complementarity pairing principle. The molar ratio of chain to walking chain was 1.2:1, and the chain completely blocked the walking chain. After assembly, the tetramethylrhodamine fluorescence quenching group was close to the upconversion nanoparticles, satisfying the condition for fluorescence resonance energy transfer, and quenching 540 Upconversion fluorescence at nm indicates that the walker is in a quiescent state, resulting in a walking nanoprobe (WPs). The chain contains a trivalent arsenic (As(III)) specific aptamer sequence. In the presence of trivalent arsenic (As(III)), the conformation changes and the walking chain is released, thereby quenching fluorescence and activating the walker.

[0078] Step 7: Preparation of magnetic nanoparticle-orbital chain complex:

[0079] 0.25 mg / mL 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride solution, 0.25 mg / mL N-hydroxythiosuccinimide solution, and 250 μL (5 mg / mL) of carboxylated magnetic nanoparticles obtained in step four were mixed and subjected to a first stirring reaction at 4 °C for 2 h to activate the carboxyl groups on the surface of the magnetic nanoparticles. After the reaction, a first magnetic separation was performed using an external magnetic field, and the activated magnetic nanoparticles were collected. Ultrapure water was added for a first washing, and the above washing operation was repeated 3 times. The resulting product was redispersed in 1 mL of 4-hydroxyethylpiperazine ethanesulfonic acid buffer to obtain a dispersion of carboxyl-activated magnetic nanoparticles. 44 μL (100 μM) of a 3' amino-terminal modified orbital chain solution (the nucleotide sequence of the orbital chain is shown in SEQ ID NO.4) was added to the obtained carboxyl-activated magnetic nanoparticle dispersion. The first incubation reaction was carried out at 4 °C for 12 h, so that the orbital chain was covalently linked to the surface of the magnetic nanoparticles via amide bonds. After the reaction, a second magnetic separation was performed by applying an external magnetic field to remove unbound orbital chains. The product was collected, and 1 mL of 4-hydroxyethylpiperazine ethanesulfonic acid buffer was added for a second wash. The above washing operation was repeated 3 times. The obtained product was redispersed in 1 mL of 4-hydroxyethylpiperazine ethanesulfonic acid buffer and stored at 4 °C for later use, to obtain the magnetic nanoparticle-orbital chain complex. The orbital chain contains ribonucleotide cleavage sites and can be used as a substrate chain for deoxyribozymes to be catalytically cleaved during the operation of the walker.

[0080] Step 8: Preparation of orbital nanoprobes:

[0081] Add 1 mL of the magnetic nanoparticle-orbital chain complex obtained in step seven to 1 mL of 3 mM tris(2-carboxyethyl)phosphine hydrochloride solution for the first treatment reaction (time is 2 h) to activate the 5' end thiol group of the orbital chain and obtain thiol-activated magnetic nanoparticle-orbital chain complex.

[0082] 30 mg of the polyethyleneimine-modified upconversion nanoparticles obtained in step 3 were added to 20 mL of 4-hydroxyethylpiperazine ethanesulfonic acid buffer and sonicated until uniformly dispersed to obtain a polyethyleneimine-modified upconversion nanoparticle dispersion. 5 mg of sodium 4-(N-maleimidemethyl)cyclohexane-1-carboxylic acid-3-thio-N-succinimide ester was added to the obtained upconversion nanoparticle dispersion, and a second stirring reaction was carried out at 4 °C for 6 h to obtain a second stirring reaction mixture. After the reaction was completed, the product was collected by centrifugation at 12000 rpm for 10 min, and a third centrifugation and washing was performed using 4-hydroxyethylpiperazine ethanesulfonic acid buffer. This centrifugation and washing operation was repeated 3 times. The obtained product was redispersed in 20 mL of 4-hydroxyethylpiperazine ethanesulfonic acid buffer to obtain a maleimine-activated upconversion nanoparticle solution.

[0083] The obtained thiol-activated magnetic nanoparticle-orbital chain complex was added to the obtained maleimide-activated upconversion nanoparticle solution, and a third stirring reaction was carried out at 4 °C for 24 h. After the reaction, a third magnetic separation was performed by applying an external magnetic field, the product was collected, and a fourth washing was performed by adding 4-hydroxyethylpiperazine ethanesulfonic acid buffer. The above washing operation was repeated 3 times to obtain orbital nanoprobes (abbreviated as: TPs). The orbital nanoprobes were redispersed in 10 mL of 4-hydroxyethylpiperazine ethanesulfonic acid buffer and stored at 4 °C for later use.

[0084] Step 9: Construction of the upconversion nanowalking fluorescence sensor and detection steps:

[0085] In this embodiment, the sample to be tested is Pb(II) and As(III) in fish meat. 1.0 g of the edible part of the fish meat sample is weighed, homogenized, and then 5 mL of nitric acid solution is added. The sample is then transferred to a digestion vessel for digestion for 12-16 h. Subsequently, a first heating digestion is performed at 140-160℃ for 4 h. After naturally cooling to room temperature, a second heating is performed at 120℃ for 1 h to remove residual nitric acid. The sample is then filtered through a 0.22 μm filter membrane and diluted to 25 mL with ultrapure water to obtain the sample solution to be tested.

[0086] (1) Mix 100 μL (0.25 mg / mL) of the walking chain functionalized upconversion nanoparticles obtained in step 5 with 800 μL (2.5 mg / mL) of the orbital nanoprobes obtained in step 8, add the test sample containing lead ions (Pb(II)), and carry out the first incubation reaction at 37°C (for 60 min) in 4-hydroxyethylpiperazine ethanesulfonic acid buffer at pH 7.5. Lead ions (Pb(II)) act as a deoxyribozyme cofactor, driving the walking chain to recognize and catalyze the cleavage of ribonucleotide cleavage sites in the orbital chain, so that the polyethyleneimine modified upconversion nanoparticles are released from the surface of the magnetic nanoparticles into the supernatant. After the reaction, magnetic separation is performed by applying an external magnetic field to remove the uncleaved orbital nanoprobes, collect the supernatant, and use an upconversion fluorescence spectrometer to detect the fluorescence intensity at 801 nm to achieve quantitative detection of lead ions (Pb(II)).

[0087] Establishment of a lead ion (Pb(II)) standard curve: A series of lead ion (Pb(II)) standard solutions with concentrations ranging from 0.1 to 20000 μg / L were prepared. The sensing system and the lead ion (Pb(II)) standard solutions were in a one-to-one correspondence. The fluorescence intensity signal characteristic value at 801 nm was recorded, and a standard curve was established by fitting the logarithm of the lead ion (Pb(II)) concentration. Within the range of 0.5–5000 μg / L, the fluorescence intensity at 801 nm showed a good linear relationship with the logarithm of the lead ion (Pb(II)) concentration, with the linear equation y = 4373.8x + 4953.7, R² = 0.9929, and the detection limit was 0.289 μg / L.

[0088] like Figure 5 The figure shows the sensitivity analysis of the upconversion nanowalking fluorescence sensor prepared in this embodiment for the first target Pb(II). As can be seen from the figure, the fluorescence intensity at 801 nm gradually increases with the increase of lead ion (Pb(II)) concentration, and the linear relationship is good in the range of 0.5-5000 μg / L.

[0089] (2) 100 μL (0.25 mg / mL) of the walking nanoprobe obtained in step six was incubated with the test sample containing trivalent arsenic (As(III)) in 4-hydroxyethylpiperazine ethanesulfonic acid buffer at pH 7.5 at 37°C for the first incubation reaction. Trivalent arsenic (As(III)) preferentially binds to the aptamer sequence in the chain, inducing a conformational change in the chain, releasing the walking chain and the tetramethylrhodamine-labeled short-chain deoxynucleotide, relieving fluorescence quenching, and restoring upconversion fluorescence at 540 nm. Subsequently, 800 μL (2.5 mg / mL) of the orbital nanoprobe obtained in step eight and the first target solution (15 mg / L lead ion (Pb(II)) solution) were added to the system, and a second incubation reaction was carried out at 37°C for 60 min, driving the walker to run. After the reaction, magnetic separation was performed by an external magnetic field, the supernatant was collected, and upconversion fluorescence spectrometry was used to detect the fluorescence at 540 nm and 801 nm, respectively. The fluorescence intensity at nm was measured to achieve highly sensitive quantitative detection of trivalent arsenic (As(III)).

[0090] Establishment of trivalent arsenic (As(III)) standard curve: Trivalent arsenic (As(III)) standard solutions with concentrations of 0.05-500 μg / L were prepared. The walking nanoprobe (100 μL) obtained in step six was mixed with the trivalent arsenic (As(III)) standard solutions of each concentration in a one-to-one correspondence. The sensing system and the trivalent arsenic (As(III)) standard solutions were incubated at 37℃. After incubation, the orbital nanoprobe (800 μL) obtained in step eight and 15 mg / L lead ion (Pb(II)) solution were added to the system for a second incubation reaction and magnetic separation operation. The fluorescence spectra of the supernatant corresponding to each concentration were collected using an upconversion fluorescence spectrometer. The fluorescence intensity signal characteristic values ​​at 540 nm and 801 nm were recorded respectively. The standard curve was established by logarithmic fitting with the trivalent arsenic (As(III)) concentration. A linear regression was performed using the logarithm of trivalent arsenic (As(III)) concentration as the abscissa and the fluorescence intensity at the corresponding characteristic wavelength as the ordinate. A standard curve for the detection of trivalent arsenic (As(III)) at 540 nm was established within the range of 1-500 μg / L, with a linear equation of y = 564.99x + 2899.9, a correlation coefficient R² of 0.9893, and a detection limit of 0.86 μg / L. A standard curve for the detection of trivalent arsenic (As(III)) at 801 nm was also established within the range of 0.05-500 μg / L, with a linear equation of y = 4953x + 10799, and a correlation coefficient R² of [missing value]. 2 The fluorescence intensity was 0.9956, and the detection limit was 0.0197 μg / L. Compared with the As (III) detection in the first step, the fluorescence intensity and detection limit were significantly improved after the walker was activated, and the sensitivity was significantly improved compared with ordinary FRET sensors.

[0091] like Figure 6 As shown in the figure, the upconversion nanowalking fluorescence sensor prepared in this embodiment has a sensitivity analysis diagram for the second target As(III). It can be seen from the figure that in the range of 0.05-500 μg / L, the fluorescence intensity at 801 nm increases significantly with the increase of trivalent arsenic (As(III)) concentration, which is significantly higher than the sensor sensitivity at 540 nm.

[0092] Effect Experiment:

[0093] 1. Sensor specificity evaluation:

[0094] The walking nanoprobe obtained in step six of this embodiment was mixed with solutions of interfering substances, each with a concentration of 500 μg / L: pentavalent arsenic (As(V)), trivalent chromium (Cr(III)), divalent barium (Ba(II)), trivalent aluminum (Al(III)), divalent mercury (Hg(II)), monovalent sodium (Na(I)), and divalent cadmium (Cd(II)). The sensing system corresponded one-to-one with each interfering substance solution. Control groups containing only lead ions (Pb(II)), only trivalent arsenic (As(III)), and both lead ions (Pb(II)) and trivalent arsenic (As(III)) were also included. The orbital nanoprobe obtained in step eight and a 15 mg / L lead ion (Pb(II)) solution were added to each group system, and the mixtures were incubated at 37°C for 60 min in 4-hydroxyethylpiperazine ethanesulfonic acid buffer at pH 7.5. After the reaction, magnetic separation was performed using an external magnetic field, and the supernatant was collected. 540 nm of the supernatant was then detected using an upconversion fluorescence spectrometer. Fluorescence intensity at 801 nm and 801 nm; record the characteristic values ​​of each group of fluorescence intensity signals, compare the differences in fluorescence response caused by each interfering substance and the target substance, and evaluate the sensor’s specific recognition ability for lead ions (Pb(II)) and trivalent arsenic (As(III)).

[0095] 2. Sensor anti-interference evaluation:

[0096] The walking nanoprobe obtained in step six of this embodiment was incubated with a mixed solution containing 500 μg / L trivalent arsenic (As(III)) and various interfering substances (all at a concentration of 500 μg / L). The detection was completed according to the above steps. The obtained fluorescence intensity was compared with the detection result of the pure target without interfering substances to evaluate the influence of coexisting interfering substances on the detection result of trivalent arsenic (As(III)) and to verify the anti-interference ability of the sensor in complex sample matrices.

[0097] like Figure 7As shown in the figure, fluorescence at 540 nm only recovers when As(III) is present, but the walking probe has not yet been activated, so the fluorescence intensity at 801 nm is comparable to that of the blank control group. When As(III) and Pb(II) are added simultaneously, fluorescence at both 540 nm and 801 nm is significantly enhanced, indicating that As(III) triggers the Pb(II)-driven walker. If only Pb(II) is present in the system, the walking nanoprobe binds to Pb(II), but due to the chain barrier, the walker cannot be activated, resulting in no change in fluorescence at 540 nm and 801 nm. Only after the chain is released does Pb(II) induce a significant upconversion fluorescence response at 801 nm. The study found that other metal ions cannot trigger or activate the walker, and no significant change in fluorescence at 540 nm and 801 nm was observed. This indicates that the DNA nanowalker has good specificity and can distinguish As(III) and Pb(II) by fluorescence position specificity. To ensure the reliability of the DNA Walker in practical applications, the sensor's anti-interference capability was investigated. After mixing other metal ions with the target solution, cross-validation experiments were conducted to observe the effects of coexisting ions on the detection of As(III) and Pb(II). Furthermore, the coexisting interfering ions had no significant impact on the detection results of As(III) and Pb(II), demonstrating that the sensing platform possesses excellent specificity and anti-interference capabilities.

[0098] Example 2: Application of a three-dimensional upconversion nanowalking fluorescence sensor in the detection of Pb(II) and As(III) in Litopenaeus vannamei samples

[0099] The difference between this embodiment and Embodiment 1 is that the sample to be tested in this embodiment is Pb(II) and As(III) in a sample of whiteleg shrimp. The processing steps of the whiteleg shrimp sample are as follows: 1.0 g of the edible part of the whiteleg shrimp sample is weighed, homogenized, and 5 mL of nitric acid solution is added. Then, it is transferred to a digestion tank for digestion for 12-16 h. Subsequently, the first heating digestion is carried out at 140-160 ℃ for 4 h. After naturally cooling to room temperature, the second heating is carried out at 120 ℃ for 1 h to remove residual nitric acid. After filtration through a 0.22 μm filter membrane, the volume is adjusted to 25 mL with ultrapure water to obtain the sample solution to be tested.

[0100] Following the procedure described in step nine of Example 1, the obtained sample solution was added to the detection system. After incubation and magnetic separation, the fluorescence intensity at 540 nm and 801 nm of the supernatant was measured using an upconversion fluorescence spectrometer. The characteristic values ​​of the fluorescence intensity signal were recorded, and the results were substituted into the standard curve established in step ten to calculate the content of lead ions (Pb(II)) and trivalent arsenic (As(III)) in the sample. Furthermore, a parallel control experiment was conducted using inductively coupled plasma mass spectrometry to compare the detection results. When the significance level of the paired t-test was >0.05, the results of the two methods were considered to have no significant difference, indicating that the method of the present invention is accurate and reliable in actual sample detection.

[0101] Example 3: Application of a three-dimensional upconversion nanowalking fluorescence sensor in the detection of Pb(II) and As(III) in water samples

[0102] The difference between this embodiment and Embodiment 1 is that the sample to be tested in this embodiment is a water sample containing Pb(II) and As(III). The liquid water sample is processed according to step nine of Embodiment 1. The resulting sample solution is added to the detection system, and after incubation and magnetic separation, the fluorescence intensity at 540 nm and 801 nm of the supernatant is measured using an upconversion fluorescence spectrometer. The characteristic values ​​of the fluorescence intensity signal are recorded, and the results are substituted into the standard curve established in step ten to calculate the content of lead ions (Pb(II)) and trivalent arsenic (As(III)) in the sample. Furthermore, a parallel control experiment is conducted using inductively coupled plasma mass spectrometry to compare the results. When the significance level of the paired t-test is greater than 0.05, the results of the two methods are considered to have no significant difference, indicating that the method of this invention is accurate and reliable in actual sample detection.

[0103] The specific embodiments of the present invention disclosed above are merely illustrative of the invention. These embodiments do not exhaustively describe all details, nor do they limit the invention to the specific embodiments described. Many modifications and variations can be made based on the content of this specification. This specification selects and specifically describes these embodiments to better explain the principles and practical applications of the invention, thereby enabling those skilled in the art to better understand and utilize the invention.

Claims

1. A method for fabricating a three-dimensional upconversion nanowalking fluorescence sensor, characterized in that, The preparation method includes the following steps: S1. Preparation of oil-soluble upconversion nanoparticles: GdCl3·6H2O, YbCl3·6H2O and ErCl3·6H2O were dissolved in methanol and added to a flask containing oleic acid and 1-octadecene under argon protection. The first heating reaction was carried out until the solution was clear and transparent. After cooling to room temperature, 10 mL of methanol solution containing sodium hydroxide and ammonium fluoride was added dropwise. The first stirring reaction was carried out in a closed environment. Then, the temperature was raised to carry out a second heating reaction to evaporate the residual methanol. The temperature was raised again to carry out a third heating reaction. After the reaction was completed and cooled, the mixture was collected by centrifugation, washed with a mixed solution of ethanol and cyclohexane with a volume ratio of 1:1, centrifuged, and vacuum dried to obtain oil-soluble upconversion nanoparticles. S2. Preparation of carboxylated upconversion nanoparticles: The oil-soluble upconversion nanoparticles obtained in S1 were dissolved in a mixed solvent of chloroform and toluene with a volume ratio of 2:3 under ultrasonic conditions. An aqueous solution of polyacrylic acid was added, and the mixture was stirred and washed with ethanol to obtain carboxylated upconversion nanoparticles. S3. Preparation of polyethyleneimine-modified upconversion nanoparticles: Polyethyleneimine was dissolved in ethylene glycol, and sodium chloride and rare earth chlorides GdCl3·6H2O, YbCl3·6H2O and TmCl3·6H2O were added and stirred until transparent. Ammonium fluoride was dissolved in ethylene glycol and added dropwise. After stirring at room temperature, the mixture was transferred to a reaction vessel and heated. After cooling, the mixture was collected by centrifugation, washed with ethanol, and dried under vacuum to obtain polyethyleneimine-modified upconversion nanoparticles. S4. Preparation of carboxylated magnetic nanoparticles: Ferric chloride hexahydrate and trisodium citrate were dissolved in ethylene glycol, sodium acetate was added and stirred, and then the mixture was transferred to a reaction vessel and heated. The magnetic nanoparticles were separated by an external magnetic field and washed with ethanol and ultrapure water to obtain carboxylated iron oxide magnetic nanoparticles. S5. Preparation of walking chain functionalized upconversion nanoparticles: The carboxylated upconversion nanoparticles obtained in S2 were dispersed in 4-hydroxyethylpiperazine ethanesulfonic acid buffer, and 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride and N-hydroxythiosuccinimide were added to activate the carboxyl groups. After incubation, the nanoparticles were centrifuged and washed. The amino-modified walking chain was added, stirred, centrifuged and washed to obtain walking chain functionalized upconversion nanoparticles. The walking chain contains a first target-responsive deoxyribozyme sequence, which can catalyze the cleavage of the substrate chain with the assistance of the first target. S6. Preparation of walking nanoprobes: The walking chain functionalized upconversion nanoparticles obtained in S5, the chain containing the second target-specific aptamer sequence, and the short-chain deoxynucleotide labeled with a fluorescence quencher group were heated and mixed separately, annealed, and then cooled. The three components were assembled according to the base complementary pairing principle, so that the chain completely closed the walking chain. After assembly, the fluorescence quencher group approached the upconversion nanoparticles and generated a fluorescence resonance energy transfer effect, quenching the upconversion fluorescence at the corresponding characteristic wavelength, and the walker was in a quiescent state. When the second target was present, the chain conformation changed and the walking chain was released, the fluorescence quenching was lifted and the walker was activated, thus obtaining the walking nanoprobes. S7. Preparation of magnetic nanoparticle-orbital chain complex: 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride, N-hydroxythiosuccinimide, and carboxylated iron oxide magnetic nanoparticles obtained in S4 were mixed, the carboxyl groups were activated by low-temperature stirring, and after magnetic separation and washing, the 3'-terminal amino-modified orbital chain was added for incubation. Unbound orbital chains were removed by magnetic separation, and after washing, the mixture was resuspended in 4-hydroxyethylpiperazine ethanesulfonic acid buffer to obtain the magnetic nanoparticle-orbital chain complex. The orbital chain contains ribonucleotide cleavage sites and can be used as a substrate chain for deoxyribozymes to be catalytically cleaved during the operation of the walker. S8. Preparation of orbital nanoprobes: The magnetic nanoparticle-orbital chain complex obtained in S7 was added to a tris(2-carboxyethyl)phosphine hydrochloride solution to activate the 5' end thiol group of the orbital chain, thus obtaining the thiol-activated magnetic nanoparticle-orbital chain complex. The polyethyleneimine-modified upconversion nanoparticles obtained in S3 were added to 4-hydroxyethylpiperazine ethanesulfonic acid buffer, sonicated, and then 4-(N-maleimidemethyl)cyclohexane-1-carboxylic acid-3-thio-N-succinimide ester sodium salt was added. The precipitate was collected by centrifugation and washed with 4-hydroxyethylpiperazine ethanesulfonic acid buffer by centrifugation to obtain a maleimine-activated upconversion nanoparticle solution. The thiol-activated magnetic nanoparticle-orbit chain complex was added to a maleimide-activated upconversion nanoparticle solution for reaction, so that the upconversion nanoparticles were connected to the 5' end of the orbital chain through thioether bonds to obtain orbital nanoprobes. S9. A three-dimensional upconversion nano-walking fluorescent sensor is constructed using the walking chain functionalized upconversion nanoparticles obtained in S5, the walking nanoprobes obtained in S6, and the orbital nanoprobes obtained in S8. The walking chain sequence is shown in SEQ ID NO.1; The chain sequence is shown in SEQ ID NO.2; The short chain sequence is shown in SEQ ID NO.3; The orbital chain sequence is shown in SEQ ID NO.

4.

2. The preparation method according to claim 1, characterized in that, The molar ratio of GdCl3·6H2O, YbCl3·6H2O, and ErCl3·6H2O in S1 is 0.80:0.18:0.02; the amount of methanol used is 5 mL, the amount of oleic acid used is 4 mL, and the amount of 1-octadecene used is 9 mL; the first heating reaction temperature is 160℃ and the time is 30 min; the molar amounts of sodium hydroxide and ammonium fluoride in the 10 mL methanol solution are 2.5 mmol and 4 mmol, respectively; the first stirring reaction temperature is 50℃ and the time is 40 min; the second heating reaction temperature is 100℃; the third heating reaction temperature is 300℃ and the time is 1 h; the centrifugation speed is 10000 rpm and the time is 10 min; the vacuum drying temperature is 60℃.

3. The preparation method according to claim 1, characterized in that, The amount of oil-soluble upconversion nanoparticles used in S2 is 50 mg; the amount of the chloroform and toluene mixed solvent is 10 mL; the amount of the polyacrylic acid aqueous solution is 15 mL, wherein the mass of polyacrylic acid is 400 mg; the stirring time is 24 h; and the concentration of the ethanol solution is 50%.

4. The preparation method according to claim 1, characterized in that, In S3, the amount of polyethyleneimine used is 0.4 g, dissolved in 18 mL of ethylene glycol; the molar ratio of sodium chloride, GdCl3·6H2O, YbCl3·6H2O, and TmCl3·6H2O is 2.402:0.72:0.474:0.006; the amount of ammonium fluoride used is 231.1 mg, dissolved in 12 mL of ethylene glycol; the stirring time at room temperature is 10 min; the heating temperature of the reaction vessel is 200℃ for 1.5 h; the concentration of the ethanol solution is 50%; and the vacuum drying temperature is 60℃ for 8 h.

5. The preparation method according to claim 1, characterized in that, In S4, the amounts of ferric chloride hexahydrate and trisodium citrate are 4 mmol and 1.36 mmol, respectively; the amount of ethylene glycol solution is 20 mL; the amount of sodium acetate is 1.2 g; the heating temperature of the reactor is 198℃ and the reaction time is 16 h.

6. The preparation method according to claim 1, characterized in that, The amount of carboxylated upconversion nanoparticles in S5 is 10 mg, and the amount of 4-hydroxyethylpiperazine ethanesulfonic acid buffer is 10 mL; the amount of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride is 3 mg, and the amount of N-hydroxythiosuccinimide is 1.5 mg; the amount of amino-modified walking chain is 260 μL; the first target includes, but is not limited to, metal ions, organic pollutants, biotoxins, and target analytes with DNAzyme-responsive properties.

7. The preparation method according to claim 1, characterized in that, The molar ratio of the walking chain functionalized upconversion nanoparticles to the chain in S6 is 1:1.2; the amount of the short-chain deoxynucleotide solution is 6 μM; the heating temperature is 95℃ and the heating time is 2 min; the annealing temperature is 95℃ and the annealing time is 5 min; the cooling endpoint is 25℃; the second target includes, but is not limited to, metal ions, pesticide residues, biotoxins, antibiotics, and target analytes with aptamer recognition characteristics.

8. The preparation method according to claim 1, characterized in that, The concentration of the 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride solution in S7 is 0.25 mg / mL; the concentration of the N-hydroxythiosuccinimide solution is 0.25 mg / mL; the amount of the carboxylated magnetite nanoparticles is 250 μL and the concentration is 5 mg / mL; the amount of the orbital chain is 44 μL; the incubation temperature is 4℃ and the time is 12 h; the amount of the 4-hydroxyethylpiperazine ethanesulfonic acid buffer used for resuspension is 1 mL.

9. The preparation method according to claim 1, characterized in that, The magnetic nanoparticle-orbital chain complex and the tris(2-carboxyethyl)phosphine hydrochloride solution in S8 are mixed in an appropriate volume ratio of 1:1, and the concentration of the tris(2-carboxyethyl)phosphine hydrochloride solution is 3 mM; the amount of the polyethyleneimine-modified upconversion nanoparticles is 30 mg; the amount of the 4-hydroxyethylpiperazine ethanesulfonic acid buffer is 20 mL; and the amount of the sodium salt of 4-(N-maleiminomethyl)cyclohexane-1-carboxylic acid-3-thio-N-succinimidyl ester is 5 mg.

10. A three-dimensional upconversion nanowalking fluorescence sensor, characterized in that, The three-dimensional upconversion nanowalking fluorescent sensor is obtained by the preparation method described in any one of claims 1 to 9.

11. The application of the three-dimensional upconversion nanowalking fluorescence sensor according to claim 10 in heavy metal detection, characterized in that, The method of using the three-dimensional upconversion nanowalking fluorescence sensor in the application includes the following steps: (1) Establishment of the standard curve of the first target: The walking chain functionalized upconversion nanoparticles in the three-dimensional upconversion nanowalking fluorescence sensor of claim 10 are mixed with the orbital nanoprobes, and the test sample containing the first target is added. The first incubation reaction is carried out in the buffer solution. After the reaction, magnetic separation is performed by applying an external magnetic field to remove the uncut orbital nanoprobes. The supernatant is collected, and the fluorescence intensity at the characteristic wavelength is detected by an upconversion fluorescence spectrometer to realize the quantitative detection of the first target. (2) Establishment of the standard curve of the second target: The test sample containing the second target is added to the walking nanoprobe in the three-dimensional upconversion nanowalking fluorescence sensor of claim 10, and the first incubation reaction is carried out in the buffer solution; then the orbital nanoprobe and the first target solution are added to the system, and the second incubation reaction is carried out to drive the walker to run; after the reaction is completed, magnetic separation is carried out by an external magnetic field, the supernatant is collected, and the fluorescence intensity at two characteristic wavelengths is detected by an upconversion fluorescence spectrometer to achieve highly sensitive quantitative detection of the second target.

12. The application according to claim 11, characterized in that, (1) The mixing volume ratio of the walking chain functionalized upconversion nanoparticles to the orbital nanoprobes is 1:8; the first incubation reaction temperature is 37℃; (2) The mixing volume ratio of the walking chain functionalized upconversion nanoparticles to the orbital nanoprobes is 1:8; the temperature of the first incubation reaction is 37°C; the buffer solution is 4-hydroxyethylpiperazine ethanesulfonic acid buffer with pH 7.5; the temperature of the second incubation reaction is 37°C and the incubation time is 60 min.

13. The application according to claim 11, characterized in that, The heavy metals include, but are not limited to, Pb(II) and As(III); the samples to be tested include, but are not limited to, aquatic products, meat products, dairy products and environmental water samples; if the sample to be tested is a liquid sample, it is directly tested after coarse filtration; if the sample to be tested is a solid sample, it is tested after homogenization and acid digestion pretreatment.

14. The application according to claim 11, characterized in that, The application can be extended to single or multiple detection of various target analytes such as heavy metal ions, pesticide residues, biotoxins, and antibiotics by replacing the nucleic acid sequence and / or deoxyribozyme sequence of the chain probe in the three-dimensional upconversion nanowalking fluorescence sensor.

Images